Starting /dee2/code/volunteer_pipeline.sh SRR7171124 current disk space = 3119658795008 free memory = 1582437424 SRR7171124 SRAfilesize f7d764dd6566d99a5e964b513e74a795 SRR7171124.sra SRR7171124.sra file validated SRR7171124 is paired end SRR7171124 is conventional basespace SRR7171124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.27525 32.0 25.0 33.0 18.0 33.0 2 31.1855 33.0 31.0 33.0 27.0 34.0 3 31.4135 33.0 31.0 33.0 28.0 33.0 4 31.208 33.0 31.0 33.0 28.0 33.0 5 32.2275 33.0 33.0 33.0 31.0 34.0 6 36.515 38.0 37.0 38.0 34.0 38.0 7 36.81425 38.0 37.0 38.0 35.0 38.0 8 37.4065 38.0 38.0 38.0 37.0 38.0 9 35.64275 38.0 38.0 38.0 29.0 38.0 10-14 37.2954 38.0 38.0 38.0 36.2 38.0 15-19 37.45975 38.0 38.0 38.0 37.6 38.0 20-24 37.506 38.0 38.0 38.0 37.8 38.0 25-29 37.45389999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.449149999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.36725 38.0 38.0 38.0 37.0 38.0 40-44 37.2919 38.0 38.0 38.0 37.0 38.0 45-49 37.1857 38.0 38.0 38.0 36.8 38.0 50-54 35.716300000000004 38.0 35.4 38.0 30.8 38.0 55-59 37.073150000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.059450000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.02475 38.0 38.0 38.0 36.0 38.0 70-74 36.99885 38.0 38.0 38.0 36.0 38.0 75-79 36.876400000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.25325 38.0 37.6 38.0 32.8 38.0 85-89 36.586749999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.5736 38.0 38.0 38.0 34.6 38.0 95-99 36.496300000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.46124999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.46695 38.0 38.0 38.0 34.2 38.0 110-114 36.00715 38.0 37.0 38.0 33.2 38.0 115-119 35.84985 38.0 37.0 38.0 32.0 38.0 120-124 35.70455 38.0 37.0 38.0 31.8 38.0 125-129 35.385549999999995 38.0 36.2 38.0 30.4 38.0 130-134 33.591 38.0 32.2 38.0 22.0 38.0 135-139 34.49285 38.0 34.2 38.0 27.4 38.0 140-144 34.101549999999996 38.0 33.6 38.0 25.6 38.0 145-149 33.28145 38.0 33.0 38.0 19.4 38.0 150-151 27.822875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 3.0 9 2.0 10 4.0 11 0.0 12 2.0 13 2.0 14 1.0 15 2.0 16 4.0 17 0.0 18 1.0 19 4.0 20 4.0 21 4.0 22 6.0 23 6.0 24 11.0 25 14.0 26 12.0 27 19.0 28 26.0 29 27.0 30 49.0 31 66.0 32 75.0 33 112.0 34 184.0 35 332.0 36 993.0 37 2032.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.94028287061288 13.776846516500784 8.433734939759036 31.849135673127293 2 19.809904952476238 18.509254627313656 35.24262131065532 26.43821910955478 3 16.950000000000003 24.875 29.225 28.95 4 23.325000000000003 31.624999999999996 23.125 21.925 5 20.681021532298445 35.92889334001001 24.536805207811717 18.85327991987982 6 18.05 35.375 26.400000000000002 20.175 7 14.124999999999998 22.3 46.325 17.25 8 17.224999999999998 22.675 31.85 28.249999999999996 9 16.950000000000003 24.275 31.85 26.924999999999997 10-14 19.865 29.075 27.534999999999997 23.525 15-19 19.91 28.005000000000003 28.425 23.66 20-24 19.825 28.525 27.71 23.94 25-29 20.0 28.865000000000002 27.83 23.305 30-34 19.794999999999998 28.675 28.365000000000002 23.165 35-39 19.33 28.67 28.12 23.880000000000003 40-44 20.23202320232023 28.84788478847885 27.81278127812781 23.10731073107311 45-49 20.815 28.225 27.29 23.669999999999998 50-54 19.755 28.215 27.955000000000002 24.075 55-59 19.869999999999997 28.205000000000002 28.08 23.845 60-64 20.07 28.050000000000004 28.57 23.31 65-69 20.09 28.244999999999997 28.22 23.445 70-74 20.125 28.18 28.34 23.355 75-79 19.8 28.765 27.79 23.645 80-84 20.48 28.645 27.63 23.244999999999997 85-89 20.855 27.985 27.884999999999998 23.275000000000002 90-94 20.685000000000002 28.865000000000002 27.41 23.04 95-99 20.57 28.285 28.07 23.075000000000003 100-104 20.294999999999998 28.115000000000002 