Starting /dee2/code/volunteer_pipeline.sh SRR7171122 current disk space = 3102375407616 free memory = 1582481432 SRR7171122 SRAfilesize fb7f8e0f859fa0beb7ff6e724994a368 SRR7171122.sra SRR7171122.sra file validated SRR7171122 is paired end SRR7171122 is conventional basespace SRR7171122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.023 27.0 18.0 32.0 18.0 33.0 2 29.49725 31.0 29.0 33.0 25.0 33.0 3 31.45425 33.0 31.0 33.0 28.0 33.0 4 31.8335 33.0 31.0 33.0 29.0 33.0 5 32.354 33.0 33.0 33.0 31.0 34.0 6 36.9445 38.0 37.0 38.0 36.0 38.0 7 37.30625 38.0 38.0 38.0 37.0 38.0 8 37.28425 38.0 38.0 38.0 37.0 38.0 9 37.38225 38.0 38.0 38.0 37.0 38.0 10-14 37.451750000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.41395 38.0 38.0 38.0 37.4 38.0 20-24 37.479200000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.04045 38.0 38.0 38.0 35.8 38.0 30-34 37.1037 38.0 38.0 38.0 36.0 38.0 35-39 36.096399999999996 38.0 36.4 38.0 31.2 38.0 40-44 37.17809999999999 38.0 38.0 38.0 36.8 38.0 45-49 36.63095 38.0 37.8 38.0 34.4 38.0 50-54 37.0736 38.0 38.0 38.0 36.4 38.0 55-59 37.05825 38.0 38.0 38.0 36.2 38.0 60-64 36.38249999999999 38.0 37.4 38.0 33.2 38.0 65-69 36.06615000000001 38.0 36.8 38.0 30.2 38.0 70-74 36.3967 38.0 37.6 38.0 33.0 38.0 75-79 36.6943 38.0 38.0 38.0 34.8 38.0 80-84 36.59635 38.0 38.0 38.0 34.4 38.0 85-89 35.5188 38.0 36.0 38.0 30.0 38.0 90-94 35.76565000000001 38.0 36.4 38.0 31.6 38.0 95-99 34.66574999999999 38.0 34.6 38.0 25.8 38.0 100-104 35.98785 38.0 37.2 38.0 32.2 38.0 105-109 36.04335000000001 38.0 37.4 38.0 33.0 38.0 110-114 34.550650000000005 38.0 34.8 38.0 25.2 38.0 115-119 32.5313 35.8 29.4 38.0 23.2 38.0 120-124 35.32405 38.0 36.2 38.0 30.0 38.0 125-129 34.9246 38.0 36.0 38.0 28.0 38.0 130-134 33.4815 37.8 32.6 38.0 21.2 38.0 135-139 33.9778 38.0 33.2 38.0 23.4 38.0 140-144 33.284800000000004 38.0 33.0 38.0 19.2 38.0 145-149 29.8582 36.0 26.4 38.0 7.8 38.0 150-151 25.86475 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 2.0 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 4.0 18 3.0 19 7.0 20 5.0 21 5.0 22 5.0 23 11.0 24 9.0 25 25.0 26 26.0 27 30.0 28 17.0 29 60.0 30 64.0 31 95.0 32 125.0 33 169.0 34 274.0 35 528.0 36 1358.0 37 1163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.450777202072537 16.295336787564768 4.248704663212435 48.00518134715026 2 12.0 14.825 56.375 16.8 3 11.35 20.825 36.625 31.2 4 19.825 28.299999999999997 28.775000000000002 23.1 5 19.30482620655164 33.633408352088026 28.93223305826457 18.12953238309577 6 15.299999999999999 34.425 28.95 21.325 7 12.775 23.125 45.975 18.125 8 13.225000000000001 22.775000000000002 38.125 25.874999999999996 9 15.1 18.6 40.225 26.075 10-14 19.195 29.335 27.92 23.549999999999997 15-19 18.52 28.444999999999997 29.01 24.025 20-24 18.81 28.720000000000002 28.625 23.845 25-29 19.145 29.065 28.095 23.695 30-34 19.105 28.610000000000003 28.505000000000003 23.78 35-39 20.111005550277515 28.10140507025351 28.72143607180359 23.06615330766538 