Starting /dee2/code/volunteer_pipeline.sh SRR7171126 current disk space = 3119129210880 free memory = 1577146896 SRR7171126 SRAfilesize 17dad3daab5eb0022b81e5ffbab291e2 SRR7171126.sra SRR7171126.sra file validated SRR7171126 is paired end SRR7171126 is conventional basespace SRR7171126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.47125 18.0 18.0 25.0 18.0 33.0 2 28.313 29.0 27.0 31.0 25.0 33.0 3 30.414 31.0 29.0 33.0 27.0 33.0 4 31.9425 33.0 31.0 33.0 29.0 33.0 5 32.3865 33.0 33.0 33.0 31.0 34.0 6 36.761 38.0 37.0 38.0 34.0 38.0 7 37.18575 38.0 38.0 38.0 36.0 38.0 8 37.34975 38.0 38.0 38.0 36.0 38.0 9 36.87675 38.0 38.0 38.0 36.0 38.0 10-14 37.457049999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.497299999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4883 38.0 38.0 38.0 37.2 38.0 25-29 37.45055 38.0 38.0 38.0 37.0 38.0 30-34 37.43814999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.488099999999996 38.0 37.2 38.0 31.6 38.0 40-44 36.8553 38.0 37.8 38.0 34.6 38.0 45-49 37.104600000000005 38.0 38.0 38.0 35.6 38.0 50-54 37.1568 38.0 38.0 38.0 36.2 38.0 55-59 35.743100000000005 38.0 35.6 38.0 30.2 38.0 60-64 37.041399999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.00175 38.0 38.0 38.0 35.8 38.0 70-74 36.85985 38.0 38.0 38.0 35.2 38.0 75-79 36.76535 38.0 38.0 38.0 35.0 38.0 80-84 36.7262 38.0 38.0 38.0 35.0 38.0 85-89 36.4615 38.0 38.0 38.0 34.0 38.0 90-94 36.1961 38.0 37.2 38.0 33.6 38.0 95-99 36.2789 38.0 37.0 38.0 33.8 38.0 100-104 36.2978 38.0 37.6 38.0 34.0 38.0 105-109 36.1506 38.0 37.0 38.0 33.2 38.0 110-114 35.6687 38.0 36.8 38.0 31.2 38.0 115-119 35.5274 38.0 36.4 38.0 30.6 38.0 120-124 35.516450000000006 38.0 36.0 38.0 31.0 38.0 125-129 35.235350000000004 38.0 36.0 38.0 29.2 38.0 130-134 32.451350000000005 37.0 29.6 38.0 18.4 38.0 135-139 34.2672 37.8 34.8 38.0 25.6 38.0 140-144 33.9784 38.0 34.2 38.0 23.4 38.0 145-149 33.213449999999995 38.0 33.4 38.0 18.8 38.0 150-151 28.80025 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 3.0 18 10.0 19 3.0 20 6.0 21 5.0 22 6.0 23 5.0 24 8.0 25 12.0 26 15.0 27 18.0 28 25.0 29 45.0 30 53.0 31 68.0 32 92.0 33 127.0 34 252.0 35 440.0 36 1230.0 37 1572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.11340206185567 16.653449643140362 9.754163362410786 36.47898493259318 2 19.829957489372344 18.404601150287572 38.084521130282575 23.680920230057513 3 17.75 23.325000000000003 28.825 30.099999999999998 4 22.5 31.825 22.85 22.825 5 21.099999999999998 35.475 25.55 17.875 6 17.325 36.825 25.825 20.025000000000002 7 13.425 23.724999999999998 45.225 17.625 8 17.075000000000003 23.575 31.374999999999996 27.975 9 16.475 23.599999999999998 33.025 26.900000000000002 10-14 19.915 29.599999999999998 26.979999999999997 23.505000000000003 15-19 20.48 28.945 27.779999999999998 22.795 20-24 19.919999999999998 28.92 28.08 23.080000000000002 25-29 19.925 29.315 27.71 23.05 30-34 19.035 28.57 28.449999999999996 23.945 35-39 19.68 28.794999999999998 28.08 23.445 40-44 20.04 28.365000000000002 27.944999999999997 23.65 45-49 20.23 28.665000000000003 27.775 23.330000000000002 50-54 19.97 28.84 27.865000000000002 23.325000000000003 55-59 19.605 29.575000000000003 27.400000000000002 23.419999999999998 60-64 19.85 28.835 28.1 23.215 65-69 19.905 28.689999999999998 28.325 23.080000000000002 70-74 20.015 29.445 27.284999999999997 23.255 75-79 19.919999999999998 28.249999999999996 28.155 23.674999999999997 80-84 20.22 28.910000000000004 27.61 23.26 85-89 20.465 28.660000000000004 27.700000000000003 23.175 90-94 20.365 28.54 27.884999999999998 23.21 95-99 20.145 29.24 27.500000000000004 23.115 100-104 20.535 28.775000000000002 27.825 22.865 105-109 20.505000000000003 28.24 27.855 23.400000000000002 110-114 20.435 28.485 27.825 23.255 115-119 20.95 28.895 27.060000000000002 23.095 