Starting /dee2/code/volunteer_pipeline.sh SRR7171123 current disk space = 3119811944448 free memory = 1579973496 SRR7171123 SRAfilesize 75a891067911204719995f94a8437892 SRR7171123.sra SRR7171123.sra file validated SRR7171123 is paired end SRR7171123 is conventional basespace SRR7171123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.51525 18.0 18.0 18.0 18.0 32.0 2 26.0665 27.0 25.0 29.0 18.0 31.0 3 27.54875 29.0 27.0 31.0 18.0 33.0 4 31.0845 31.0 30.0 33.0 29.0 33.0 5 32.08675 33.0 32.0 33.0 31.0 33.0 6 33.40525 37.0 33.0 38.0 16.0 38.0 7 36.21375 38.0 36.0 38.0 31.0 38.0 8 37.1265 38.0 38.0 38.0 36.0 38.0 9 37.42025 38.0 38.0 38.0 37.0 38.0 10-14 37.431149999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.515550000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.602799999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.57815 38.0 38.0 38.0 37.8 38.0 30-34 37.53425 38.0 38.0 38.0 37.8 38.0 35-39 36.9363 38.0 38.0 38.0 35.0 38.0 40-44 37.433949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.356049999999996 38.0 38.0 38.0 37.0 38.0 50-54 34.56065 37.0 31.0 38.0 28.4 38.0 55-59 36.25175 37.8 35.8 38.0 33.0 38.0 60-64 37.092999999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0901 38.0 38.0 38.0 36.0 38.0 70-74 36.86985 38.0 38.0 38.0 35.0 38.0 75-79 36.7736 38.0 38.0 38.0 34.6 38.0 80-84 36.8264 38.0 38.0 38.0 34.8 38.0 85-89 36.622049999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.44265 38.0 37.6 38.0 34.0 38.0 95-99 36.48965 38.0 37.8 38.0 34.0 38.0 100-104 36.29684999999999 38.0 37.0 38.0 34.0 38.0 105-109 36.18125 38.0 37.0 38.0 33.0 38.0 110-114 35.88045 38.0 36.6 38.0 32.2 38.0 115-119 35.70784999999999 38.0 36.4 38.0 31.0 38.0 120-124 35.5066 38.0 36.0 38.0 30.6 38.0 125-129 35.313 38.0 36.0 38.0 29.8 38.0 130-134 29.2418 32.2 22.6 37.2 16.4 38.0 135-139 33.8237 37.2 33.8 38.0 24.4 38.0 140-144 33.978249999999996 38.0 34.2 38.0 23.6 38.0 145-149 32.9271 38.0 33.0 38.0 18.2 38.0 150-151 28.471 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 2.0 18 5.0 19 0.0 20 6.0 21 4.0 22 4.0 23 8.0 24 6.0 25 11.0 26 20.0 27 21.0 28 19.0 29 26.0 30 39.0 31 74.0 32 116.0 33 160.0 34 292.0 35 633.0 36 1669.0 37 881.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.155339805825243 26.483279395900755 8.441208198489752 36.92017259978425 2 19.3 19.55 37.625 23.525 3 17.75 26.150000000000002 27.0 29.099999999999998 4 22.075 33.4 22.375 22.15 5 22.075 38.0 23.275000000000002 16.650000000000002 6 17.125 36.875 26.200000000000003 19.8 7 14.224999999999998 23.075000000000003 43.974999999999994 18.725 8 17.4 22.900000000000002 32.1 27.6 9 16.85 23.625 34.475 25.05 10-14 20.560000000000002 29.68 26.775 22.985 15-19 20.810000000000002 28.28 27.250000000000004 23.66 20-24 20.325 28.735 27.634999999999998 23.305 25-29 20.25 28.299999999999997 27.54 23.91 30-34 19.950000000000003 29.095 27.845 23.11 35-39 20.200000000000003 28.235 27.889999999999997 23.674999999999997 40-44 20.355 28.965000000000003 27.439999999999998 23.24 45-49 20.119999999999997 28.46 27.744999999999997 23.674999999999997 50-54 20.97 27.985 27.845 23.200000000000003 55-59 20.05 28.555000000000003 27.85 23.544999999999998 60-64 20.21 28.175 28.035 23.580000000000002 65-69 20.11 28.76 27.639999999999997 23.49 70-74 20.355 28.389999999999997 27.62 23.635 75-79 20.380000000000003 27.975 27.47 24.175 80-84 20.65 27.865000000000002 27.865000000000002 23.62 85-89 20.785 28.34 27.515 23.36 90-94 20.485 28.42 27.58 23.515 95-99 20.765 27.905 27.85 23.48 100-104 21.095 28.705000000000002 27.04 23.16 105-109 21.23 28.52 27.54 22.71 110-114 20.465 29.205 27.034999999999997 23.294999999999998 115-119 21.099999999999998 29.285 