Starting /dee2/code/volunteer_pipeline.sh SRR7171420 current disk space = 3088659927040 free memory = 1446262488 SRR7171420 SRAfilesize 819bba5686799b40bf7e913a74eee694 SRR7171420.sra SRR7171420.sra file validated SRR7171420 is paired end SRR7171420 is conventional basespace SRR7171420 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6795 33.0 31.0 34.0 18.0 34.0 2 32.08725 33.0 31.0 34.0 29.0 34.0 3 32.8485 33.0 33.0 34.0 32.0 34.0 4 32.96225 33.0 33.0 34.0 32.0 34.0 5 33.07875 34.0 33.0 34.0 32.0 34.0 6 36.91675 38.0 37.0 38.0 35.0 38.0 7 37.29275 38.0 38.0 38.0 36.0 38.0 8 37.46 38.0 38.0 38.0 37.0 38.0 9 37.54575 38.0 38.0 38.0 38.0 38.0 10-14 37.5613 38.0 38.0 38.0 38.0 38.0 15-19 37.528150000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.52140000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.49635 38.0 38.0 38.0 37.8 38.0 30-34 37.425250000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.4452 38.0 38.0 38.0 37.4 38.0 40-44 37.423700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.4514 38.0 38.0 38.0 37.2 38.0 50-54 37.398649999999996 38.0 38.0 38.0 37.2 38.0 55-59 37.33905 38.0 38.0 38.0 37.0 38.0 60-64 37.22375 38.0 38.0 38.0 36.8 38.0 65-69 37.2137 38.0 38.0 38.0 36.6 38.0 70-74 37.07165 38.0 38.0 38.0 36.0 38.0 75-79 37.118550000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.10085 38.0 38.0 38.0 36.0 38.0 85-89 37.13215 38.0 38.0 38.0 36.0 38.0 90-94 37.0905 38.0 38.0 38.0 36.0 38.0 95-99 36.86559999999999 38.0 38.0 38.0 35.4 38.0 100-104 36.6847 38.0 38.0 38.0 34.8 38.0 105-109 36.70235 38.0 38.0 38.0 35.0 38.0 110-114 36.7393 38.0 38.0 38.0 34.4 38.0 115-119 36.5911 38.0 38.0 38.0 34.0 38.0 120-124 36.48415 38.0 38.0 38.0 34.0 38.0 125-129 36.42229999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.31975 38.0 37.8 38.0 33.6 38.0 135-139 36.11935 38.0 37.2 38.0 33.0 38.0 140-144 35.95335 38.0 36.2 38.0 33.0 38.0 145-149 35.851800000000004 38.0 36.0 38.0 32.6 38.0 150-151 34.010125 37.0 33.5 38.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 0.0 23 5.0 24 5.0 25 4.0 26 10.0 27 17.0 28 14.0 29 23.0 30 39.0 31 43.0 32 66.0 33 82.0 34 102.0 35 197.0 36 476.0 37 2914.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.178147867776936 12.112036336109009 9.361594751450921 40.348221044663134 2 20.25 14.825 34.475 30.45 3 21.3 16.75 25.224999999999998 36.725 4 21.575 25.7 24.224999999999998 28.499999999999996 5 22.025 29.475 25.374999999999996 23.125 6 19.85 33.650000000000006 25.275 21.224999999999998 7 14.924999999999999 25.95 40.45 18.675 8 18.35 25.624999999999996 31.0 25.025 9 17.1 24.65 34.0 24.25 10-14 19.634999999999998 29.409999999999997 27.339999999999996 23.615 15-19 19.689999999999998 28.525 27.725 24.060000000000002 20-24 19.885 28.095 27.944999999999997 24.075 25-29 19.445 28.555000000000003 28.055000000000003 23.945 30-34 19.74098704935247 27.946397319865994 28.0314015700785 24.281214060703036 35-39 19.830949284785433 28.788636590977294 27.71331399419826 23.667100130039014 40-44 20.22 29.020000000000003 