27.855 23.735 105-109 20.345 28.375 27.57 23.71 110-114 20.185 28.285 27.825 23.705000000000002 115-119 20.385 28.544999999999998 27.439999999999998 23.630000000000003 120-124 20.215 28.685 27.48 23.62 125-129 21.145 28.64 27.13 23.085 130-134 20.549999999999997 28.849999999999998 26.515 24.085 135-139 20.915 28.335 26.915 23.835 140-144 20.54 28.294999999999998 26.96 24.205 145-149 21.23 28.505000000000003 26.435 23.830000000000002 150-151 20.943915873810717 27.766649974962444 27.30345518277416 23.985978968452677 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 1.0 4 2.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 0.5 25 3.0 26 7.0 27 11.0 28 16.5 29 19.0 30 26.5 31 33.5 32 42.5 33 51.5 34 63.5 35 75.0 36 87.5 37 111.0 38 131.0 39 157.5 40 177.0 41 199.0 42 232.5 43 249.5 44 247.0 45 267.0 46 270.5 47 248.5 48 239.0 49 213.0 50 176.0 51 138.5 52 108.5 53 86.0 54 71.0 55 54.0 56 40.0 57 33.5 58 23.5 59 18.0 60 18.0 61 12.0 62 6.5 63 5.5 64 4.5 65 3.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.05 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTGGG 10 0.006836113 144.9625 6 >>END_MODULE SRR7171124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06875 33.0 32.0 34.0 27.0 34.0 2 29.4215 33.0 27.0 34.0 18.0 34.0 3 31.584 33.0 32.0 34.0 27.0 34.0 4 32.19125 33.0 32.0 34.0 31.0 34.0 5 32.50175 33.0 33.0 34.0 32.0 34.0 6 36.65225 38.0 38.0 38.0 35.0 38.0 7 36.855 38.0 38.0 38.0 36.0 38.0 8 36.939 38.0 38.0 38.0 36.0 38.0 9 36.912 38.0 38.0 38.0 36.0 38.0 10-14 36.789699999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.8297 38.0 38.0 38.0 36.0 38.0 20-24 35.84985 38.0 37.4 38.0 29.6 38.0 25-29 36.54715 38.0 37.8 38.0 34.2 38.0 30-34 36.8326 38.0 38.0 38.0 36.2 38.0 35-39 36.80785000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.704600000000006 38.0 38.0 38.0 35.6 38.0 45-49 36.2352 38.0 37.8 38.0 33.2 38.0 50-54 36.639050000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.55965 38.0 38.0 38.0 35.2 38.0 60-64 35.47005 38.0 36.0 38.0 29.4 38.0 65-69 36.4399 38.0 38.0 38.0 34.6 38.0 70-74 36.43085 38.0 38.0 38.0 34.4 38.0 75-79 36.39295 38.0 38.0 38.0 34.4 38.0 80-84 34.33125 37.6 31.4 38.0 27.8 38.0 85-89 36.017399999999995 38.0 37.6 38.0 33.4 38.0 90-94 36.15095 38.0 38.0 38.0 34.0 38.0 95-99 36.021 38.0 37.8 38.0 33.6 38.0 100-104 35.7507 38.0 37.2 38.0 32.2 38.0 105-109 34.83335 38.0 36.0 38.0 26.4 38.0 110-114 34.11405 38.0 34.0 38.0 23.4 38.0 115-119 35.035450000000004 38.0 36.0 38.0 28.8 38.0 120-124 34.82885 38.0 36.0 38.0 28.0 38.0 125-129 34.4735 38.0 36.0 38.0 26.2 38.0 130-134 33.947950000000006 38.0 34.6 38.0 23.0 38.0 135-139 33.3481 38.0 33.2 38.0 19.8 38.0 140-144 32.46725 38.0 33.0 38.0 13.2 38.0 145-149 31.221099999999996 38.0 31.2 38.0 8.0 38.0 150-151 24.973374999999997 32.0 16.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 6.0 5 1.0 6 0.0 7 2.0 8 1.0 9 2.0 10 2.0 11 3.0 12 7.0 13 2.0 14 6.0 15 6.0 16 6.0 17 8.0 18 4.0 19 7.0 20 11.0 21 9.0 22 18.0 23 16.0 24 17.0 25 21.0 26 40.0 27 28.0 28 41.0 29 37.0 30 50.0 31 75.0 32 106.0 33 136.0 34 226.0 35 362.0 36 977.0 37 1750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.8 18.6 10.15 21.45 2 25.7 24.6 31.85 17.849999999999998 3 23.111555777888945 27.288644322161083 30.115057528764382 19.484742371185593 4 23.75 36.175000000000004 21.725 18.35 5 24.0 38.4 21.55 16.05 6 19.775000000000002 39.525 23.5 17.2 7 20.1 20.05 39.0 20.849999999999998 8 20.65 23.599999999999998 29.525000000000002 26.224999999999998 9 22.7 25.124999999999996 28.175 24.0 10-14 23.845 28.82 26.490000000000002 20.845 15-19 22.650000000000002 27.650000000000002 28.720000000000002 20.979999999999997 20-24 22.66 28.32 27.694999999999997 21.325 25-29 22.884999999999998 