Starting /dee2/code/volunteer_pipeline.sh SRR7171120 current disk space = 3085452201984 free memory = 1469719980 SRR7171120 SRAfilesize 3ae54b8ee9da24a1631752fda8d4c1dc SRR7171120.sra SRR7171120.sra file validated SRR7171120 is paired end SRR7171120 is conventional basespace SRR7171120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.75525 32.0 18.0 33.0 18.0 33.0 2 24.8665 25.0 18.0 30.0 18.0 33.0 3 27.57625 29.0 25.0 31.0 18.0 33.0 4 30.83525 31.0 30.0 33.0 28.0 33.0 5 32.15075 33.0 32.0 33.0 32.0 33.0 6 36.4525 38.0 36.0 38.0 34.0 38.0 7 36.96175 38.0 37.0 38.0 35.0 38.0 8 37.474 38.0 38.0 38.0 37.0 38.0 9 37.591 38.0 38.0 38.0 37.0 38.0 10-14 37.569849999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.598699999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.5139 38.0 38.0 38.0 37.6 38.0 25-29 37.4934 38.0 38.0 38.0 37.6 38.0 30-34 37.52255 38.0 38.0 38.0 37.8 38.0 35-39 37.33125 38.0 38.0 38.0 37.0 38.0 40-44 37.41455 38.0 38.0 38.0 37.0 38.0 45-49 37.40295 38.0 38.0 38.0 37.0 38.0 50-54 36.7934 38.0 38.0 38.0 34.6 38.0 55-59 37.1517 38.0 38.0 38.0 36.0 38.0 60-64 37.128550000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.0797 38.0 38.0 38.0 36.0 38.0 70-74 36.948249999999994 38.0 38.0 38.0 35.6 38.0 75-79 36.9106 38.0 38.0 38.0 35.6 38.0 80-84 36.834050000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.6267 38.0 38.0 38.0 34.8 38.0 90-94 36.3596 38.0 37.6 38.0 33.8 38.0 95-99 36.479499999999994 38.0 37.4 38.0 34.0 38.0 100-104 36.31945 38.0 37.4 38.0 33.8 38.0 105-109 36.22485 38.0 37.0 38.0 33.8 38.0 110-114 36.004999999999995 38.0 37.0 38.0 32.8 38.0 115-119 35.580349999999996 38.0 36.0 38.0 30.6 38.0 120-124 35.44975 38.0 36.0 38.0 30.6 38.0 125-129 35.2567 38.0 35.6 38.0 29.4 38.0 130-134 32.1743 36.0 28.6 38.0 21.6 38.0 135-139 34.265 38.0 33.8 38.0 25.2 38.0 140-144 33.7418 38.0 33.6 38.0 22.0 38.0 145-149 32.96965 38.0 33.0 38.0 18.6 38.0 150-151 28.733125 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 3.0 15 1.0 16 0.0 17 4.0 18 0.0 19 2.0 20 5.0 21 3.0 22 7.0 23 8.0 24 4.0 25 9.0 26 12.0 27 18.0 28 20.0 29 34.0 30 43.0 31 61.0 32 67.0 33 118.0 34 221.0 35 452.0 36 1331.0 37 1570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.62264150943396 12.679245283018867 8.553459119496855 27.144654088050313 2 24.05 16.025 35.099999999999994 24.825 3 20.025000000000002 24.075 27.450000000000003 28.449999999999996 4 22.675 32.15 24.25 20.925 5 23.075000000000003 34.325 25.35 17.25 6 18.375 35.325 26.5 19.8 7 14.174999999999999 23.200000000000003 45.074999999999996 17.549999999999997 8 17.299999999999997 23.575 32.6 26.525 9 18.275 22.525000000000002 33.75 25.45 10-14 20.445 29.675 26.655 23.225 15-19 20.48 28.595 27.889999999999997 23.035 20-24 20.435 28.52 28.27 22.775000000000002 25-29 19.8 28.735 28.76 22.705000000000002 30-34 19.845 28.825 27.925 23.405 35-39 20.07 28.465 28.155 23.31 40-44 20.145 28.34 28.025 23.49 45-49 20.11 29.01 27.85 23.03 50-54 20.44 28.645 27.815 23.1 55-59 20.445 28.1 28.185 23.27 60-64 20.52 28.58 27.400000000000002 23.5 65-69 20.29 28.83 27.735 23.145 70-74 19.99 28.645 28.035 23.330000000000002 75-79 19.965 28.365000000000002 28.07 23.599999999999998 80-84 20.44 28.799999999999997 28.144999999999996 22.615 85-89 20.68 28.07 28.405 22.845 90-94 20.16 28.7 27.815 23.325000000000003 95-99 20.51 28.575 27.6 23.315 100-104 21.025 28.87 27.16 22.945 105-109 20.810000000000002 29.080000000000002 27.615000000000002 22.495 110-114 20.375 28.74 28.26 22.625 115-119 21.195 28.82 27.73 22.255 120-124 20.995 28.71 26.91 23.385 125-129 21.59 28.42 26.939999999999998 23.05 130-134 21.15 28.244999999999997 27.245 23.36 135-139 21.759999999999998 28.33 26.685 23.225 140-144 21.135 28.165000000000003 26.889999999999997 23.810000000000002 145-149 21.23 28.01 26.855 23.905 150-151 21.0625 28.625 27.0 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 1.0 13 1.