Starting /dee2/code/volunteer_pipeline.sh SRR7171121 current disk space = 3084958466048 free memory = 1579944372 SRR7171121 SRAfilesize 02c443c1f4abc34cfa161c6d257b0b7b SRR7171121.sra SRR7171121.sra file validated SRR7171121 is paired end SRR7171121 is conventional basespace SRR7171121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.786 27.0 18.0 33.0 18.0 33.0 2 28.81875 30.0 27.0 33.0 18.0 33.0 3 30.02475 31.0 29.0 33.0 27.0 33.0 4 30.13625 31.0 29.0 33.0 27.0 33.0 5 31.57625 33.0 31.0 33.0 29.0 33.0 6 34.9325 37.0 35.0 38.0 29.0 38.0 7 36.5875 38.0 37.0 38.0 34.0 38.0 8 37.23825 38.0 38.0 38.0 36.0 38.0 9 37.51275 38.0 38.0 38.0 37.0 38.0 10-14 37.488099999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.51835 38.0 38.0 38.0 37.8 38.0 20-24 37.578700000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.52515000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.454950000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.438900000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.423350000000006 38.0 38.0 38.0 37.2 38.0 45-49 37.40335 38.0 38.0 38.0 37.4 38.0 50-54 37.2774 38.0 38.0 38.0 37.0 38.0 55-59 37.20739999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.2342 38.0 38.0 38.0 37.0 38.0 65-69 36.286899999999996 38.0 37.6 38.0 32.6 38.0 70-74 36.36344999999999 38.0 37.4 38.0 31.4 38.0 75-79 37.041250000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.985299999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.8044 38.0 38.0 38.0 35.2 38.0 90-94 36.73455 38.0 38.0 38.0 35.0 38.0 95-99 36.7207 38.0 38.0 38.0 34.8 38.0 100-104 36.6502 38.0 38.0 38.0 34.6 38.0 105-109 36.51065 38.0 38.0 38.0 34.0 38.0 110-114 36.428650000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.09555 38.0 37.2 38.0 33.4 38.0 120-124 35.9317 38.0 37.0 38.0 32.6 38.0 125-129 35.51155 38.0 36.4 38.0 30.4 38.0 130-134 34.9416 38.0 35.6 38.0 28.4 38.0 135-139 34.8842 38.0 35.8 38.0 29.0 38.0 140-144 34.0115 38.0 33.6 38.0 24.2 38.0 145-149 33.1152 38.0 33.0 38.0 16.8 38.0 150-151 27.673625 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 2.0 9 2.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 3.0 20 5.0 21 0.0 22 3.0 23 4.0 24 8.0 25 17.0 26 14.0 27 18.0 28 14.0 29 28.0 30 46.0 31 53.0 32 79.0 33 126.0 34 172.0 35 332.0 36 926.0 37 2137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.15881147540984 13.498975409836063 9.01639344262295 32.325819672131146 2 19.634817408704354 19.70985492746373 34.642321160580295 26.013006503251624 3 18.7 25.424999999999997 28.275 27.6 4 23.150000000000002 33.525 22.3 21.025 5 20.474999999999998 35.875 25.174999999999997 18.475 6 17.075000000000003 37.525 25.825 19.575 7 13.225000000000001 22.45 44.800000000000004 19.525000000000002 8 17.275 23.9 31.2 27.625 9 17.175 22.55 33.375 26.900000000000002 10-14 19.535 29.49 27.27 23.705000000000002 15-19 19.11 29.104999999999997 28.59 23.195 20-24 19.735 28.810000000000002 27.950000000000003 23.505000000000003 25-29 19.950000000000003 28.29 28.18 23.580000000000002 30-34 19.84 28.98 27.675 23.505000000000003 35-39 19.895 28.735 27.99 23.380000000000003 40-44 20.26 28.794999999999998 28.015 22.93 45-49 20.005 29.125 27.37 23.5 50-54 19.93 28.255000000000003 28.665000000000003 