Starting /dee2/code/volunteer_pipeline.sh SRR7171125 current disk space = 3085125390336 free memory = 1465239500 SRR7171125 SRAfilesize fdea43d5be3c11260bab62962988e2a1 SRR7171125.sra SRR7171125.sra file validated SRR7171125 is paired end SRR7171125 is conventional basespace SRR7171125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.40675 30.0 18.0 33.0 18.0 33.0 2 24.55575 25.0 18.0 29.0 18.0 33.0 3 28.326 29.0 27.0 31.0 25.0 33.0 4 31.0075 31.0 30.0 33.0 28.0 33.0 5 32.14725 33.0 32.0 33.0 32.0 33.0 6 36.24975 37.0 36.0 38.0 33.0 38.0 7 36.99075 38.0 37.0 38.0 35.0 38.0 8 37.37675 38.0 38.0 38.0 36.0 38.0 9 37.46025 38.0 38.0 38.0 37.0 38.0 10-14 37.47165 38.0 38.0 38.0 37.0 38.0 15-19 37.575450000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.439350000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.34365 38.0 38.0 38.0 37.0 38.0 30-34 37.29805 38.0 38.0 38.0 37.0 38.0 35-39 37.267849999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.1601 38.0 38.0 38.0 37.0 38.0 45-49 37.127750000000006 38.0 38.0 38.0 36.4 38.0 50-54 36.833800000000004 38.0 38.0 38.0 35.4 38.0 55-59 35.91145 38.0 36.6 38.0 29.6 38.0 60-64 36.782999999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.7923 38.0 38.0 38.0 35.2 38.0 70-74 36.6379 38.0 38.0 38.0 34.8 38.0 75-79 36.5314 38.0 38.0 38.0 34.4 38.0 80-84 36.43255 38.0 38.0 38.0 34.2 38.0 85-89 36.19995 38.0 37.4 38.0 33.8 38.0 90-94 35.98095 38.0 37.0 38.0 33.0 38.0 95-99 35.92315 38.0 37.0 38.0 32.6 38.0 100-104 35.837650000000004 38.0 37.0 38.0 33.0 38.0 105-109 35.7398 38.0 37.0 38.0 32.2 38.0 110-114 35.524350000000005 38.0 36.8 38.0 31.0 38.0 115-119 34.999 38.0 36.0 38.0 28.6 38.0 120-124 34.8981 38.0 35.8 38.0 28.0 38.0 125-129 34.705149999999996 38.0 35.0 38.0 27.6 38.0 130-134 31.38195 35.2 27.8 38.0 18.6 38.0 135-139 33.471500000000006 38.0 34.0 38.0 19.8 38.0 140-144 33.0022 38.0 33.4 38.0 16.0 38.0 145-149 32.204699999999995 37.2 32.4 38.0 13.8 38.0 150-151 27.6845 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 5.0 7 3.0 8 2.0 9 1.0 10 2.0 11 2.0 12 5.0 13 3.0 14 4.0 15 2.0 16 6.0 17 8.0 18 2.0 19 5.0 20 8.0 21 7.0 22 7.0 23 3.0 24 12.0 25 9.0 26 20.0 27 26.0 28 36.0 29 34.0 30 41.0 31 59.0 32 87.0 33 148.0 34 246.0 35 485.0 36 1456.0 37 1266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.521785054132565 12.305254819118035 9.90229733298125 25.270662793768157 2 22.6 15.85 36.55 25.0 3 17.974999999999998 25.7 30.125 26.200000000000003 4 22.125 30.5 25.35 22.025 5 20.775 35.075 25.15 19.0 6 18.3 35.525 26.924999999999997 19.25 7 13.950000000000001 22.675 45.025 18.35 8 18.4 22.3 32.975 26.325 9 18.6 21.7 34.5 25.2 10-14 20.115 29.95 27.51 22.425 15-19 20.7 28.549999999999997 28.205000000000002 22.545 20-24 20.105 29.265 27.865000000000002 22.765 25-29 20.1 28.865000000000002 28.115000000000002 22.919999999999998 30-34 19.855 29.099999999999998 28.444999999999997 22.6 35-39 20.115 28.725 28.24 22.919999999999998 40-44 20.28 28.720000000000002 28.360000000000003 22.64 45-49 20.345 28.455000000000002 27.935 23.265 50-54 20.53 28.84 28.244999999999997 22.384999999999998 55-59 20.09 