40-44 19.26096304815241 29.33646682334117 28.081404070203508 23.321166058302914 45-49 20.11 28.439999999999998 28.675 22.775000000000002 50-54 19.205 28.939999999999998 28.525 23.330000000000002 55-59 19.785 28.735 28.439999999999998 23.04 60-64 19.935 28.29 28.475 23.3 65-69 19.81 29.110000000000003 28.299999999999997 22.78 70-74 19.440972048602433 28.961448072403623 28.16140807040352 23.43617180859043 75-79 20.34 28.705000000000002 28.15 22.805 80-84 19.91599579978999 28.621431071553577 28.106405320266013 23.356167808390417 85-89 19.422913437015552 28.819322898434763 28.854328149222386 22.9034355153273 90-94 19.75098754937747 29.146457322866144 27.821391069553474 23.28116405820291 95-99 19.41 29.049999999999997 27.994999999999997 23.544999999999998 100-104 20.407040704070408 29.44294429442944 27.73777377737774 22.41224122412241 105-109 20.02 29.005 27.755000000000003 23.22 110-114 20.405 28.62 27.905 23.07 115-119 20.59 29.32 27.229999999999997 22.86 120-124 20.57602880144007 28.991449572478622 27.341367068353417 23.091154557727886 125-129 20.356017800890044 28.41142057102855 28.046402320116005 23.186159307965397 130-134 21.0 29.03 26.979999999999997 22.99 135-139 20.671033551677585 28.121406070303518 27.50637531876594 23.701185059252964 140-144 20.701035051752587 28.656432821641083 26.681334066703332 23.961198059902994 145-149 20.36 29.630000000000003 26.369999999999997 23.64 150-151 20.845316993872704 27.485306990121295 27.372764786795052 24.296611229210953 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 5.0 25 9.0 26 10.0 27 9.0 28 15.0 29 28.5 30 31.5 31 36.0 32 55.0 33 69.0 34 72.5 35 90.0 36 117.5 37 138.5 38 159.5 39 180.5 40 206.0 41 232.5 42 258.5 43 285.0 44 278.0 45 255.5 46 238.0 47 210.5 48 192.5 49 170.0 50 134.5 51 112.0 52 92.5 53 73.5 54 66.5 55 47.0 56 33.0 57 28.0 58 14.0 59 6.0 60 7.0 61 7.5 62 3.5 63 2.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.025 0.0 20-21 0.1 0.0 0.0 0.025 0.0 22-23 0.1 0.0 0.0 0.025 0.0 24-25 0.1 0.0 0.0 0.025 0.0 26-27 0.1 0.0 0.0 0.025 0.0 28-29 0.1 0.0 0.0 0.025 0.0 30-31 0.1 0.0 0.0 0.025 0.0 32-33 0.1 0.0 0.0 0.025 0.0 34-35 0.1 0.0 0.0 0.025 0.0 36-37 0.1 0.0 0.0 0.025 0.0 38-39 0.1 0.0 0.0 0.025 0.0 40-41 0.1 0.0 0.0 0.025 0.0 42-43 0.1 0.0 0.0 0.025 0.0 44-45 0.1 0.0 0.0 0.025 0.0 46-47 0.1 0.0 0.0 0.025 0.0 48-49 0.1 0.0 0.0 0.025 0.0 50-51 0.1 0.0 0.0 0.025 0.0 52-53 0.1 0.0 0.0 0.025 0.0 54-55 0.1 0.0 0.0 0.025 0.0 56-57 0.1 0.0 0.0 0.025 0.0 58-59 0.1 0.0 0.0 0.025 0.0 60-61 0.1125 0.0 0.0 0.025 0.0 62-63 0.125 0.0 0.0 0.025 0.0 64-65 0.125 0.0 0.0 0.025 0.0 66-67 0.125 0.0 0.0 0.025 0.0 68-69 0.125 0.0 0.0 0.025 0.0 70-71 0.15 0.0 0.0 0.025 0.0 72-73 0.1875 0.0 0.0 0.025 0.0 74-75 0.2 0.0 0.0 0.025 0.0 76-77 0.2625 0.0 0.0 0.025 0.0 78-79 0.3375 0.0 0.0 0.025 0.0 80-81 0.3875 0.0 0.0 0.025 0.0 82-83 0.425 0.0 0.0 0.025 0.0 84-85 0.5125 0.0 0.0 0.025 0.0 86-87 0.6375 0.0 0.0 0.025 0.0 88-89 0.7125 0.0 0.0 0.025 0.0 90-91 0.875 0.0 0.0 0.025 0.0 92-93 