28.055000000000003 28.215 20.845 30-34 22.795 28.7 28.095 20.41 35-39 22.655 28.595 28.07 20.68 40-44 22.935 28.005000000000003 28.22 20.84 45-49 22.79 27.950000000000003 28.389999999999997 20.87 50-54 23.1 28.744999999999997 27.73 20.424999999999997 55-59 23.16 28.355000000000004 28.125 20.36 60-64 23.59 27.46 27.639999999999997 21.310000000000002 65-69 22.895 27.925 27.495000000000005 21.685 70-74 23.215 27.855 27.905 21.025 75-79 23.305 27.595 28.34 20.76 80-84 23.150000000000002 27.750000000000004 28.185 20.915 85-89 23.465 28.205000000000002 27.41 20.919999999999998 90-94 23.365 27.955000000000002 27.855 20.825 95-99 23.115 27.625 28.265 20.995 100-104 23.835 27.284999999999997 28.199999999999996 20.68 105-109 23.7 28.065 27.800000000000004 20.435 110-114 23.49 27.785 27.98 20.745 115-119 23.849999999999998 27.565 28.03 20.555 120-124 23.945 27.825 27.815 20.415 125-129 24.26 27.944999999999997 28.09 19.705000000000002 130-134 24.490000000000002 27.815 27.74 19.955000000000002 135-139 24.915000000000003 27.79 27.565 19.73 140-144 25.424999999999997 27.26 27.265 20.05 145-149 25.069999999999997 27.750000000000004 27.33 19.85 150-151 26.643295354951796 27.29435332415175 26.25516464254413 19.807186678352323 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 1.5 22 1.0 23 2.0 24 3.5 25 3.5 26 4.0 27 6.0 28 6.5 29 7.5 30 12.0 31 19.5 32 30.5 33 37.0 34 48.5 35 70.5 36 89.5 37 121.5 38 158.5 39 174.0 40 188.0 41 211.5 42 247.0 43 274.5 44 267.0 45 251.0 46 241.5 47 235.5 48 246.0 49 219.0 50 168.0 51 143.5 52 111.5 53 90.0 54 77.5 55 58.0 56 45.0 57 36.5 58 24.5 59 17.5 60 13.5 61 10.0 62 9.0 63 5.5 64 2.0 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47129909365559 98.775 2 0.3776435045317221 0.75 3 0.12588116817724068 0.375 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.6375 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.987500000000001 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAA 10 0.006830828 145.0 1 >>END_MODULE Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978972 spots for SRR7171124.sra Written 978972 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra Read 978970 spots for SRR7171124.sra Written 978970 spots for SRR7171124.sra SRR ids: ['SRR7171124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dpen68vk SRR7171124.sra spots: 19579402 blocks: [[1, 978970], [978971, 1957940], [1957941, 2936910], [2936911, 3915880], [3915881, 4894850], [4894851, 5873820], [5873821, 6852790], [6852791, 7831760], [7831761, 8810730], [8810731, 9789700], [9789701, 10768670], [10768671, 11747640], [11747641, 12726610], [12726611, 13705580], [13705581, 14684550], [14684551, 15663520], [15663521, 16642490], [16642491, 17621460], [17621461, 18600430], [18600431, 19579402]] SRR7171124 file size 6613116 SRR7171124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171124 SRR7171124_1.fastq SRR7171124_2.fastq Input file: SRR7171124_1.fastq Paired file: SRR7171124_2.fastq trimmed: SRR7171124-trimmed-pair1.fastq, SRR7171124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:33:43 2025 >> started Fri Feb 14 07:34:04 2025 >> done (21.206s) 19579402 read pairs processed; of these: 31288 ( 0.16%) short read pairs filtered out after trimming by size control 32221 ( 0.16%) empty read pairs filtered out after trimming by size control 19515893 (99.68%) read pairs available; of these: 11674206 (59.82%) trimmed read pairs available after processing 7841687 (40.