Starting /dee2/code/volunteer_pipeline.sh SRR7171118 current disk space = 3085199454208 free memory = 1579973504 SRR7171118 SRAfilesize 6fb9d3dd31d12de0ca695a7cb6e55132 SRR7171118.sra SRR7171118.sra file validated SRR7171118 is paired end SRR7171118 is conventional basespace SRR7171118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.38025 18.0 18.0 28.0 18.0 32.0 2 30.25775 31.0 29.0 33.0 27.0 33.0 3 31.658 33.0 31.0 33.0 29.0 33.0 4 32.3375 33.0 33.0 33.0 31.0 33.0 5 33.02925 33.0 33.0 34.0 33.0 34.0 6 36.8425 38.0 37.0 38.0 35.0 38.0 7 37.22225 38.0 38.0 38.0 36.0 38.0 8 37.46625 38.0 38.0 38.0 37.0 38.0 9 37.47425 38.0 38.0 38.0 37.0 38.0 10-14 37.46035 38.0 38.0 38.0 37.0 38.0 15-19 37.45174999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.29350000000001 38.0 38.0 38.0 36.6 38.0 25-29 37.38175 38.0 38.0 38.0 37.0 38.0 30-34 37.35095 38.0 38.0 38.0 37.0 38.0 35-39 37.365899999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.28345 38.0 38.0 38.0 37.0 38.0 45-49 37.21855000000001 38.0 38.0 38.0 36.6 38.0 50-54 36.5178 38.0 37.6 38.0 33.6 38.0 55-59 35.438900000000004 38.0 35.4 38.0 28.8 38.0 60-64 36.792649999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.8625 38.0 38.0 38.0 35.0 38.0 70-74 36.66475 38.0 38.0 38.0 34.4 38.0 75-79 36.4396 38.0 38.0 38.0 34.0 38.0 80-84 36.36605000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.0596 38.0 37.0 38.0 33.4 38.0 90-94 35.8605 38.0 37.0 38.0 32.4 38.0 95-99 35.82285 38.0 37.0 38.0 32.6 38.0 100-104 35.822050000000004 38.0 37.0 38.0 32.8 38.0 105-109 35.688700000000004 38.0 37.0 38.0 32.0 38.0 110-114 35.40585 38.0 36.2 38.0 30.2 38.0 115-119 34.8635 38.0 35.4 38.0 27.6 38.0 120-124 34.8072 38.0 35.0 38.0 27.8 38.0 125-129 34.67805 38.0 35.0 38.0 27.2 38.0 130-134 31.828650000000003 36.0 27.8 38.0 17.6 38.0 135-139 33.27015000000001 37.8 34.0 38.0 18.6 38.0 140-144 32.83970000000001 37.8 33.4 38.0 14.8 38.0 145-149 31.868299999999998 36.8 31.8 38.0 11.2 38.0 150-151 27.167375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 0.0 10 2.0 11 1.0 12 0.0 13 5.0 14 0.0 15 4.0 16 6.0 17 1.0 18 10.0 19 16.0 20 0.0 21 5.0 22 3.0 23 12.0 24 10.0 25 13.0 26 12.0 27 24.0 28 32.0 29 38.0 30 63.0 31 73.0 32 97.0 33 164.0 34 281.0 35 509.0 36 1329.0 37 1286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.04962327877371 12.808521693946478 12.808521693946478 33.33333333333333 2 21.160580290145074 16.783391695847925 34.71735867933967 27.33866933466733 3 17.925 21.475 30.475 30.125 4 20.825 29.95 26.224999999999998 23.0 5 22.400000000000002 32.9 25.5 19.2 6 18.525 34.75 26.6 20.125 7 13.100000000000001 24.55 43.5 18.85 8 16.825000000000003 25.025 32.25 25.900000000000002 9 17.775 23.425 33.75 25.05 10-14 20.09 29.330000000000002 27.224999999999998 23.355 15-19 19.615 28.355000000000004 28.265 23.765 20-24 20.03 28.060000000000002 28.485 23.425 25-29 19.695 28.89 28.03 23.385 30-34 19.345000000000002 29.715000000000003 27.665 23.275000000000002 35-39 19.57 28.634999999999998 27.495000000000005 24.3 40-44 20.005 28.715000000000003 28.005000000000003 23.275000000000002 45-49 20.4 28.335 27.92 23.345 50-54 20.544999999999998 28.38 27.939999999999998 23.135 55-59 19.935 27.485 28.65 23.93 60-64 20.055 27.834999999999997 28.175 23.935000000000002 65-69 20.11 28.73 27.894999999999996 23.265 70-74 20.0 28.4 27.76 23.84 75-79 20.335 28.884999999999998 27.500000000000004 