120-124 20.515 28.89 27.11 23.485 125-129 20.86 28.68 27.365000000000002 23.095 130-134 20.505000000000003 28.7 27.35 23.445 135-139 20.655 28.815 26.889999999999997 23.64 140-144 20.74 28.515 26.83 23.915 145-149 20.810000000000002 28.645 26.790000000000003 23.755000000000003 150-151 21.3625 29.4125 25.775 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.5 16 2.0 17 1.0 18 0.0 19 0.5 20 0.5 21 1.5 22 3.0 23 3.5 24 3.5 25 4.0 26 8.0 27 10.0 28 12.0 29 23.0 30 24.5 31 28.5 32 42.0 33 53.5 34 74.5 35 89.0 36 102.5 37 133.0 38 149.5 39 157.5 40 185.5 41 215.0 42 244.5 43 268.5 44 257.5 45 259.0 46 259.5 47 244.5 48 219.5 49 176.0 50 148.0 51 116.0 52 103.0 53 90.0 54 62.0 55 47.5 56 45.5 57 38.5 58 26.5 59 19.0 60 12.0 61 9.5 62 7.0 63 5.0 64 3.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.4020100502512563 0.8 3 0.0 0.0 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.8 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96 33.0 33.0 34.0 32.0 34.0 2 33.08075 34.0 33.0 34.0 32.0 34.0 3 33.04225 34.0 33.0 34.0 32.0 34.0 4 33.01475 34.0 33.0 34.0 32.0 34.0 5 32.94825 34.0 33.0 34.0 32.0 34.0 6 37.143 38.0 38.0 38.0 36.0 38.0 7 37.017 38.0 38.0 38.0 36.0 38.0 8 37.073 38.0 38.0 38.0 37.0 38.0 9 37.09375 38.0 38.0 38.0 37.0 38.0 10-14 37.12935 38.0 38.0 38.0 36.6 38.0 15-19 37.13735 38.0 38.0 38.0 36.8 38.0 20-24 36.416549999999994 38.0 37.8 38.0 33.4 38.0 25-29 36.72240000000001 38.0 38.0 38.0 35.4 38.0 30-34 36.885299999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.881949999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.05945 38.0 36.2 38.0 32.0 38.0 45-49 36.561299999999996 38.0 37.4 38.0 34.0 38.0 50-54 36.932050000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.851150000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.7414 38.0 38.0 38.0 35.6 38.0 65-69 36.6819 38.0 38.0 38.0 35.4 38.0 70-74 36.6254 38.0 38.0 38.0 34.8 38.0 75-79 36.58295 38.0 38.0 38.0 35.0 38.0 80-84 36.43725 38.0 38.0 38.0 34.4 38.0 85-89 36.3289 38.0 38.0 38.0 34.0 38.0 90-94 36.32915 38.0 38.0 38.0 34.0 38.0 95-99 36.19029999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.0152 38.0 37.4 38.0 33.4 38.0 105-109 35.5629 38.0 36.6 38.0 30.8 38.0 110-114 35.34615 38.0 36.4 38.0 29.6 38.0 115-119 35.51514999999999 38.0 36.6 38.0 31.0 38.0 120-124 35.01815 38.0 36.2 38.0 28.0 38.0 125-129 34.540000000000006 38.0 34.6 38.0 25.8 38.0 130-134 34.43365 38.0 35.0 38.0 26.8 38.0 135-139 33.884550000000004 38.0 33.4 38.0 23.2 38.0 140-144 33.05675 38.0 33.0 38.0 17.2 38.0 145-149 32.0255 38.0 33.0 38.0 10.4 38.0 150-151 26.500125 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 6.0 6 0.0 7 6.0 8 1.0 9 3.0 10 0.0 11 2.0 12 5.0 13 2.0 14 2.0 15 0.0 16 5.0 17 2.0 18 8.0 19 5.0 20 13.0 21 4.0 22 9.0 23 11.0 24 17.0 25 17.0 26 23.0 27 34.0 28 29.0 29 39.0 30 47.0 31 77.0 32 78.0 33 132.0 34 181.0 35 337.0 36 766.0 37 2132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.2 19.775000000000002 12.6 27.425 2 25.724999999999998 25.900000000000002 32.175 16.2 3 21.15 27.250000000000004 31.35 20.25 4 23.75 34.725 22.900000000000002 18.625 5 23.58089522380595 38.33458364591148 20.980245061265315 17.104276069017253 6 18.775 38.15 24.275 18.8 7 19.650000000000002 18.675 41.525 20.150000000000002 8 20.175 24.6 29.15 26.075 9 20.625 25.424999999999997 30.975 22.975 10-14 23.474999999999998 28.74 26.419999999999998 21.365000000000002 15-19 23.669999999999998 28.285 27.560000000000002 20.485 20-24 22.805 28.910000000000004 27.48 20.805 25-29 22.795 28.060000000000002 28.24 20.905 30-34 22.93 28.43 28.134999999999998 20.505000000000003 35-39 22.425 27.975 28.749999999999996 20.849999999999998 40-44 23.16 28.075 28.27 20.495 45-49 22.45 28.694999999999997 28.115000000000002 20.74 50-54 23.465 28.01 28.225 20.3 55-59 22.955000000000002 