28.799999999999997 28.139999999999997 22.97 60-64 20.26 28.294999999999998 28.375 23.07 65-69 20.095 28.345 28.785 22.775000000000002 70-74 20.560000000000002 28.349999999999998 28.12 22.97 75-79 20.745 28.360000000000003 27.965 22.93 80-84 20.055 28.77 28.125 23.05 85-89 20.09 28.499999999999996 28.22 23.189999999999998 90-94 20.59 28.050000000000004 28.444999999999997 22.915 95-99 20.595 28.67 27.725 23.01 100-104 20.14 28.384999999999998 28.435 23.04 105-109 20.395 28.345 27.96 23.3 110-114 20.775 28.435 27.834999999999997 22.955000000000002 115-119 21.21 28.7 27.505000000000003 22.585 120-124 21.215 28.76 27.04 22.985 125-129 20.580000000000002 28.535 27.595 23.29 130-134 20.225 28.605000000000004 27.450000000000003 23.72 135-139 21.335 28.82 26.924999999999997 22.919999999999998 140-144 21.035 28.494999999999997 27.105 23.365 145-149 20.895 29.03 26.615 23.46 150-151 21.175 29.225 26.687499999999996 22.912499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 6.0 2 5.5 3 4.5 4 1.5 5 1.5 6 1.5 7 1.5 8 2.0 9 2.0 10 1.0 11 0.5 12 0.5 13 0.5 14 1.5 15 1.0 16 1.0 17 1.0 18 0.5 19 1.5 20 1.0 21 1.0 22 3.5 23 6.0 24 8.5 25 9.5 26 13.5 27 18.5 28 19.0 29 19.0 30 24.0 31 40.0 32 48.5 33 53.5 34 64.5 35 76.5 36 100.5 37 116.0 38 135.5 39 159.5 40 178.0 41 200.0 42 210.5 43 233.0 44 262.0 45 242.5 46 221.5 47 237.0 48 229.0 49 186.0 50 165.5 51 145.0 52 105.5 53 95.0 54 82.5 55 63.5 56 53.0 57 41.5 58 28.5 59 22.0 60 19.5 61 10.0 62 3.0 63 2.5 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.5547150781643975 1.0999999999999999 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.4625000000000004 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.1375 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.2375 0.0 0.0 0.0 0.0 126-127 6.5875 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.6875 0.0 0.0 0.0 0.0 132-133 8.225 0.0 0.0 0.0 0.0 134-135 8.925 0.0 0.0 0.0 0.0 136-137 9.6625 0.0 0.0 0.0 0.0 138-139 10.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGTA 10 0.006836113 144.9625 4 AGAGCAT 10 0.006836113 144.9625 9 AAGAGCA 40 0.007666461 18.120312 140-144 >>END_MODULE SRR7171125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48325 33.0 33.0 34.0 32.0 34.0 2 32.77325 33.0 33.0 34.0 32.0 34.0 3 30.58275 33.0 31.0 34.0 18.0 34.0 4 32.07775 33.0 32.0 34.0 28.0 34.0 5 32.65425 33.0 33.0 34.0 32.0 34.0 6 37.03875 38.0 38.0 38.0 36.0 38.0 7 37.033 38.0 38.0 38.0 37.0 38.0 8 37.1025 38.0 38.0 38.0 37.0 38.0 9 37.18425 38.0 38.0 38.0 37.0 38.0 10-14 37.15625 38.0 38.0 38.0 37.0 38.0 15-19 37.138200000000005 38.0 38.0 38.0 37.0 38.0 20-24 36.7606 38.0 38.0 38.0 35.0 38.0 25-29 36.662 38.0 38.0 38.0 35.2 38.0 30-34 36.96765 38.0 38.0 38.0 36.2 38.0 35-39 37.0166 38.0 38.0 38.0 36.8 38.0 40-44 37.04254999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.03715 38.0 38.0 38.0 36.8 38.0 50-54 37.0308 38.0 38.0 38.0 36.6 38.0 55-59 36.97455 38.0 38.0 38.0 36.2 38.0 60-64 36.95885 38.0 38.0 38.0 36.0 38.0 65-69 36.8833 38.0 38.0 38.0 36.0 38.0 70-74 36.84755 38.0 38.0 38.0 36.0 38.0 75-79 36.8558 38.0 38.0 38.0 36.0 38.0 80-84 36.64045 38.0 38.0 38.0 35.2 38.0 