23.28 80-84 20.115 28.439999999999998 27.415 24.03 85-89 20.380000000000003 28.015 28.355000000000004 23.25 90-94 20.39 28.494999999999997 27.32 23.794999999999998 95-99 19.725 28.63 27.145000000000003 24.5 100-104 20.855 28.12 27.61 23.415 105-109 20.669999999999998 28.299999999999997 27.839999999999996 23.189999999999998 110-114 20.625 27.925 27.950000000000003 23.5 115-119 20.794999999999998 28.575 27.455000000000002 23.175 120-124 20.895 28.689999999999998 26.93 23.485 125-129 21.2 28.02 27.389999999999997 23.39 130-134 20.549999999999997 28.560000000000002 26.85 24.04 135-139 21.044999999999998 28.26 26.465 24.23 140-144 20.685000000000002 28.7 26.58 24.035 145-149 20.925 28.395 26.540000000000003 24.14 150-151 20.025000000000002 29.4875 26.125 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 1.0 4 1.5 5 2.0 6 3.0 7 2.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 1.0 21 3.0 22 3.0 23 3.0 24 3.5 25 3.5 26 8.0 27 14.0 28 15.0 29 19.5 30 23.5 31 34.0 32 44.5 33 56.0 34 79.5 35 89.5 36 103.5 37 114.5 38 122.0 39 160.0 40 188.5 41 192.5 42 215.5 43 240.0 44 235.0 45 234.0 46 232.0 47 210.5 48 199.0 49 194.0 50 176.5 51 141.5 52 119.5 53 109.5 54 97.0 55 78.5 56 58.0 57 51.0 58 44.5 59 25.0 60 9.0 61 10.5 62 8.0 63 4.0 64 2.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88097660223805 97.2 2 0.9409969481180062 1.8499999999999999 3 0.1271617497456765 0.375 4 0.0 0.0 5 0.025432349949135298 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025432349949135298 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 13 (97% over 38bp) GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.2999999999999998 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.6875 0.0 0.0 0.0 0.0 110-111 2.975 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.112500000000001 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 4.987500000000001 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.9625 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.2 0.0 0.0 0.0 0.0 134-135 8.962499999999999 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 10.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCTGC 10 0.006832588 144.9875 145 >>END_MODULE SRR7171118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5575 33.0 33.0 34.0 32.0 34.0 2 32.8265 33.0 33.0 34.0 32.0 34.0 3 30.58675 33.0 31.0 34.0 18.0 34.0 4 32.22075 33.0 32.0 34.0 28.0 34.0 5 32.74275 33.0 33.0 34.0 32.0 34.0 6 37.32575 38.0 38.0 38.0 37.0 38.0 7 37.2875 38.0 38.0 38.0 37.0 38.0 8 37.37425 38.0 38.0 38.0 38.0 38.0 9 37.43975 38.0 38.0 38.0 38.0 38.0 10-14 37.39545 38.0 38.0 38.0 38.0 38.0 15-19 37.30595 38.0 38.0 38.0 37.4 38.0 20-24 37.11925000000001 38.0 38.0 38.0 36.8 38.0 25-29 37.03425 38.0 38.0 38.0 36.4 38.0 30-34 37.1699 38.0 38.0 38.0 37.0 38.0 35-39 37.2633 38.0 38.0 38.0 37.0 38.0 40-44 37.19645 38.0 38.0 38.0 37.0 38.0 45-49 37.22355 38.0 38.0 38.0 37.0 38.0 50-54 37.2456 38.0 38.0 38.0 37.0 38.0 55-59 37.203649999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.13334999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.10105 38.0 38.0 38.0 36.8 38.0 70-74 37.0542 38.0 38.0 38.0 36.2 38.0 75-79 37.0599 38.0 38.0 38.0 36.4 38.0 80-84 36.72455 38.0 38.0 38.0 35.6 38.0 85-89 36.654700000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.7429 38.0 38.0 38.0 36.0 38.0 95-99 36.650150000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.3589 