23.150000000000002 55-59 20.235 28.725 27.865000000000002 23.175 60-64 19.955000000000002 28.799999999999997 27.775 23.47 65-69 20.26 28.915000000000003 27.529999999999998 23.294999999999998 70-74 20.34 28.03 28.54 23.09 75-79 20.315 28.23 28.494999999999997 22.96 80-84 19.735 28.27 28.43 23.565 85-89 20.18 28.99 27.62 23.21 90-94 19.975 28.910000000000004 28.199999999999996 22.915 95-99 20.255000000000003 28.59 27.779999999999998 23.375 100-104 20.4 29.24 27.01 23.35 105-109 20.165 28.34 28.015 23.48 110-114 21.105 28.175 27.875 22.845 115-119 20.935000000000002 28.689999999999998 26.950000000000003 23.425 120-124 20.335 28.299999999999997 28.050000000000004 23.315 125-129 20.76 28.525 26.884999999999998 23.830000000000002 130-134 21.065 28.9 26.779999999999998 23.255 135-139 20.735 28.1 27.555000000000003 23.61 140-144 20.935000000000002 28.405 27.334999999999997 23.325000000000003 145-149 20.14 28.884999999999998 27.05 23.925 150-151 21.100687929956223 28.630393996247655 26.278924327704818 23.989993746091308 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 1.0 24 2.0 25 5.0 26 7.0 27 8.5 28 10.5 29 20.0 30 24.0 31 23.5 32 36.0 33 54.5 34 73.5 35 84.0 36 89.0 37 127.0 38 147.5 39 161.5 40 202.5 41 224.5 42 253.5 43 265.5 44 262.5 45 254.5 46 251.5 47 242.5 48 219.0 49 204.5 50 169.0 51 124.0 52 96.0 53 77.0 54 67.5 55 56.0 56 38.5 57 29.5 58 21.0 59 14.0 60 8.5 61 9.0 62 11.0 63 5.0 64 0.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47076612903226 98.675 2 0.3780241935483871 0.75 3 0.05040322580645161 0.15 4 0.07560483870967742 0.3 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.6 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.9375 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.7375 0.0 0.0 0.0 0.0 126-127 7.4375 0.0 0.0 0.0 0.0 128-129 8.024999999999999 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.6125 0.0 0.0 0.0 0.0 136-137 10.1625 0.0 0.0 0.0 0.0 138-139 10.850000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATC 10 0.0068343505 144.975 145 >>END_MODULE SRR7171121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8035 33.0 33.0 34.0 27.0 34.0 2 32.53425 33.0 33.0 34.0 31.0 34.0 3 32.7455 33.0 33.0 34.0 32.0 34.0 4 32.793 33.0 33.0 34.0 32.0 34.0 5 32.856 34.0 33.0 34.0 32.0 34.0 6 37.1075 38.0 38.0 38.0 37.0 38.0 7 37.0535 38.0 38.0 38.0 37.0 38.0 8 37.0245 38.0 38.0 38.0 37.0 38.0 9 37.03575 38.0 38.0 38.0 37.0 38.0 10-14 36.83364999999999 38.0 38.0 38.0 35.8 38.0 15-19 36.86705 38.0 38.0 38.0 36.4 38.0 20-24 35.22545 38.0 35.0 38.0 26.8 38.0 25-29 36.7512 38.0 37.8 38.0 35.6 38.0 30-34 36.90295 38.0 38.0 38.0 36.8 38.0 35-39 36.882200000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.836349999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.693799999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.15155 38.0 37.8 38.0 32.6 38.0 55-59 36.6264 38.0 38.0 38.0 35.4 38.0 60-64 36.6607 38.0 38.0 38.0 35.8 38.0 65-69 36.5866 38.0 38.0 38.0 35.0 38.0 70-74 36.54600000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.514649999999996 38.0 38.0 38.0 35.0 38.0 80-84 35.4916 38.0 36.8 38.0 29.4 38.0 85-89 36.2289 38.0 38.0 38.0 34.0 38.0 90-94 36.22855 38.0 38.0 38.0 34.0 38.0 95-99 36.12044999999999 