27.715 28.499999999999996 20.830000000000002 60-64 23.325000000000003 27.33 28.935 20.41 65-69 22.625 27.825 28.64 20.91 70-74 23.26 28.199999999999996 27.655 20.885 75-79 22.895 28.065 28.560000000000002 20.48 80-84 23.244999999999997 27.85 28.335 20.57 85-89 23.425 28.15 27.474999999999998 20.95 90-94 23.25 27.950000000000003 28.205000000000002 20.595 95-99 22.855 27.750000000000004 28.395 21.0 100-104 22.855 28.03 28.24 20.875 105-109 23.810000000000002 27.779999999999998 28.365000000000002 20.044999999999998 110-114 24.345 27.51 27.944999999999997 20.200000000000003 115-119 23.365 28.115000000000002 28.015 20.505000000000003 120-124 23.755000000000003 28.02 27.79 20.435 125-129 24.205 28.415000000000003 27.155 20.225 130-134 24.42 28.09 27.555000000000003 19.935 135-139 24.555 27.375 28.02 20.05 140-144 25.135 28.000000000000004 27.435 19.43 145-149 25.174999999999997 27.345000000000002 27.93 19.55 150-151 25.3125 28.499999999999996 27.1625 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.5 22 3.5 23 3.0 24 3.0 25 3.0 26 4.0 27 6.5 28 10.5 29 17.0 30 22.5 31 26.0 32 30.5 33 38.0 34 56.5 35 83.5 36 101.5 37 117.5 38 130.5 39 156.0 40 190.5 41 225.0 42 248.5 43 257.5 44 265.0 45 261.0 46 265.5 47 251.5 48 235.0 49 214.0 50 165.5 51 130.5 52 95.0 53 71.0 54 76.0 55 67.5 56 43.5 57 29.0 58 22.5 59 21.0 60 15.5 61 10.0 62 8.5 63 4.5 64 2.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52189229994968 98.875 2 0.35228988424760943 0.7000000000000001 3 0.0754906894816306 0.22499999999999998 4 0.050327126321087066 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.275 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 5.0625 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.2125 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856543 spots for SRR7171126.sra Written 856543 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra Read 856536 spots for SRR7171126.sra Written 856536 spots for SRR7171126.sra SRR ids: ['SRR7171126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_19v7qgt2 SRR7171126.sra spots: 17130727 blocks: [[1, 856536], [856537, 1713072], [1713073, 2569608], [2569609, 3426144], [3426145, 4282680], [4282681, 5139216], [5139217, 5995752], [5995753, 6852288], [6852289, 7708824], [7708825, 8565360], [8565361, 9421896], [9421897, 10278432], [10278433, 11134968], [11134969, 11991504], [11991505, 12848040], [12848041, 13704576], [13704577, 14561112], [14561113, 15417648], [15417649, 16274184], [16274185, 17130727]] SRR7171126 file size 5783340 SRR7171126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171126 SRR7171126_1.fastq SRR7171126_2.fastq Input file: SRR7171126_1.fastq Paired file: SRR7171126_2.fastq trimmed: SRR7171126-trimmed-pair1.fastq, SRR7171126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:49:15 2025 >> started Fri Feb 14 07:49:34 2025 >> done (18.990s) 17130727 read pairs processed; of these: 19190 ( 0.11%) short read pairs filtered out after trimming by size control 23540 ( 0.14%) empty read pairs filtered out after trimming by size control 17087997 (99.75%) read pairs available; of these: 9680532 (56.65%) trimmed read pairs available after processing 7407465 (43.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 11 0.00% 21 5 0.00% 22 6 0.00% 23 7 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 13 0.00% 28 11 0.00% 29 7 0.00% 30 7 0.00% 31 15 0.00% 32 12 0.00% 33 10 0.00% 34 17 0.00% 35 19 0.00% 36 25 0.00% 37 13 0.00% 38 21 0.00% 39 25 0.00% 40 18 0.00% 41 48 0.00% 42 29 0.00% 43 28 0.00% 44 37 0.00% 45 42 0.00% 46 51 0.00% 47 74 0.00% 48 77 0.00% 49 81 0.00% 50 98 0.00% 51 122 0.00% 52 109 0.00% 53 114 0.00% 54 138 0.00% 55 177 0.00% 56 191 0.00% 57 168 0.00% 58 205 0.00% 59 240 0.00% 60 306 0.00% 61 350 0.00% 62 379 0.00% 63 423 0.00% 64 455 0.00% 65 521 0.00% 66 561 