38.0 38.0 38.0 34.2 38.0 105-109 36.12575 38.0 38.0 38.0 34.0 38.0 110-114 34.547200000000004 37.8 34.4 38.0 26.0 38.0 115-119 35.4107 38.0 36.2 38.0 31.0 38.0 120-124 35.6872 38.0 37.0 38.0 32.4 38.0 125-129 35.481550000000006 38.0 36.4 38.0 31.4 38.0 130-134 35.18185 38.0 36.0 38.0 29.4 38.0 135-139 34.793749999999996 38.0 35.4 38.0 28.8 38.0 140-144 34.11465 38.0 33.6 38.0 24.8 38.0 145-149 33.36664999999999 38.0 33.0 38.0 20.6 38.0 150-151 28.122999999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 4.0 11 2.0 12 1.0 13 3.0 14 3.0 15 1.0 16 6.0 17 5.0 18 5.0 19 6.0 20 13.0 21 3.0 22 5.0 23 9.0 24 7.0 25 6.0 26 13.0 27 13.0 28 19.0 29 21.0 30 38.0 31 42.0 32 70.0 33 103.0 34 143.0 35 264.0 36 806.0 37 2377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 23.549999999999997 11.125 21.625 2 26.88844422211106 25.212606303151574 31.265632816408207 16.633316658329164 3 21.510755377688845 27.088544272136065 32.1160580290145 19.28464232116058 4 23.81190595297649 34.092046023011505 23.386693346673336 18.70935467733867 5 23.58679339669835 37.16858429214607 21.68584292146073 17.55877938969485 6 21.5 36.8 22.7 19.0 7 20.325 20.625 38.35 20.7 8 19.75 26.3 27.325 26.625 9 21.9 24.8 28.425 24.875 10-14 23.705000000000002 29.125 25.419999999999998 21.75 15-19 23.549999999999997 28.355000000000004 27.375 20.72 20-24 23.874774954991 28.83076615323065 27.135427085417085 20.15903180636127 25-29 23.390847711927982 28.892223055763942 26.981745436359088 20.735183795948984 30-34 23.315 28.610000000000003 27.58 20.495 35-39 23.73 28.285 27.185 20.8 40-44 23.807380738073807 27.852785278527854 27.577757775777577 20.762076207620762 45-49 22.869999999999997 28.42 27.560000000000002 21.15 50-54 23.685000000000002 27.744999999999997 27.779999999999998 20.79 55-59 23.915 27.6 27.810000000000002 20.674999999999997 60-64 23.75 27.779999999999998 28.060000000000002 20.41 65-69 23.8973897389739 27.022702270227022 28.027802780278027 21.052105210521052 70-74 23.646182309115456 28.666433321666084 26.796339816990848 20.891044552227612 75-79 23.74737473747375 28.08780878087809 27.27272727272727 20.89208920892089 80-84 23.63472694538908 27.915583116623328 28.060612122424484 20.389077815563112 85-89 23.435 28.015 27.779999999999998 20.77 90-94 23.72237223722372 28.172817281728175 27.487748774877485 20.617061706170617 95-99 24.115000000000002 28.51 26.840000000000003 20.535 100-104 24.224999999999998 27.939999999999998 27.68 20.155 105-109 23.85977195439088 28.060612122424484 27.515503100620126 20.56411282256451 110-114 24.205 28.595 27.425 19.775000000000002 115-119 24.491224561228062 28.41142057102855 27.44137206860343 19.655982799139956 120-124 24.376218810940546 28.86644332216611 27.211360568028404 19.545977298864944 125-129 24.26242624262426 28.417841784178417 27.27272727272727 20.047004700470048 130-134 24.555 28.435 27.43 19.580000000000002 135-139 25.147514751475146 28.26282628262826 26.837683768376834 19.75197519751975 140-144 24.96624831241562 28.63643182159108 26.631331566578332 19.76598829941497 145-149 26.02 28.89 25.55 19.54 150-151 25.9625 29.1625 26.437500000000004 18.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 2.5 24 1.0 25 6.0 26 9.0 27 6.0 28 8.5 29 11.0 30 13.5 31 19.0 32 23.5 33 33.5 34 54.5 35 75.0 36 82.5 37 105.0 38 137.5 39 155.5 40 184.5 41 211.5 42 230.0 43 252.5 44 253.0 45 246.5 46 241.0 47 238.5 48 232.5 49 201.5 50 173.5 51 147.0 52 127.5 53 106.0 54 85.5 55 83.5 56 73.5 57 50.0 58 33.0 59 23.0 60 14.5 61 12.0 62 11.5 63 6.5 64 1.