38.0 38.0 38.0 34.0 38.0 100-104 35.88655 38.0 37.8 38.0 33.4 38.0 105-109 35.2331 38.0 36.6 38.0 27.0 38.0 110-114 35.433800000000005 38.0 37.0 38.0 30.6 38.0 115-119 35.38135 38.0 37.0 38.0 31.0 38.0 120-124 35.176249999999996 38.0 36.2 38.0 30.2 38.0 125-129 34.98095 38.0 36.4 38.0 29.8 38.0 130-134 34.08905 38.0 34.6 38.0 23.6 38.0 135-139 33.602250000000005 38.0 33.6 38.0 21.4 38.0 140-144 32.678749999999994 38.0 33.0 38.0 15.2 38.0 145-149 31.82465 38.0 33.0 38.0 8.2 38.0 150-151 25.90175 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 4.0 5 3.0 6 4.0 7 1.0 8 6.0 9 2.0 10 1.0 11 2.0 12 6.0 13 1.0 14 7.0 15 3.0 16 2.0 17 3.0 18 3.0 19 10.0 20 14.0 21 9.0 22 9.0 23 9.0 24 17.0 25 13.0 26 19.0 27 32.0 28 40.0 29 44.0 30 45.0 31 48.0 32 86.0 33 118.0 34 186.0 35 320.0 36 827.0 37 2086.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.9 20.325 12.025 22.75 2 25.4 24.6 32.074999999999996 17.925 3 22.225 26.450000000000003 32.574999999999996 18.75 4 24.275 34.525 22.85 18.35 5 23.35 38.25 20.8 17.599999999999998 6 19.025 38.4 24.4 18.175 7 19.2 18.875 41.199999999999996 20.724999999999998 8 19.55 24.325 29.7 26.424999999999997 9 22.275 24.925 28.549999999999997 24.25 10-14 23.345 29.185 26.445 21.025 15-19 23.11 28.134999999999998 28.199999999999996 20.555 20-24 22.695 28.249999999999996 28.76 20.294999999999998 25-29 22.759999999999998 28.7 28.310000000000002 20.23 30-34 22.535 28.410000000000004 28.705000000000002 20.349999999999998 35-39 22.195 28.475 28.884999999999998 20.445 40-44 22.759999999999998 27.97 28.99 20.28 45-49 22.685 28.87 28.18 20.265 50-54 22.84 27.845 29.049999999999997 20.265 55-59 22.415 28.405 28.060000000000002 21.12 60-64 22.7 27.775 28.98 20.544999999999998 65-69 23.025000000000002 27.33 29.049999999999997 20.595 70-74 23.044999999999998 27.950000000000003 28.585 20.419999999999998 75-79 23.064999999999998 28.285 27.765 20.885 80-84 22.98 28.000000000000004 27.994999999999997 21.025 85-89 23.45 27.939999999999998 27.88 20.73 90-94 23.419999999999998 27.935 28.060000000000002 20.585 95-99 23.275000000000002 28.189999999999998 28.205000000000002 20.330000000000002 100-104 23.765 27.63 28.07 20.535 105-109 24.12 27.685 28.24 19.955000000000002 110-114 24.169999999999998 28.51 27.71 19.61 115-119 24.709999999999997 28.384999999999998 27.134999999999998 19.77 120-124 24.285 28.48 27.355 19.88 125-129 24.795 28.49 26.875 19.84 130-134 24.87 27.83 27.315 19.985 135-139 24.9 28.07 27.150000000000002 19.88 140-144 25.669999999999998 27.82 27.205000000000002 19.305 145-149 26.08 27.939999999999998 26.86 19.12 150-151 26.297361510566464 27.19769913717644 27.160185069401027 19.344754282856073 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 0.5 21 1.5 22 2.5 23 3.5 24 5.5 25 7.0 26 6.5 27 7.5 28 7.5 29 14.5 30 26.0 31 26.5 32 30.5 33 39.5 34 53.0 35 69.0 36 78.0 37 107.5 38 138.0 39 178.0 40 210.0 41 231.0 42 264.5 43 300.0 44 286.0 45 259.0 46 265.0 47 242.0 48 228.0 49 208.5 50 153.0 51 119.0 52 100.5 53 77.0 54 70.0 55 58.5 56 38.0 57 27.5 58 21.0 59 9.5 60 5.0 61 4.5 62 6.0 63 4.5 64 0.5 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31766489764973 98.25 2 0.5054334091483448 1.0 3 0.0758150113722517 0.22499999999999998 