1.0375 0.0 0.0 0.025 0.0 94-95 1.275 0.0 0.0 0.025 0.0 96-97 1.55 0.0 0.0 0.025 0.0 98-99 1.825 0.0 0.0 0.025 0.0 100-101 2.1624999999999996 0.0 0.0 0.025 0.0 102-103 2.6375 0.0 0.0 0.025 0.0 104-105 3.0 0.0 0.0 0.025 0.0 106-107 3.2750000000000004 0.0 0.0 0.025 0.0 108-109 3.5 0.0 0.0 0.025 0.0 110-111 3.8125 0.0 0.0 0.025 0.0 112-113 4.0625 0.0 0.0 0.025 0.0 114-115 4.3375 0.0 0.0 0.025 0.0 116-117 4.725 0.0 0.0 0.025 0.0 118-119 5.0875 0.0 0.0 0.025 0.0 120-121 5.5375 0.0 0.0 0.025 0.0 122-123 5.975 0.0 0.0 0.025 0.0 124-125 6.5125 0.0 0.0 0.025 0.0 126-127 7.025 0.0 0.0 0.025 0.0 128-129 7.4 0.0 0.0 0.025 0.0 130-131 8.0875 0.0 0.0 0.025 0.0 132-133 8.6 0.0 0.0 0.025 0.0 134-135 9.2875 0.0 0.0 0.025 0.0 136-137 9.925 0.0 0.0 0.025 0.0 138-139 10.625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.818 33.0 33.0 34.0 32.0 34.0 2 32.79775 33.0 33.0 34.0 32.0 34.0 3 32.95875 34.0 33.0 34.0 32.0 34.0 4 32.9135 34.0 33.0 34.0 32.0 34.0 5 32.9255 34.0 33.0 34.0 32.0 34.0 6 37.1205 38.0 38.0 38.0 37.0 38.0 7 37.12475 38.0 38.0 38.0 37.0 38.0 8 37.1535 38.0 38.0 38.0 37.0 38.0 9 37.11775 38.0 38.0 38.0 37.0 38.0 10-14 37.001099999999994 38.0 38.0 38.0 36.2 38.0 15-19 36.9832 38.0 38.0 38.0 36.0 38.0 20-24 36.59065 38.0 37.8 38.0 34.6 38.0 25-29 36.9759 38.0 38.0 38.0 36.0 38.0 30-34 36.954150000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.96735 38.0 38.0 38.0 36.0 38.0 40-44 36.827799999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.692449999999994 38.0 38.0 38.0 35.2 38.0 50-54 36.749300000000005 38.0 38.0 38.0 35.4 38.0 55-59 36.700300000000006 38.0 38.0 38.0 35.2 38.0 60-64 36.6375 38.0 38.0 38.0 35.0 38.0 65-69 36.6265 38.0 38.0 38.0 34.8 38.0 70-74 36.63340000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.455149999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.32905000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.28975 38.0 38.0 38.0 34.0 38.0 90-94 36.228500000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.10079999999999 38.0 37.8 38.0 33.8 38.0 100-104 35.834 38.0 37.0 38.0 31.8 38.0 105-109 35.667 38.0 37.0 38.0 31.4 38.0 110-114 35.42515 38.0 37.0 38.0 29.4 38.0 115-119 35.10045 38.0 36.0 38.0 28.4 38.0 120-124 35.038850000000004 38.0 36.0 38.0 28.6 38.0 125-129 34.39155 38.0 35.4 38.0 25.4 38.0 130-134 33.9382 38.0 34.6 38.0 22.8 38.0 135-139 33.05105 38.0 33.2 38.0 16.4 38.0 140-144 31.7771 38.0 31.2 38.0 12.8 38.0 145-149 30.573500000000003 37.8 30.0 38.0 3.8 38.0 150-151 23.969 29.5 14.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 2.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 0.0 15 3.0 16 2.0 17 4.0 18 4.0 19 6.0 20 11.0 21 11.0 22 12.0 23 13.0 24 16.0 25 25.0 26 34.0 27 49.0 28 41.0 29 51.0 30 76.0 31 68.0 32 91.0 33 130.0 34 215.0 35 317.0 36 699.0 37 2095.