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.025 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.005 75-79 0.01 80-84 0.02 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.01 130-134 0.0 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87812340642529 96.95 2 0.790413054563998 1.55 3 0.17848036715961244 0.525 4 0.05099439061703213 0.2 5 0.0764915859255482 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.525 0.0 0.0 0.0 0.0 120-121 5.0625 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.3 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.8 0.0 0.0 0.0 0.0 130-131 8.375 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.7375 0.0 0.0 0.0 0.0 136-137 10.4 0.0 0.0 0.0 0.0 138-139 11.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGA 10 0.006830828 145.0 6 >>END_MODULE Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644884 spots for SRR7171118.sra Written 644884 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra Read 644875 spots for SRR7171118.sra Written 644875 spots for SRR7171118.sra SRR ids: ['SRR7171118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gkx5eh7d SRR7171118.sra spots: 12897509 blocks: [[1, 644875], [644876, 1289750], [1289751, 1934625], [1934626, 2579500], [2579501, 3224375], [3224376, 3869250], [3869251, 4514125], [4514126, 5159000], [5159001, 5803875], [5803876, 6448750], [6448751, 7093625], [7093626, 7738500], [7738501, 8383375], [8383376, 9028250], [9028251, 9673125], [9673126, 10318000], [10318001, 10962875], [10962876, 11607750], [11607751, 12252625], [12252626, 12897509]] SRR7171118 file size 4348842 SRR7171118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171118 SRR7171118_1.fastq SRR7171118_2.fastq Input file: SRR7171118_1.fastq Paired file: SRR7171118_2.fastq trimmed: SRR7171118-trimmed-pair1.fastq, SRR7171118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:38:17 2025 >> started Fri Feb 14 06:38:31 2025 >> done (13.488s) 12897509 read pairs processed; of these: 13240 ( 0.10%) short read pairs filtered out after trimming by size control 51160 ( 0.40%) empty read pairs filtered out after trimming by size control 12833109 (99.50%) read pairs available; of these: 7767045 (60.52%) trimmed read pairs available after processing 5066064 (39.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 15 0.00% 20 15 0.00% 21 22 0.00% 22 19 0.00% 23 27 0.00% 24 34 0.00% 25 31 0.00% 26 32 0.00% 27 36 0.00% 28 25 0.00% 29 27 0.00% 30 21 0.00% 31 164 0.00% 32 24 0.00% 33 49 0.00% 34 21 0.00% 35 24 0.00% 36 25 0.00% 37 56 0.00% 38 58 0.00% 39 33 0.00% 40 51 0.00% 41 40 0.00% 42 38 0.00% 43 53 0.00% 44 52 0.00% 45 63 0.00% 46 84 0.00% 47 110 0.00% 48 123 0.00% 49 127 0.00% 50 140 0.00% 51 169 0.00% 52 186 0.00% 53 224 0.00% 54 224 0.00% 55 246 0.00% 56 277 0.00% 57 287 0.00% 58 374 0.00% 59 395 0.00% 60 506 0.00% 61 533 0.00% 62 603 0.00% 63 661 0.01% 64 741 0.01% 65 792 0.01% 66 803 0.01% 67 882 0.01% 68 1066 0.01% 69 1192 0.01% 70 1306 0.01% 71 1515 0.01% 72 1784 0.01% 73 1912 0.01% 74 2130 0.02% 75 2491 0.02% 76 3332 0.03% 77 4017 0.03% 78 3522 0.03% 79 3789 0.03% 80 4136 0.03% 81 4775 0.04% 82 5266 0.04% 83 6065 0.05% 84 7489 0.06% 85 8376 0.07% 86 9195 0.07% 87 10077 0.08% 88 10651 0.08% 