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5249999999999999 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.0750000000000002 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.6 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.525 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.375 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.262499999999999 0.0 0.0 0.0 0.0 120-121 5.824999999999999 0.0 0.0 0.0 0.0 122-123 6.2625 0.0 0.0 0.0 0.0 124-125 6.775 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 7.975 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 8.9625 0.0 0.0 0.0 0.0 134-135 9.5375 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838184 spots for SRR7171121.sra Written 838184 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra Read 838171 spots for SRR7171121.sra Written 838171 spots for SRR7171121.sra SRR ids: ['SRR7171121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5seaj1g SRR7171121.sra spots: 16763433 blocks: [[1, 838171], [838172, 1676342], [1676343, 2514513], [2514514, 3352684], [3352685, 4190855], [4190856, 5029026], [5029027, 5867197], [5867198, 6705368], [6705369, 7543539], [7543540, 8381710], [8381711, 9219881], [9219882, 10058052], [10058053, 10896223], [10896224, 11734394], [11734395, 12572565], [12572566, 13410736], [13410737, 14248907], [14248908, 15087078], [15087079, 15925249], [15925250, 16763433]] SRR7171121 file size 5658877 SRR7171121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171121 SRR7171121_1.fastq SRR7171121_2.fastq Input file: SRR7171121_1.fastq Paired file: SRR7171121_2.fastq trimmed: SRR7171121-trimmed-pair1.fastq, SRR7171121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:08:07 2025 >> started Fri Feb 14 07:08:26 2025 >> done (18.887s) 16763433 read pairs processed; of these: 23844 ( 0.14%) short read pairs filtered out after trimming by size control 37851 ( 0.23%) empty read pairs filtered out after trimming by size control 16701738 (99.63%) read pairs available; of these: 10932672 (65.46%) trimmed read pairs available after processing 5769066 (34.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 7 0.00% 20 13 0.00% 21 12 0.00% 22 19 0.00% 23 18 0.00% 24 13 0.00% 25 24 0.00% 26 12 0.00% 27 29 0.00% 28 19 0.00% 29 25 0.00% 30 29 0.00% 31 25 0.00% 32 16 0.00% 33 25 0.00% 34 28 0.00% 35 30 0.00% 36 28 0.00% 37 32 0.00% 38 36 0.00% 39 63 0.00% 40 51 0.00% 41 67 0.00% 42 55 0.00% 43 81 0.00% 44 70 0.00% 45 78 0.00% 46 110 0.00% 47 115 0.00% 48 130 0.00% 49 143 0.00% 50 185 0.00% 51 214 0.00% 52 209 0.00% 53 231 0.00% 54 274 0.00% 55 277 0.00% 56 347 0.00% 57 354 0.00% 58 427 0.00% 59 501 0.00% 60 620 0.00% 61 648 0.00% 62 867 0.01% 63 863 0.01% 64 955 0.01% 65 1026 0.01% 66 1076 0.01% 67 1167 0.01% 68 1381 0.01% 69 1537 0.01% 70 1763 0.01% 71 2085 0.01% 72 2434 0.01% 73 2738 0.02% 74 2973 0.02% 75 3358 0.02% 76 4109 0.02% 77 4329 0.03% 78 4302 0.03% 79 4721 0.03% 80 5319 0.03% 81 6089 0.04% 82 6918 0.04% 83 7853 0.05% 84 9665 0.06% 85 10703 0.06% 86 11340 0.07% 87 12093 0.07% 88 13202 0.08% 89 13906 0.08% 90 14878 0.09% 91 15947 0.10% 92 17375 0.10% 93 18807 0.11% 94 20037 0.12% 95 20990 0.13% 96 21803 0.13% 97 22477 0.13% 98 23306 0.14% 99 24509 0.15% 100 26550 