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.5 21 1.5 22 2.0 23 3.0 24 5.0 25 6.5 26 8.0 27 10.5 28 12.5 29 18.0 30 22.5 31 26.0 32 45.5 33 57.5 34 59.0 35 78.0 36 98.5 37 116.5 38 144.0 39 160.5 40 186.0 41 231.5 42 233.0 43 230.0 44 267.5 45 268.5 46 238.0 47 228.5 48 218.5 49 193.5 50 164.5 51 139.5 52 106.5 53 82.5 54 70.5 55 55.0 56 50.5 57 45.0 58 32.0 59 22.0 60 14.5 61 12.5 62 8.5 63 3.5 64 2.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21736935117394 98.25 2 0.6311537490532694 1.25 3 0.10098459984852311 0.3 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.4625000000000004 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.3875 0.0 0.0 0.0 0.0 122-123 4.7875 0.0 0.0 0.0 0.0 124-125 5.0375 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 7.95 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGATT 10 0.006577216 146.82278 1 TGTTCAG 10 0.006832588 144.9875 5 >>END_MODULE SRR7171120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.823 33.0 33.0 34.0 32.0 34.0 2 32.494 33.0 33.0 34.0 31.0 34.0 3 32.8405 34.0 33.0 34.0 32.0 34.0 4 32.93525 34.0 33.0 34.0 32.0 34.0 5 32.98475 34.0 33.0 34.0 32.0 34.0 6 37.16925 38.0 38.0 38.0 37.0 38.0 7 37.12375 38.0 38.0 38.0 37.0 38.0 8 37.18825 38.0 38.0 38.0 37.0 38.0 9 37.22075 38.0 38.0 38.0 37.0 38.0 10-14 37.152 38.0 38.0 38.0 37.0 38.0 15-19 37.0364 38.0 38.0 38.0 36.8 38.0 20-24 35.778 38.0 37.0 38.0 29.0 38.0 25-29 36.4813 38.0 38.0 38.0 34.4 38.0 30-34 36.90505 38.0 38.0 38.0 36.2 38.0 35-39 36.973 38.0 38.0 38.0 36.8 38.0 40-44 36.988749999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.9353 38.0 38.0 38.0 36.6 38.0 50-54 36.91725 38.0 38.0 38.0 36.0 38.0 55-59 36.8774 38.0 38.0 38.0 36.0 38.0 60-64 36.8222 38.0 38.0 38.0 36.0 38.0 65-69 36.77255 38.0 38.0 38.0 36.0 38.0 70-74 36.711949999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.34735 38.0 37.8 38.0 34.2 38.0 80-84 34.92355 37.8 34.8 38.0 28.0 38.0 85-89 36.497949999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.4452 38.0 38.0 38.0 34.6 38.0 95-99 36.253049999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.20309999999999 38.0 38.0 38.0 34.0 38.0 105-109 34.75215 37.8 35.0 38.0 28.0 38.0 110-114 35.6448 38.0 36.8 38.0 31.6 38.0 115-119 34.93 38.0 35.6 38.0 26.8 38.0 120-124 35.13835 38.0 36.2 38.0 28.8 38.0 125-129 34.94905 38.0 35.8 38.0 28.4 38.0 130-134 34.7155 38.0 35.2 38.0 27.8 38.0 135-139 34.209700000000005 38.0 34.0 38.0 24.8 38.0 140-144 32.0782 37.0 29.0 38.0 18.6 38.0 145-149 30.558749999999996 36.0 29.0 38.0 8.4 38.0 150-151 26.529875 34.0 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 4.0 5 0.0 6 3.0 7 3.0 8 4.0 9 5.0 10 0.0 11 0.0 12 3.0 13 1.0 14 1.0 15 4.0 16 4.0 17 0.0 18 4.0 19 14.0 20 8.0 21 7.0 22 6.0 23 11.0 24 9.0 25 10.0 26 19.0 27 24.0 28 27.0 29 37.0 30 46.0 31 65.0 32 93.0 33 125.0 34 191.0 35 382.0 36 1029.0 37 1844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.675 20.925 10.549999999999999 20.849999999999998 2 26.35 25.55 29.7 18.4 3 20.575 27.325 32.0 20.1 4 23.40585146286572 35.608902225556385 22.305576394098527 18.67966991747937 5 24.58729364682341 37.39369684842421 20.4352176088044 17.58379189594797 6 20.775 37.4 22.1 19.725 7 17.8 22.025 38.975 21.2 8 19.475 25.224999999999998 28.599999999999998 26.700000000000003 9 21.4 24.55 29.25 24.8 10-14 22.939999999999998 28.794999999999998 26.96 21.305 15-19 22.23 28.42 27.950000000000003 21.4 20-24 22.13 29.32 27.534999999999997 21.015 25-29 22.2 28.549999999999997 28.365000000000002 20.885 30-34 22.31 28.115000000000002 28.125 