89 10768 0.08% 90 11333 0.09% 91 12237 0.10% 92 12450 0.10% 93 13915 0.11% 94 14371 0.11% 95 15816 0.12% 96 15851 0.12% 97 16084 0.13% 98 16515 0.13% 99 17581 0.14% 100 19337 0.15% 101 19134 0.15% 102 20757 0.16% 103 22275 0.17% 104 23451 0.18% 105 25331 0.20% 106 25766 0.20% 107 26051 0.20% 108 26611 0.21% 109 28880 0.23% 110 29635 0.23% 111 29901 0.23% 112 31184 0.24% 113 34544 0.27% 114 34111 0.27% 115 35933 0.28% 116 36979 0.29% 117 36737 0.29% 118 37830 0.29% 119 38279 0.30% 120 39673 0.31% 121 39910 0.31% 122 41131 0.32% 123 43173 0.34% 124 45067 0.35% 125 45349 0.35% 126 46636 0.36% 127 47718 0.37% 128 49196 0.38% 129 50478 0.39% 130 51571 0.40% 131 53341 0.42% 132 55593 0.43% 133 59021 0.46% 134 61528 0.48% 135 66232 0.52% 136 68744 0.54% 137 73015 0.57% 138 77381 0.60% 139 82257 0.64% 140 87768 0.68% 141 97608 0.76% 142 108169 0.84% 143 123667 0.96% 144 146601 1.14% 145 177545 1.38% 146 221484 1.73% 147 304389 2.37% 148 463104 3.61% 149 888871 6.93% 150 3207544 24.99% 151 5066064 39.48% 12833109 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=17 prefix-density=0.53 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=55.51 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.4 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=18.95 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=ACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR7171118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:39:16 Started mapping on | Feb 14 06:39:17 Finished on | Feb 14 06:41:16 Mapping speed, Million of reads per hour | 388.23 Number of input reads | 12833109 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11606206 Uniquely mapped reads % | 90.44% Average mapped length | 290.31 Number of splices: Total | 10758306 Number of splices: Annotated (sjdb) | 10528765 Number of splices: GT/AG | 10552270 Number of splices: GC/AG | 166560 Number of splices: AT/AC | 7515 Number of splices: Non-canonical | 31961 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295831 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 38992 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.78% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 949600 949600 949600 N_multimapping 295831 295831 295831 N_noFeature 453725 11378162 527746 N_ambiguous 228047 741 73671 UnstrandedReadsAssigned:10924434 PositiveStrandReadsAssigned:227303 NegativeStrandReadsAssigned:11004789 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171118-trimmed-pair1.fastq SRR7171118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,833,109 reads, 11,002,010 reads pseudoaligned [quant] estimated average fragment length: 223.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7171118.ke.tsv 34699 SRR7171118.se.tsv 87100 total ==> SRR7171118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.62 429 16.9636 Potri.005G024800.1.v4.1 1035 812.62 215 18.7856 Potri.004G059700.1.v4.1 961 738.649 30 2.88375 Potri.007G009000.2.v4.1 1416 1193.62 0 0 Potri.003G141000.2.v4.1 2943 2720.62 605 15.7893 Potri.016G087400.1.v4.1 270 89.6317 864 684.426 Potri.015G069301.1.v4.1 564 344.717 0 0 Potri.010G195200.1.v4.1 1773 1550.62 14 0.641058 Potri.012G127500.1.v4.1 977 754.63 178 16.7479 ==> SRR7171118.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 810 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR7171118 completed mapping pipeline successfully