27.224999999999998 22.39 120-124 21.0 28.405 26.97 23.625 125-129 21.105 28.67 26.665 23.56 130-134 21.01 29.104999999999997 26.745 23.14 135-139 21.215 28.84 26.634999999999998 23.31 140-144 21.495 28.744999999999997 26.325 23.435 145-149 20.89 28.854999999999997 26.645000000000003 23.61 150-151 21.3875 27.625 27.55 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 3.0 25 6.0 26 6.5 27 8.5 28 15.0 29 19.5 30 24.5 31 33.5 32 35.0 33 40.5 34 58.5 35 78.5 36 101.5 37 111.5 38 133.0 39 171.5 40 187.5 41 215.0 42 248.0 43 236.5 44 239.5 45 259.0 46 261.0 47 259.0 48 214.5 49 183.0 50 183.0 51 153.0 52 114.5 53 88.0 54 68.5 55 55.5 56 48.0 57 39.5 58 28.5 59 20.0 60 13.5 61 8.5 62 6.5 63 6.0 64 4.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.612500000000001 0.0 0.0 0.0 0.0 128-129 4.862500000000001 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.3625 0.0 0.0 0.0 0.0 138-139 8.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06425 33.0 33.0 34.0 32.0 34.0 2 33.13125 34.0 33.0 34.0 33.0 34.0 3 33.07075 34.0 33.0 34.0 32.0 34.0 4 33.14175 34.0 33.0 34.0 33.0 34.0 5 33.2485 34.0 33.0 34.0 33.0 34.0 6 37.343 38.0 38.0 38.0 37.0 38.0 7 36.30525 38.0 38.0 38.0 34.0 38.0 8 37.12875 38.0 38.0 38.0 36.0 38.0 9 37.30525 38.0 38.0 38.0 37.0 38.0 10-14 37.4002 38.0 38.0 38.0 37.2 38.0 15-19 37.3242 38.0 38.0 38.0 37.0 38.0 20-24 37.243399999999994 38.0 38.0 38.0 36.8 38.0 25-29 37.0392 38.0 38.0 38.0 36.4 38.0 30-34 37.2721 38.0 38.0 38.0 37.0 38.0 35-39 37.2793 38.0 38.0 38.0 37.0 38.0 40-44 37.23375 38.0 38.0 38.0 37.0 38.0 45-49 35.95955 38.0 36.0 38.0 30.6 38.0 50-54 37.1767 38.0 38.0 38.0 36.8 38.0 55-59 37.1443 38.0 38.0 38.0 36.4 38.0 60-64 37.08969999999999 38.0 38.0 38.0 36.2 38.0 65-69 37.12075 38.0 38.0 38.0 36.2 38.0 70-74 37.0486 38.0 38.0 38.0 36.0 38.0 75-79 37.043899999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.8782 38.0 38.0 38.0 35.8 38.0 85-89 36.86285 38.0 38.0 38.0 35.8 38.0 90-94 36.8006 38.0 38.0 38.0 35.2 38.0 95-99 36.7091 38.0 38.0 38.0 35.0 38.0 100-104 36.420849999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.23909999999999 38.0 37.6 38.0 33.6 38.0 110-114 33.906400000000005 37.8 33.2 38.0 23.0 38.0 115-119 35.782799999999995 38.0 36.6 38.0 31.6 38.0 120-124 35.75815 38.0 36.6 38.0 32.0 38.0 125-129 35.461 38.0 36.0 38.0 30.2 38.0 130-134 35.2208 38.0 36.0 38.0 29.8 38.0 135-139 34.61495 38.0 34.6 38.0 27.4 38.0 140-144 33.95285 38.0 33.0 38.0 24.2 38.0 145-149 32.99810000000001 38.0 33.0 38.0 17.8 38.0 150-151 27.82525 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 3.0 11 2.0 12 0.0 13 0.0 14 5.0 15 2.0 16 3.0 17 3.0 18 1.0 19 2.0 20 6.0 21 1.0 22 4.0 23 6.0 24 8.0 25 13.0 26 12.0 27 20.0 28 16.0 29 34.0 30 47.0 31 67.0 32 85.0 33 103.0 34 170.0 35 347.0 36 822.0 37 2212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.275 19.125 11.875 27.725 2 25.3 25.7 32.675 16.325 3 20.775 27.224999999999998 31.324999999999996 20.674999999999997 4 23.799999999999997 35.6 23.200000000000003 17.4 5 23.275000000000002 36.8 23.400000000000002 16.525000000000002 6 19.7 38.175 23.724999999999998 18.4 7 19.475 19.15 41.625 19.75 8 20.05 24.325 29.225 26.400000000000002 9 22.925 23.375 29.4 24.3 10-14 23.645 28.945 26.035000000000004 21.375 15-19 22.5 28.29 28.144999999999996 21.065 20-24 22.61 28.599999999999998 27.805000000000003 20.985 25-29 22.915 28.470000000000002 27.944999999999997 20.669999999999998 30-34 22.84 28.24 27.839999999999996 21.08 35-39 22.835 28.165000000000003 28.29 20.71 40-44 23.075000000000003 28.235 27.375 21.315 45-49 22.78 28.255000000000003 28.12 20.845 50-54 22.67 28.110000000000003 28.005000000000003 21.215 55-59 23.73 26.75 28.43 21.09 60-64 22.855 27.375 