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.6 24.975 6.875000000000001 36.55 2 20.925 22.675 44.474999999999994 11.924999999999999 3 13.350000000000001 27.675 37.7 21.275 4 18.575 35.375 26.6 19.45 5 23.9 37.375 22.425 16.3 6 16.900000000000002 39.275 26.075 17.75 7 17.275 19.85 43.425000000000004 19.45 8 16.375 23.575 33.825 26.224999999999998 9 18.85 22.1 34.275 24.775 10-14 22.35 27.73 28.015 21.905 15-19 22.116105805290264 28.291414570728534 28.826441322066103 20.766038301915096 20-24 21.815 28.26 29.01 20.915 25-29 22.245 28.175 28.77 20.810000000000002 30-34 21.945 28.335 29.04 20.68 35-39 22.295 27.98 29.134999999999998 20.59 40-44 22.33 28.044999999999998 29.145 20.48 45-49 21.959999999999997 28.625 28.744999999999997 20.669999999999998 50-54 22.384999999999998 28.065 28.875 20.674999999999997 55-59 22.495 28.09 28.660000000000004 20.755000000000003 60-64 23.294999999999998 27.435 28.225 21.044999999999998 65-69 22.32 28.17 28.54 20.97 70-74 22.395 28.455000000000002 28.139999999999997 21.01 75-79 22.43 28.26 28.48 20.830000000000002 80-84 23.445 28.139999999999997 28.59 19.825 85-89 23.035 28.215 28.610000000000003 20.14 90-94 23.275000000000002 28.549999999999997 28.084999999999997 20.09 95-99 22.869999999999997 29.085 28.244999999999997 19.8 100-104 23.585 28.544999999999998 28.044999999999998 19.825 105-109 23.45 28.43 27.855 20.265 110-114 23.84 28.48 27.73 19.950000000000003 115-119 23.965 28.895 27.62 19.52 120-124 24.115000000000002 28.53 27.73 19.625 125-129 24.529999999999998 28.884999999999998 27.045 19.54 130-134 24.85 28.325 27.38 19.445 135-139 24.485 27.91 27.785 19.82 140-144 24.779999999999998 28.655 27.389999999999997 19.175 145-149 25.0 28.910000000000004 27.145000000000003 18.945 150-151 26.15980992872327 27.622858571964485 26.710016256096036 19.507315243216205 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 2.0 13 2.0 14 0.5 15 0.0 16 1.0 17 1.5 18 1.5 19 1.5 20 1.0 21 0.5 22 1.0 23 3.0 24 3.5 25 5.5 26 9.0 27 12.0 28 17.0 29 21.0 30 21.0 31 30.0 32 40.0 33 53.5 34 73.0 35 93.5 36 116.5 37 127.0 38 149.0 39 182.5 40 220.5 41 256.5 42 265.5 43 252.0 44 262.5 45 266.0 46 245.5 47 228.5 48 198.5 49 171.5 50 138.5 51 122.5 52 107.5 53 76.0 54 60.5 55 45.0 56 31.5 57 25.0 58 18.5 59 12.5 60 6.0 61 4.0 62 4.0 63 2.0 64 1.5 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26804644119132 98.32499999999999 2 0.5552751135790005 1.0999999999999999 3 0.12619888944977284 0.375 4 0.05047955577990913 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.025 0.0 0.0 0.0 0.0 100-101 2.35 0.0 0.0 0.0 0.0 102-103 2.8375 0.0 0.0 0.0 0.0 104-105 3.275 0.0 0.0 0.0 0.0 106-107 3.6500000000000004 0.0 0.0 0.0 0.0 108-109 3.95 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 4.637499999999999 0.0 0.0 0.0 0.0 114-115 5.0625 0.0 0.0 0.0 0.0 116-117 5.487500000000001 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.4 0.0 0.0 0.0 0.0 122-123 6.9 0.0 0.0 0.0 0.0 124-125 7.425 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.325 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.575 0.0 0.0 0.0 0.0 134-135 10.2625 0.0 0.0 0.0 0.0 136-137 10.9 0.0 0.0 0.0 0.0 138-139 