85-89 36.56825 38.0 38.0 38.0 34.8 38.0 90-94 36.65235 38.0 38.0 38.0 35.2 38.0 95-99 36.516949999999994 38.0 38.0 38.0 34.4 38.0 100-104 36.2414 38.0 37.8 38.0 33.8 38.0 105-109 35.99550000000001 38.0 37.6 38.0 33.0 38.0 110-114 34.093650000000004 37.4 32.0 38.0 27.4 38.0 115-119 35.29625 38.0 36.2 38.0 29.6 38.0 120-124 35.43390000000001 38.0 36.2 38.0 30.6 38.0 125-129 35.14925 38.0 36.0 38.0 29.2 38.0 130-134 34.82405 38.0 35.8 38.0 27.8 38.0 135-139 34.376999999999995 38.0 34.8 38.0 26.8 38.0 140-144 33.79 38.0 33.4 38.0 23.6 38.0 145-149 32.72495 38.0 33.0 38.0 14.0 38.0 150-151 27.344625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 0.0 5 1.0 6 3.0 7 1.0 8 2.0 9 2.0 10 0.0 11 4.0 12 2.0 13 0.0 14 4.0 15 2.0 16 5.0 17 6.0 18 4.0 19 2.0 20 3.0 21 7.0 22 12.0 23 10.0 24 7.0 25 12.0 26 19.0 27 22.0 28 29.0 29 36.0 30 54.0 31 55.0 32 81.0 33 110.0 34 156.0 35 309.0 36 848.0 37 2182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.95 19.0 10.875 20.175 2 26.900000000000002 23.825 30.525000000000002 18.75 3 20.075000000000003 27.474999999999998 31.424999999999997 21.025 4 23.3 35.25 22.95 18.5 5 24.5 36.525 21.925 17.05 6 19.575 39.300000000000004 22.375 18.75 7 18.825 21.675 38.925 20.575 8 20.1 25.6 27.6 26.700000000000003 9 21.775 25.924999999999997 28.525 23.775 10-14 22.985 28.895 26.474999999999998 21.645 15-19 22.74 28.21 27.939999999999998 21.11 20-24 22.759999999999998 28.675 27.615000000000002 20.95 25-29 22.735 28.605000000000004 27.765 20.895 30-34 22.57 28.225 28.325 20.880000000000003 35-39 23.169999999999998 28.050000000000004 27.48 21.3 40-44 22.435 29.005 27.54 21.02 45-49 22.955000000000002 28.175 28.08 20.79 50-54 22.955000000000002 28.549999999999997 27.810000000000002 20.685000000000002 55-59 23.380000000000003 27.425 28.17 21.025 60-64 22.75 27.92 28.005000000000003 21.325 65-69 22.915 27.615000000000002 28.425 21.044999999999998 70-74 23.275000000000002 27.950000000000003 27.91 20.865000000000002 75-79 22.955000000000002 27.715 27.72 21.61 80-84 22.84 28.349999999999998 28.110000000000003 20.7 85-89 23.205000000000002 28.044999999999998 27.82 20.93 90-94 23.655 28.58 27.12 20.645 95-99 22.79 28.075 27.785 21.349999999999998 100-104 23.285 27.935 28.199999999999996 20.580000000000002 105-109 23.52 28.249999999999996 27.405 20.825 110-114 23.26 28.68 27.905 20.155 115-119 23.82 28.595 27.315 20.27 120-124 24.310000000000002 28.015 27.515 20.16 125-129 23.69 28.475 27.305 20.53 130-134 24.26 28.005000000000003 27.384999999999998 20.349999999999998 135-139 24.815 27.500000000000004 27.589999999999996 20.095 140-144 25.215 28.155 26.765 19.865 145-149 25.435000000000002 28.544999999999998 26.845000000000002 19.175 150-151 26.625 27.737499999999997 27.1125 18.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 2.5 22 3.0 23 1.5 24 1.5 25 4.5 26 7.0 27 6.0 28 10.0 29 17.5 30 21.5 31 28.5 32 35.5 33 39.0 34 53.5 35 69.0 36 82.5 37 103.5 38 126.0 39 157.5 40 187.0 41 212.0 42 243.0 43 261.5 44 258.5 45 262.5 46 259.0 47 236.5 48 214.5 49 204.0 50 181.0 51 148.0 52 120.5 53 103.0 54 84.5 55 64.0 56 51.0 57 35.0 58 26.0 59 20.0 60 16.5 61 9.0 62 7.0 63 8.0 64 4.