0.16% 101 27104 0.16% 102 29285 0.18% 103 30795 0.18% 104 32646 0.20% 105 33936 0.20% 106 34990 0.21% 107 35603 0.21% 108 36518 0.22% 109 37393 0.22% 110 38817 0.23% 111 40147 0.24% 112 42341 0.25% 113 43781 0.26% 114 46574 0.28% 115 47996 0.29% 116 49455 0.30% 117 50562 0.30% 118 51110 0.31% 119 52010 0.31% 120 53485 0.32% 121 55295 0.33% 122 57175 0.34% 123 59466 0.36% 124 62756 0.38% 125 64863 0.39% 126 68380 0.41% 127 68962 0.41% 128 70212 0.42% 129 72818 0.44% 130 75636 0.45% 131 78203 0.47% 132 82302 0.49% 133 87296 0.52% 134 91965 0.55% 135 98475 0.59% 136 104556 0.63% 137 111959 0.67% 138 118927 0.71% 139 125986 0.75% 140 135366 0.81% 141 145774 0.87% 142 160048 0.96% 143 178183 1.07% 144 206202 1.23% 145 245058 1.47% 146 298144 1.79% 147 401828 2.41% 148 615444 3.68% 149 1212243 7.26% 150 4593448 27.50% 151 5769066 34.54% 16701738 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=30.54 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.50 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=1.48 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.20 sequence-density-rank=16 fanout-score=11.55 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=6.1 sequence=AAGAAAGCTTACCCTAAC SRR7171121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:09:12 Started mapping on | Feb 14 07:09:12 Finished on | Feb 14 07:11:14 Mapping speed, Million of reads per hour | 492.84 Number of input reads | 16701738 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15514359 Uniquely mapped reads % | 92.89% Average mapped length | 288.36 Number of splices: Total | 14851813 Number of splices: Annotated (sjdb) | 14453529 Number of splices: GT/AG | 14553885 Number of splices: GC/AG | 224045 Number of splices: AT/AC | 9968 Number of splices: Non-canonical | 63915 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 497353 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 14920 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718731 718731 718731 N_multimapping 497353 497353 497353 N_noFeature 654932 15200426 768291 N_ambiguous 334361 1132 133242 UnstrandedReadsAssigned:14525066 PositiveStrandReadsAssigned:312801 NegativeStrandReadsAssigned:14612826 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171121-trimmed-pair1.fastq SRR7171121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,701,738 reads, 14,468,384 reads pseudoaligned [quant] estimated average fragment length: 231.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7171121.ke.tsv 34699 SRR7171121.se.tsv 87100 total ==> SRR7171121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.37 867 28.0037 Potri.005G024800.1.v4.1 1035 804.368 252 18.0866 Potri.004G059700.1.v4.1 961 730.425 5 0.395189 Potri.007G009000.2.v4.1 1416 1185.37 0 0 Potri.003G141000.2.v4.1 2943 2712.37 948.312 20.1843 Potri.016G087400.1.v4.1 270 92.3352 895 559.585 Potri.015G069301.1.v4.1 564 339.379 0 0 Potri.010G195200.1.v4.1 1773 1542.37 347.909 13.0223 Potri.012G127500.1.v4.1 977 746.394 162 12.5302 ==> SRR7171121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 420 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 53 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7171121 completed mapping pipeline successfully