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 12 0.00% 21 20 0.00% 22 19 0.00% 23 16 0.00% 24 18 0.00% 25 22 0.00% 26 16 0.00% 27 23 0.00% 28 22 0.00% 29 18 0.00% 30 22 0.00% 31 26 0.00% 32 24 0.00% 33 25 0.00% 34 20 0.00% 35 25 0.00% 36 24 0.00% 37 21 0.00% 38 41 0.00% 39 23 0.00% 40 40 0.00% 41 43 0.00% 42 52 0.00% 43 55 0.00% 44 52 0.00% 45 62 0.00% 46 57 0.00% 47 67 0.00% 48 86 0.00% 49 90 0.00% 50 107 0.00% 51 107 0.00% 52 131 0.00% 53 147 0.00% 54 134 0.00% 55 168 0.00% 56 170 0.00% 57 191 0.00% 58 265 0.00% 59 274 0.00% 60 296 0.00% 61 380 0.00% 62 428 0.00% 63 421 0.00% 64 508 0.00% 65 538 0.00% 66 600 0.00% 67 701 0.00% 68 766 0.00% 69 812 0.00% 70 988 0.01% 71 1098 0.01% 72 1296 0.01% 73 1457 0.01% 74 1617 0.01% 75 1915 0.01% 76 2536 0.01% 77 2491 0.01% 78 2513 0.01% 79 2927 0.01% 80 3145 0.02% 81 3674 0.02% 82 4184 0.02% 83 4824 0.02% 84 6669 0.03% 85 7735 0.04% 86 8469 0.04% 87 9150 0.05% 88 9884 0.05% 89 10558 0.05% 90 11348 0.06% 91 11957 0.06% 92 12643 0.06% 93 13738 0.07% 94 14411 0.07% 95 15176 0.08% 96 16050 0.08% 97 16698 0.09% 98 17687 0.09% 99 18960 0.10% 100 20220 0.10% 101 21038 0.11% 102 22738 0.12% 103 24309 0.12% 104 25464 0.13% 105 27337 0.14% 106 28549 0.15% 107 29565 0.15% 108 30750 0.16% 109 32335 0.17% 110 33414 0.17% 111 35154 0.18% 112 36795 0.19% 113 38446 0.20% 114 40714 0.21% 115 42461 0.22% 116 44287 0.23% 117 45627 0.23% 118 46767 0.24% 119 48627 0.25% 120 50506 0.26% 121 52733 0.27% 122 55106 0.28% 123 57702 0.30% 124 60549 0.31% 125 62810 0.32% 126 65819 0.34% 127 67580 0.35% 128 71355 0.37% 129 73871 0.38% 130 76742 0.39% 131 79400 0.41% 132 85006 0.44% 133 90610 0.46% 134 95403 0.49% 135 103039 0.53% 136 109967 0.56% 137 117249 0.60% 138 126202 0.65% 139 136126 0.70% 140 145433 0.75% 141 159147 0.82% 142 175869 0.90% 143 195880 1.00% 144 223297 1.14% 145 260448 1.33% 146 323050 1.66% 147 425858 2.18% 148 632190 3.24% 149 1226525 6.28% 150 5350127 27.41% 151 7841687 40.18% 19515893 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=336.90 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=19.35 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:34:47 Started mapping on | Feb 14 07:34:47 Finished on | Feb 14 07:37:04 Mapping speed, Million of reads per hour | 512.83 Number of input reads | 19515893 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18198563 Uniquely mapped reads % | 93.25% Average mapped length | 291.41 Number of splices: Total | 17269727 Number of splices: Annotated (sjdb) | 16897642 Number of splices: GT/AG | 16943008 Number of splices: GC/AG | 263889 Number of splices: AT/AC | 10131 Number of splices: Non-canonical | 52699 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500938 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 57081 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 854130 854130 854130 N_multimapping 500938 500938 500938 N_noFeature 743860 17889931 870453 N_ambiguous 291426 1107 108825 UnstrandedReadsAssigned:17163277 PositiveStrandReadsAssigned:307525 NegativeStrandReadsAssigned:17219285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171124-trimmed-pair1.fastq SRR7171124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,515,893 reads, 17,187,734 reads pseudoaligned [quant] estimated average fragment length: 230.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7171124.ke.tsv 34699 SRR7171124.se.tsv 87100 total ==> SRR7171124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.07 672 19.8452 Potri.005G024800.1.v4.1 1035 805.066 220 14.4298 Potri.004G059700.1.v4.1 961 731.076 33 2.38353 Potri.007G009000.2.v4.1 1416 1186.07 0 0 Potri.003G141000.2.v4.1 2943 2713.07 675 13.1375 Potri.016G087400.1.v4.1 270 84.8767 978 608.443 Potri.015G069301.1.v4.1 564 338.804 0 0 Potri.010G195200.1.v4.1 1773 1543.07 52 1.77946 Potri.012G127500.1.v4.1 977 747.066 261 18.4481 ==> SRR7171124.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1342 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR7171124 completed mapping pipeline successfully