28.939999999999998 20.830000000000002 65-69 22.89 27.55 27.845 21.715 70-74 22.895 27.98 27.779999999999998 21.345 75-79 23.244999999999997 27.85 27.834999999999997 21.07 80-84 23.525 27.77 27.605 21.099999999999998 85-89 23.585 27.725 28.144999999999996 20.544999999999998 90-94 22.79 27.985 28.044999999999998 21.18 95-99 22.8 27.88 27.91 21.41 100-104 23.505000000000003 27.925 27.415 21.154999999999998 105-109 23.04 28.315 27.855 20.79 110-114 23.665 28.37 27.045 20.919999999999998 115-119 24.18 28.455000000000002 27.0 20.365 120-124 23.765 27.755000000000003 27.82 20.66 125-129 24.2 27.305 27.785 20.71 130-134 24.565 27.985 27.439999999999998 20.01 135-139 24.610000000000003 27.639999999999997 27.565 20.185 140-144 24.935 27.565 27.485 20.015 145-149 25.290000000000003 27.515 27.16 20.035 150-151 24.337500000000002 27.987499999999997 27.3125 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 3.0 23 3.5 24 3.5 25 5.0 26 5.5 27 10.5 28 12.0 29 8.5 30 13.0 31 19.0 32 29.5 33 37.5 34 47.0 35 66.5 36 78.5 37 110.5 38 145.0 39 160.0 40 189.5 41 222.0 42 250.0 43 261.5 44 252.5 45 266.5 46 284.0 47 255.0 48 214.5 49 199.0 50 174.0 51 131.0 52 115.0 53 102.0 54 80.0 55 66.5 56 45.5 57 31.0 58 29.5 59 24.5 60 13.0 61 8.0 62 8.0 63 5.5 64 3.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4274578828262509 0.8500000000000001 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.175000000000001 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 7.125 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.5 0.0 0.0 0.0 0.0 138-139 9.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865162 spots for SRR7171123.sra Written 865162 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra Read 865145 spots for SRR7171123.sra Written 865145 spots for SRR7171123.sra SRR ids: ['SRR7171123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fmjgk8mp SRR7171123.sra spots: 17302917 blocks: [[1, 865145], [865146, 1730290], [1730291, 2595435], [2595436, 3460580], [3460581, 4325725], [4325726, 5190870], [5190871, 6056015], [6056016, 6921160], [6921161, 7786305], [7786306, 8651450], [8651451, 9516595], [9516596, 10381740], [10381741, 11246885], [11246886, 12112030], [12112031, 12977175], [12977176, 13842320], [13842321, 14707465], [14707466, 15572610], [15572611, 16437755], [16437756, 17302917]] SRR7171123 file size 5841690 SRR7171123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171123 SRR7171123_1.fastq SRR7171123_2.fastq Input file: SRR7171123_1.fastq Paired file: SRR7171123_2.fastq trimmed: SRR7171123-trimmed-pair1.fastq, SRR7171123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:28:19 2025 >> started Fri Feb 14 07:28:44 2025 >> done (25.035s) 17302917 read pairs processed; of these: 12928 ( 0.07%) short read pairs filtered out after trimming by size control 17016 ( 0.10%) empty read pairs filtered out after trimming by size control 17272973 (99.83%) read pairs available; of these: 9720710 (56.28%) trimmed read pairs available after processing 7552263 (43.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 9 0.00% 21 6 0.00% 22 7 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 9 0.00% 27 6 0.00% 28 11 0.00% 29 8 0.00% 30 12 0.00% 31 15 0.00% 32 16 0.00% 33 16 0.00% 34 8 0.00% 35 16 0.00% 36 24 0.00% 37 27 0.00% 38 28 0.00% 39 31 0.00% 40 40 0.00% 41 47 0.00% 42 47 0.00% 43 57 0.00% 44 58 0.00% 45 68 0.00% 46 68 0.00% 47 85 0.00% 48 85 0.00% 49 106 0.00% 50 133 0.00% 51 138 0.00% 52 162 0.00% 53 194 0.00% 54 182 0.00% 55 184 0.00% 56 224 0.00% 57 218 0.00% 58 252 0.00% 59 330 0.00% 60 377 0.00% 61 430 0.00% 62 476 0.00% 63 552 0.00% 64 584 0.00% 65 686 0.00% 66 695 0.00% 67 790 0.00% 68 864 0.01% 69 1012 