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCATC 10 0.006830828 145.0 6 AATTACT 10 0.006830828 145.0 145 >>END_MODULE Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753869 spots for SRR7171122.sra Written 753869 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra Read 753859 spots for SRR7171122.sra Written 753859 spots for SRR7171122.sra SRR ids: ['SRR7171122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jreo1slh SRR7171122.sra spots: 15077190 blocks: [[1, 753859], [753860, 1507718], [1507719, 2261577], [2261578, 3015436], [3015437, 3769295], [3769296, 4523154], [4523155, 5277013], [5277014, 6030872], [6030873, 6784731], [6784732, 7538590], [7538591, 8292449], [8292450, 9046308], [9046309, 9800167], [9800168, 10554026], [10554027, 11307885], [11307886, 12061744], [12061745, 12815603], [12815604, 13569462], [13569463, 14323321], [14323322, 15077190]] SRR7171122 file size 5087464 SRR7171122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171122 SRR7171122_1.fastq SRR7171122_2.fastq Input file: SRR7171122_1.fastq Paired file: SRR7171122_2.fastq trimmed: SRR7171122-trimmed-pair1.fastq, SRR7171122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:22:04 2025 >> started Fri Feb 14 07:22:25 2025 >> done (21.107s) 15077190 read pairs processed; of these: 11016 ( 0.07%) short read pairs filtered out after trimming by size control 35682 ( 0.24%) empty read pairs filtered out after trimming by size control 15030492 (99.69%) read pairs available; of these: 9676468 (64.38%) trimmed read pairs available after processing 5354024 (35.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 54 0.00% 19 45 0.00% 20 51 0.00% 21 60 0.00% 22 67 0.00% 23 62 0.00% 24 74 0.00% 25 66 0.00% 26 79 0.00% 27 69 0.00% 28 83 0.00% 29 76 0.00% 30 97 0.00% 31 82 0.00% 32 84 0.00% 33 99 0.00% 34 78 0.00% 35 92 0.00% 36 94 0.00% 37 103 0.00% 38 92 0.00% 39 120 0.00% 40 108 0.00% 41 128 0.00% 42 146 0.00% 43 153 0.00% 44 133 0.00% 45 182 0.00% 46 208 0.00% 47 201 0.00% 48 265 0.00% 49 272 0.00% 50 302 0.00% 51 300 0.00% 52 363 0.00% 53 414 0.00% 54 454 0.00% 55 420 0.00% 56 514 0.00% 57 532 0.00% 58 657 0.00% 59 756 0.01% 60 879 0.01% 61 994 0.01% 62 1117 0.01% 63 1255 0.01% 64 1285 0.01% 65 1423 0.01% 66 1473 0.01% 67 1656 0.01% 68 1843 0.01% 69 2137 0.01% 70 2405 0.02% 71 2768 0.02% 72 3266 0.02% 73 3657 0.02% 74 3800 0.03% 75 4237 0.03% 76 4923 0.03% 77 5473 0.04% 78 5454 0.04% 79 6165 0.04% 80 6636 0.04% 81 7276 0.05% 82 8198 0.05% 83 9457 0.06% 84 10596 0.07% 85 11095 0.07% 86 12052 0.08% 87 12640 0.08% 88 13856 0.09% 89 14868 0.10% 90 15968 0.11% 91 17248 0.11% 92 18098 0.12% 93 20070 0.13% 94 21069 0.14% 95 22381 0.15% 96 23057 0.15% 97 23779 0.16% 98 24914 0.17% 99 25786 0.17% 100 27339 0.18% 101 28108 0.19% 102 30474 0.20% 103 31494 0.21% 104 33480 0.22% 105 34728 0.23% 106 35349 0.24% 107 35844 0.24% 108 36873 0.25% 109 37636 0.25% 110 38748 0.26% 111 40051 0.27% 112 42014 0.28% 113 43734 0.29% 114 44917 0.30% 115 46958 0.31% 116 