0.00% 67 672 0.00% 68 742 0.00% 69 792 0.00% 70 934 0.01% 71 1046 0.01% 72 1310 0.01% 73 1486 0.01% 74 1668 0.01% 75 1957 0.01% 76 2691 0.02% 77 3060 0.02% 78 2537 0.01% 79 2787 0.02% 80 3034 0.02% 81 3428 0.02% 82 3870 0.02% 83 4483 0.03% 84 5765 0.03% 85 6695 0.04% 86 7160 0.04% 87 7737 0.05% 88 8529 0.05% 89 8587 0.05% 90 9507 0.06% 91 10165 0.06% 92 10747 0.06% 93 11954 0.07% 94 12913 0.08% 95 13912 0.08% 96 14629 0.09% 97 15305 0.09% 98 16035 0.09% 99 17056 0.10% 100 17916 0.10% 101 19040 0.11% 102 20457 0.12% 103 21656 0.13% 104 22866 0.13% 105 24551 0.14% 106 25411 0.15% 107 26760 0.16% 108 27477 0.16% 109 28607 0.17% 110 29679 0.17% 111 31119 0.18% 112 32476 0.19% 113 34011 0.20% 114 35986 0.21% 115 37418 0.22% 116 38540 0.23% 117 39388 0.23% 118 41157 0.24% 119 41429 0.24% 120 43105 0.25% 121 44414 0.26% 122 45954 0.27% 123 47893 0.28% 124 49484 0.29% 125 51375 0.30% 126 53242 0.31% 127 54820 0.32% 128 56647 0.33% 129 59228 0.35% 130 60486 0.35% 131 63035 0.37% 132 65867 0.39% 133 69472 0.41% 134 72665 0.43% 135 76919 0.45% 136 81406 0.48% 137 86314 0.51% 138 91533 0.54% 139 100222 0.59% 140 108243 0.63% 141 119957 0.70% 142 132544 0.78% 143 152355 0.89% 144 179640 1.05% 145 217789 1.27% 146 273292 1.60% 147 382273 2.24% 148 568786 3.33% 149 1086835 6.36% 150 4370307 25.58% 151 7407465 43.35% 17087997 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.34 prefix-fanout=2.0 sequence=GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=416.10 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=35 prefix-density=0.52 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=135.46 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.8 sequence=GAAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGTGT SRR7171126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:50:20 Started mapping on | Feb 14 07:50:20 Finished on | Feb 14 07:52:19 Mapping speed, Million of reads per hour | 516.95 Number of input reads | 17087997 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16012468 Uniquely mapped reads % | 93.71% Average mapped length | 291.92 Number of splices: Total | 14895977 Number of splices: Annotated (sjdb) | 14533713 Number of splices: GT/AG | 14610815 Number of splices: GC/AG | 228148 Number of splices: AT/AC | 9585 Number of splices: Non-canonical | 47429 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503407 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 45016 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 591261 591261 591261 N_multimapping 503407 503407 503407 N_noFeature 695975 15782198 788902 N_ambiguous 246446 975 108564 UnstrandedReadsAssigned:15070047 PositiveStrandReadsAssigned:229295 NegativeStrandReadsAssigned:15115002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171126-trimmed-pair1.fastq SRR7171126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,087,997 reads, 15,175,275 reads pseudoaligned [quant] estimated average fragment length: 229.654 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR7171126.ke.tsv 34699 SRR7171126.se.tsv 87100 total ==> SRR7171126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.35 676 23.6033 Potri.005G024800.1.v4.1 1035 806.346 123 9.53023 Potri.004G059700.1.v4.1 961 732.366 17 1.45024 Potri.007G009000.2.v4.1 1416 1187.35 0 0 Potri.003G141000.2.v4.1 2943 2714.35 584 13.4421 Potri.016G087400.1.v4.1 270 84.3928 964 713.659 Potri.015G069301.1.v4.1 564 338.393 0 0 Potri.010G195200.1.v4.1 1773 1544.35 27 1.09229 Potri.012G127500.1.v4.1 977 748.351 191 15.9458 ==> SRR7171126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 249 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 54 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 224 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7171126 completed mapping pipeline successfully