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0250000000000004 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 2.95 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.5875000000000004 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.425 0.0 0.0 0.0 0.0 118-119 4.762499999999999 0.0 0.0 0.0 0.0 120-121 5.35 0.0 0.0 0.0 0.0 122-123 5.95 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.7875 0.0 0.0 0.0 0.0 128-129 7.512499999999999 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.675 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912937 spots for SRR7171125.sra Written 912937 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra Read 912926 spots for SRR7171125.sra Written 912926 spots for SRR7171125.sra SRR ids: ['SRR7171125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l2pqssts SRR7171125.sra spots: 18258531 blocks: [[1, 912926], [912927, 1825852], [1825853, 2738778], [2738779, 3651704], [3651705, 4564630], [4564631, 5477556], [5477557, 6390482], [6390483, 7303408], [7303409, 8216334], [8216335, 9129260], [9129261, 10042186], [10042187, 10955112], [10955113, 11868038], [11868039, 12780964], [12780965, 13693890], [13693891, 14606816], [14606817, 15519742], [15519743, 16432668], [16432669, 17345594], [17345595, 18258531]] SRR7171125 file size 6165516 SRR7171125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171125 SRR7171125_1.fastq SRR7171125_2.fastq Input file: SRR7171125_1.fastq Paired file: SRR7171125_2.fastq trimmed: SRR7171125-trimmed-pair1.fastq, SRR7171125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:47:16 2025 >> started Fri Feb 14 06:47:37 2025 >> done (21.101s) 18258531 read pairs processed; of these: 22603 ( 0.12%) short read pairs filtered out after trimming by size control 22596 ( 0.12%) empty read pairs filtered out after trimming by size control 18213332 (99.75%) read pairs available; of these: 11182876 (61.40%) trimmed read pairs available after processing 7030456 (38.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 26 0.00% 21 35 0.00% 22 39 0.00% 23 45 0.00% 24 51 0.00% 25 51 0.00% 26 52 0.00% 27 39 0.00% 28 50 0.00% 29 46 0.00% 30 45 0.00% 31 52 0.00% 32 36 0.00% 33 33 0.00% 34 40 0.00% 35 38 0.00% 36 30 0.00% 37 54 0.00% 38 53 0.00% 39 57 0.00% 40 66 0.00% 41 70 0.00% 42 77 0.00% 43 87 0.00% 44 110 0.00% 45 106 0.00% 46 130 0.00% 47 147 0.00% 48 149 0.00% 49 193 0.00% 50 227 0.00% 51 252 0.00% 52 292 0.00% 53 324 0.00% 54 363 0.00% 55 366 0.00% 56 441 0.00% 57 479 0.00% 58 568 0.00% 59 642 0.00% 60 726 0.00% 61 776 0.00% 62 809 0.00% 63 908 0.00% 64 1030 0.01% 65 1131 0.01% 66 1228 0.01% 67 1261 0.01% 68 1371 0.01% 69 1654 0.01% 70 1800 0.01% 71 2011 0.01% 72 2392 0.01% 73 2610 0.01% 74 2849 0.02% 75 3168 0.02% 76 3658 0.02% 77 4007 0.02% 78 4282 0.02% 79 4835 0.03% 80 5231 0.03% 81 6117 0.03% 82 6900 0.04% 83 7836 0.04% 84 9631 0.05% 85 11356 0.06% 86 13004 0.07% 87 14617 0.08% 88 15425 0.08% 89 15922 0.09% 90 16214 0.09% 91 16845 0.09% 92 17656 0.10% 93 19198 0.11% 94 20103 0.11% 95 21467 0.12% 96 22299 0.12% 97 23158 0.13% 98 24479 0.13% 99 25696 0.14% 