47953 0.32% 117 48735 0.32% 118 49592 0.33% 119 49910 0.33% 120 51712 0.34% 121 53146 0.35% 122 55563 0.37% 123 57474 0.38% 124 59908 0.40% 125 60745 0.40% 126 63754 0.42% 127 64722 0.43% 128 66461 0.44% 129 68366 0.45% 130 70507 0.47% 131 73315 0.49% 132 77345 0.51% 133 81292 0.54% 134 86674 0.58% 135 91308 0.61% 136 96363 0.64% 137 103784 0.69% 138 110161 0.73% 139 117522 0.78% 140 125935 0.84% 141 137011 0.91% 142 149101 0.99% 143 165218 1.10% 144 188882 1.26% 145 218897 1.46% 146 266592 1.77% 147 343766 2.29% 148 511500 3.40% 149 968409 6.44% 150 3923609 26.10% 151 5354024 35.62% 15030492 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.24 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=24.71 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.0 sequence=TCCTTCACCTTCA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=20 prefix-density=0.40 prefix-fanout=3.0 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=58.98 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=16.6 sequence=AAGAAAAGAAAA SRR7171122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:23:10 Started mapping on | Feb 14 07:23:11 Finished on | Feb 14 07:25:06 Mapping speed, Million of reads per hour | 470.52 Number of input reads | 15030492 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14089718 Uniquely mapped reads % | 93.74% Average mapped length | 287.06 Number of splices: Total | 13257202 Number of splices: Annotated (sjdb) | 12876551 Number of splices: GT/AG | 12999041 Number of splices: GC/AG | 186617 Number of splices: AT/AC | 9418 Number of splices: Non-canonical | 62126 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460308 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 16735 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 493895 493895 493895 N_multimapping 460308 460308 460308 N_noFeature 669400 13839594 770823 N_ambiguous 280174 1281 130901 UnstrandedReadsAssigned:13140144 PositiveStrandReadsAssigned:248843 NegativeStrandReadsAssigned:13187994 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171122-trimmed-pair1.fastq SRR7171122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,030,492 reads, 13,095,914 reads pseudoaligned [quant] estimated average fragment length: 227.864 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7171122.ke.tsv 34699 SRR7171122.se.tsv 87100 total ==> SRR7171122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.14 1080 41.4994 Potri.005G024800.1.v4.1 1035 808.136 289 24.6128 Potri.004G059700.1.v4.1 961 734.166 0 0 Potri.007G009000.2.v4.1 1416 1189.14 0 0 Potri.003G141000.2.v4.1 2943 2716.14 749.402 18.9894 Potri.016G087400.1.v4.1 270 93.5975 1056 776.51 Potri.015G069301.1.v4.1 564 343.093 0 0 Potri.010G195200.1.v4.1 1773 1546.14 474 21.0998 Potri.012G127500.1.v4.1 977 750.161 129 11.8354 ==> SRR7171122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 805 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR7171122 completed mapping pipeline successfully