21.45 35-39 22.215 28.33 28.67 20.785 40-44 23.119999999999997 27.825 28.33 20.724999999999998 45-49 22.63 28.255000000000003 28.345 20.77 50-54 22.765 28.199999999999996 27.98 21.055 55-59 22.8 27.894999999999996 27.98 21.325 60-64 22.725 27.6 28.315 21.36 65-69 23.165 28.02 27.950000000000003 20.865000000000002 70-74 23.189999999999998 27.6 27.235 21.975 75-79 22.925 28.349999999999998 27.689999999999998 21.035 80-84 23.064999999999998 28.365000000000002 27.395000000000003 21.175 85-89 22.955000000000002 27.985 28.02 21.04 90-94 23.655 28.044999999999998 27.375 20.925 95-99 22.845 28.125 28.33 20.7 100-104 23.385 28.375 27.505000000000003 20.735 105-109 22.689999999999998 28.050000000000004 28.235 21.025 110-114 23.34 27.529999999999998 28.33 20.8 115-119 23.995 27.88 27.675 20.45 120-124 24.14 27.965 27.450000000000003 20.445 125-129 24.43 27.605 27.405 20.560000000000002 130-134 24.18 27.715 27.52 20.585 135-139 24.46 27.845 27.35 20.345 140-144 24.495 28.544999999999998 27.18 19.78 145-149 25.055 27.779999999999998 27.560000000000002 19.605 150-151 25.0 28.125 26.275 20.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 2.0 24 3.5 25 3.5 26 3.5 27 5.0 28 6.5 29 13.5 30 23.5 31 28.0 32 36.5 33 46.0 34 53.0 35 69.0 36 98.0 37 118.5 38 131.0 39 156.5 40 199.0 41 237.0 42 251.5 43 261.0 44 263.5 45 260.0 46 236.0 47 222.5 48 216.0 49 190.0 50 157.0 51 138.5 52 123.0 53 101.0 54 83.5 55 59.5 56 39.5 57 34.5 58 35.0 59 24.5 60 19.0 61 14.0 62 11.5 63 8.0 64 1.5 65 2.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21657821582006 98.15 2 0.6065200909780136 1.2 3 0.1263583522870862 0.375 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.775 0.0 0.0 0.0 0.0 120-121 4.112500000000001 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.362500000000001 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 7.1125 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 7.9125000000000005 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780714 spots for SRR7171120.sra Written 780714 spots for SRR7171120.sra Read 780726 spots for SRR7171120.sra Written 780726 spots for SRR7171120.sra SRR ids: ['SRR7171120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wzkn2d8b SRR7171120.sra spots: 15614292 blocks: [[1, 780714], [780715, 1561428], [1561429, 2342142], [2342143, 3122856], [3122857, 3903570], [3903571, 4684284], [4684285, 5464998], [5464999, 6245712], [6245713, 7026426], [7026427, 7807140], [7807141, 8587854], [8587855, 9368568], [9368569, 10149282], [10149283, 10929996], [10929997, 11710710], [11710711, 12491424], [12491425, 13272138], [13272139, 14052852], [14052853, 14833566], [14833567, 15614292]] SRR7171120 file size 5269470 SRR7171120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171120 SRR7171120_1.fastq SRR7171120_2.fastq Input file: SRR7171120_1.fastq Paired file: SRR7171120_2.fastq trimmed: SRR7171120-trimmed-pair1.fastq, SRR7171120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:11:24 2025 >> started Fri Feb 14 06:11:43 2025 >> done (18.668s) 15614292 read pairs processed; of these: 21904 ( 0.14%) short read pairs filtered out after trimming by size control 20041 ( 0.13%) empty read pairs filtered out after trimming by size control 15572347 (99.73%) read pairs available; of these: 9554404 (61.35%) trimmed read pairs available after processing 6017943 (38.