100 27582 0.15% 101 28823 0.16% 102 31288 0.17% 103 33435 0.18% 104 35278 0.19% 105 37543 0.21% 106 38821 0.21% 107 40358 0.22% 108 41495 0.23% 109 43257 0.24% 110 45209 0.25% 111 47235 0.26% 112 49663 0.27% 113 51872 0.28% 114 54134 0.30% 115 55812 0.31% 116 57236 0.31% 117 58557 0.32% 118 59381 0.33% 119 59806 0.33% 120 61606 0.34% 121 64048 0.35% 122 65122 0.36% 123 68383 0.38% 124 70841 0.39% 125 72685 0.40% 126 75297 0.41% 127 76181 0.42% 128 77963 0.43% 129 80367 0.44% 130 81349 0.45% 131 84464 0.46% 132 88174 0.48% 133 93012 0.51% 134 97616 0.54% 135 103141 0.57% 136 108082 0.59% 137 113832 0.62% 138 120347 0.66% 139 128239 0.70% 140 136374 0.75% 141 149815 0.82% 142 167699 0.92% 143 190040 1.04% 144 222820 1.22% 145 266417 1.46% 146 327404 1.80% 147 440541 2.42% 148 660385 3.63% 149 1239273 6.80% 150 4392932 24.12% 151 7030456 38.60% 18213332 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=30.60 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=123.59 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=12.4 sequence=GAAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGT SRR7171125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:48:20 Started mapping on | Feb 14 06:48:20 Finished on | Feb 14 06:50:20 Mapping speed, Million of reads per hour | 546.40 Number of input reads | 18213332 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17009589 Uniquely mapped reads % | 93.39% Average mapped length | 289.01 Number of splices: Total | 15418223 Number of splices: Annotated (sjdb) | 15091234 Number of splices: GT/AG | 15112697 Number of splices: GC/AG | 246355 Number of splices: AT/AC | 9958 Number of splices: Non-canonical | 49213 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 524212 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 64542 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 720241 720241 720241 N_multimapping 524212 524212 524212 N_noFeature 633989 16705341 755377 N_ambiguous 292324 1157 108751 UnstrandedReadsAssigned:16083276 PositiveStrandReadsAssigned:303091 NegativeStrandReadsAssigned:16145461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171125-trimmed-pair1.fastq SRR7171125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,213,332 reads, 16,181,899 reads pseudoaligned [quant] estimated average fragment length: 217.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7171125.ke.tsv 34699 SRR7171125.se.tsv 87100 total ==> SRR7171125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.96 646 20.5743 Potri.005G024800.1.v4.1 1035 818.963 124 8.68951 Potri.004G059700.1.v4.1 961 744.978 10 0.770361 Potri.007G009000.2.v4.1 1416 1199.96 0 0 Potri.003G141000.2.v4.1 2943 2726.96 864.349 18.1906 Potri.016G087400.1.v4.1 270 91.7864 905 565.859 Potri.015G069301.1.v4.1 564 351.187 0 0 Potri.010G195200.1.v4.1 1773 1556.96 40 1.47441 Potri.012G127500.1.v4.1 977 760.973 184 13.8767 ==> SRR7171125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1257 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 131 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7171125 completed mapping pipeline successfully