0.01% 70 1130 0.01% 71 1304 0.01% 72 1519 0.01% 73 1695 0.01% 74 1952 0.01% 75 2268 0.01% 76 2653 0.02% 77 2971 0.02% 78 2928 0.02% 79 3204 0.02% 80 3419 0.02% 81 3958 0.02% 82 4487 0.03% 83 5068 0.03% 84 6243 0.04% 85 7191 0.04% 86 7554 0.04% 87 8149 0.05% 88 8865 0.05% 89 9388 0.05% 90 10088 0.06% 91 11069 0.06% 92 11763 0.07% 93 12965 0.08% 94 14175 0.08% 95 15239 0.09% 96 15957 0.09% 97 17093 0.10% 98 17351 0.10% 99 18553 0.11% 100 19799 0.11% 101 20914 0.12% 102 22290 0.13% 103 23415 0.14% 104 24776 0.14% 105 26620 0.15% 106 27318 0.16% 107 28853 0.17% 108 29800 0.17% 109 31081 0.18% 110 31871 0.18% 111 33371 0.19% 112 35115 0.20% 113 36274 0.21% 114 38532 0.22% 115 39577 0.23% 116 40872 0.24% 117 42132 0.24% 118 43509 0.25% 119 44094 0.26% 120 45658 0.26% 121 47224 0.27% 122 48298 0.28% 123 50301 0.29% 124 52036 0.30% 125 53628 0.31% 126 55653 0.32% 127 57171 0.33% 128 58917 0.34% 129 60618 0.35% 130 62266 0.36% 131 64280 0.37% 132 67467 0.39% 133 70722 0.41% 134 73667 0.43% 135 77660 0.45% 136 81648 0.47% 137 86468 0.50% 138 90756 0.53% 139 98891 0.57% 140 105215 0.61% 141 115121 0.67% 142 128810 0.75% 143 147250 0.85% 144 171721 0.99% 145 207791 1.20% 146 262187 1.52% 147 360833 2.09% 148 557436 3.23% 149 1085973 6.29% 150 4395208 25.45% 151 7552263 43.72% 17272973 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=33 prefix-density=0.41 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=10.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=30 prefix-density=0.31 prefix-fanout=2.3 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=38.84 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.2 sequence=CACAGAGAACACATTCATAC SRR7171123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:29:29 Started mapping on | Feb 14 07:29:29 Finished on | Feb 14 07:31:28 Mapping speed, Million of reads per hour | 522.54 Number of input reads | 17272973 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16172381 Uniquely mapped reads % | 93.63% Average mapped length | 291.66 Number of splices: Total | 14693483 Number of splices: Annotated (sjdb) | 14375515 Number of splices: GT/AG | 14407424 Number of splices: GC/AG | 233249 Number of splices: AT/AC | 9465 Number of splices: Non-canonical | 43345 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 529932 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 87355 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 583477 583477 583477 N_multimapping 529932 529932 529932 N_noFeature 645016 15939186 738026 N_ambiguous 244982 1199 103969 UnstrandedReadsAssigned:15282383 PositiveStrandReadsAssigned:231996 NegativeStrandReadsAssigned:15330386 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171123-trimmed-pair1.fastq SRR7171123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,272,973 reads, 15,401,740 reads pseudoaligned [quant] estimated average fragment length: 228.125 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR7171123.ke.tsv 34699 SRR7171123.se.tsv 87100 total ==> SRR7171123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.87 473 16.9524 Potri.005G024800.1.v4.1 1035 807.875 337 26.7744 Potri.004G059700.1.v4.1 961 733.898 5 0.437289 Potri.007G009000.2.v4.1 1416 1188.87 1 0.0539881 Potri.003G141000.2.v4.1 2943 2715.87 751.595 17.7627 Potri.016G087400.1.v4.1 270 86.4595 849 630.274 Potri.015G069301.1.v4.1 564 340.365 0 0 Potri.010G195200.1.v4.1 1773 1545.87 16 0.664324 Potri.012G127500.1.v4.1 977 749.886 161 13.7805 ==> SRR7171123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 761 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 351 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7171123 completed mapping pipeline successfully