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 17 0.00% 21 15 0.00% 22 22 0.00% 23 26 0.00% 24 24 0.00% 25 30 0.00% 26 29 0.00% 27 31 0.00% 28 26 0.00% 29 20 0.00% 30 25 0.00% 31 25 0.00% 32 22 0.00% 33 23 0.00% 34 17 0.00% 35 28 0.00% 36 28 0.00% 37 29 0.00% 38 29 0.00% 39 27 0.00% 40 30 0.00% 41 47 0.00% 42 47 0.00% 43 58 0.00% 44 56 0.00% 45 56 0.00% 46 76 0.00% 47 76 0.00% 48 81 0.00% 49 109 0.00% 50 119 0.00% 51 130 0.00% 52 162 0.00% 53 162 0.00% 54 194 0.00% 55 197 0.00% 56 235 0.00% 57 261 0.00% 58 312 0.00% 59 344 0.00% 60 348 0.00% 61 412 0.00% 62 464 0.00% 63 507 0.00% 64 591 0.00% 65 608 0.00% 66 665 0.00% 67 722 0.00% 68 781 0.01% 69 889 0.01% 70 969 0.01% 71 1216 0.01% 72 1415 0.01% 73 1519 0.01% 74 1639 0.01% 75 1745 0.01% 76 2118 0.01% 77 2398 0.02% 78 2601 0.02% 79 2832 0.02% 80 3033 0.02% 81 3575 0.02% 82 4124 0.03% 83 4698 0.03% 84 6178 0.04% 85 6936 0.04% 86 7608 0.05% 87 8637 0.06% 88 9217 0.06% 89 9451 0.06% 90 9986 0.06% 91 10571 0.07% 92 11067 0.07% 93 12004 0.08% 94 12795 0.08% 95 13772 0.09% 96 14447 0.09% 97 14591 0.09% 98 15535 0.10% 99 16435 0.11% 100 18196 0.12% 101 18871 0.12% 102 20221 0.13% 103 21611 0.14% 104 22644 0.15% 105 24260 0.16% 106 24990 0.16% 107 26221 0.17% 108 27232 0.17% 109 28007 0.18% 110 29235 0.19% 111 31307 0.20% 112 32456 0.21% 113 34343 0.22% 114 36070 0.23% 115 37380 0.24% 116 38414 0.25% 117 39740 0.26% 118 40290 0.26% 119 41279 0.27% 120 42894 0.28% 121 44641 0.29% 122 46254 0.30% 123 48555 0.31% 124 50490 0.32% 125 52163 0.33% 126 54018 0.35% 127 55888 0.36% 128 58017 0.37% 129 59857 0.38% 130 62256 0.40% 131 64551 0.41% 132 68431 0.44% 133 72235 0.46% 134 77181 0.50% 135 82020 0.53% 136 86790 0.56% 137 93467 0.60% 138 100277 0.64% 139 108719 0.70% 140 118079 0.76% 141 131383 0.84% 142 146032 0.94% 143 166748 1.07% 144 194103 1.25% 145 232921 1.50% 146 291130 1.87% 147 390734 2.51% 148 585516 3.76% 149 1107262 7.11% 150 4046666 25.99% 151 6017943 38.65% 15572347 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=28.21 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=2.5 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=24.91 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:12:28 Started mapping on | Feb 14 06:12:28 Finished on | Feb 14 06:14:55 Mapping speed, Million of reads per hour | 381.36 Number of input reads | 15572347 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14338542 Uniquely mapped reads % | 92.08% Average mapped length | 290.74 Number of splices: Total | 13375038 Number of splices: Annotated (sjdb) | 13046119 Number of splices: GT/AG | 13119638 Number of splices: GC/AG | 198451 Number of splices: AT/AC | 9375 Number of splices: Non-canonical | 47574 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436608 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 147156 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 824596 824596 824596 N_multimapping 436608 436608 436608 N_noFeature 680612 14082433 777406 N_ambiguous 263620 1105 103677 UnstrandedReadsAssigned:13394310 PositiveStrandReadsAssigned:255004 NegativeStrandReadsAssigned:13457459 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171120-trimmed-pair1.fastq SRR7171120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,572,347 reads, 13,469,752 reads pseudoaligned [quant] estimated average fragment length: 232.856 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7171120.ke.tsv 34699 SRR7171120.se.tsv 87100 total ==> SRR7171120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.14 579 20.8329 Potri.005G024800.1.v4.1 1035 803.144 229 18.3244 Potri.004G059700.1.v4.1 961 729.175 8 0.705093 Potri.007G009000.2.v4.1 1416 1184.14 2 0.108546 Potri.003G141000.2.v4.1 2943 2711.14 739.099 17.5202 Potri.016G087400.1.v4.1 270 86.712 661.327 490.146 Potri.015G069301.1.v4.1 564 336.475 0 0 Potri.010G195200.1.v4.1 1773 1541.14 81 3.37777 Potri.012G127500.1.v4.1 977 745.16 286 24.6663 ==> SRR7171120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 800 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR7171120 completed mapping pipeline successfully