27.125 23.635 45-49 19.785 27.944999999999997 27.685 24.585 50-54 19.6 28.244999999999997 27.805000000000003 24.349999999999998 55-59 19.56 27.67 28.37 24.4 60-64 19.689999999999998 28.075 27.665 24.57 65-69 20.14 27.900000000000002 27.73 24.23 70-74 20.015 28.29 27.694999999999997 24.0 75-79 20.625 28.15 27.389999999999997 23.835 80-84 19.98 28.345 27.644999999999996 24.03 85-89 19.705000000000002 28.48 27.334999999999997 24.48 90-94 20.365 28.415000000000003 27.735 23.485 95-99 20.18 27.775 28.050000000000004 23.995 100-104 19.925 28.01 27.675 24.39 105-109 20.505000000000003 27.3 27.975 24.22 110-114 20.805 28.04 27.62 23.535 115-119 20.48 28.315 26.93 24.275 120-124 20.82 27.72 27.315 24.145 125-129 21.015 27.689999999999998 27.145000000000003 24.15 130-134 20.885 28.04 27.22 23.855 135-139 21.055 28.015 26.765 24.165 140-144 20.735 27.955000000000002 27.189999999999998 24.12 145-149 20.64 27.88 26.979999999999997 24.5 150-151 20.4375 28.275 26.687499999999996 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 4.0 28 6.5 29 10.5 30 15.0 31 19.5 32 28.5 33 33.5 34 43.5 35 60.5 36 70.5 37 94.0 38 120.5 39 141.0 40 185.0 41 228.0 42 257.0 43 274.0 44 273.5 45 272.0 46 287.0 47 278.5 48 247.0 49 217.0 50 187.5 51 159.5 52 122.5 53 88.5 54 63.0 55 51.0 56 40.0 57 30.0 58 23.5 59 16.5 60 12.5 61 9.5 62 9.0 63 5.5 64 1.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.949999999999999 0.0 0.0 0.0 0.0 136-137 6.512499999999999 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171420 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96825 33.0 33.0 34.0 32.0 34.0 2 33.04725 34.0 33.0 34.0 32.0 34.0 3 33.11125 34.0 33.0 34.0 33.0 34.0 4 33.09625 34.0 33.0 34.0 33.0 34.0 5 33.09975 34.0 33.0 34.0 33.0 34.0 6 37.26875 38.0 38.0 38.0 37.0 38.0 7 37.1665 38.0 38.0 38.0 37.0 38.0 8 37.1595 38.0 38.0 38.0 37.0 38.0 9 37.18475 38.0 38.0 38.0 37.0 38.0 10-14 37.19225 38.0 38.0 38.0 37.0 38.0 15-19 37.11215 38.0 38.0 38.0 37.0 38.0 20-24 37.09335 38.0 38.0 38.0 37.0 38.0 25-29 37.094649999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.1551 38.0 38.0 38.0 37.0 38.0 35-39 37.182550000000006 38.0 38.0 38.0 37.0 38.0 40-44 36.55765 37.8 37.4 38.0 34.0 38.0 45-49 37.01695 38.0 38.0 38.0 36.4 38.0 50-54 36.97935 38.0 38.0 38.0 36.0 38.0 55-59 36.93679999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.933400000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.935900000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.98545 38.0 38.0 38.0 36.0 38.0 75-79 36.9824 38.0 38.0 38.0 36.0 38.0 80-84 36.91755 38.0 38.0 38.0 36.0 38.0 85-89 36.84745 38.0 38.0 38.0 35.4 38.0 90-94 36.73845 38.0 38.0 38.0 35.2 38.0 95-99 36.625150000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.51055000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.4073 38.0 38.0 38.0 34.0 38.0 110-114 36.39295 38.0 38.0 38.0 34.0 38.0 115-119 36.253600000000006 38.0 38.0 38.0 33.8 38.0 120-124 36.15625 38.0 38.0 38.0 33.4 38.0 125-129 36.0731 38.0 37.6 38.0 33.0 38.0 130-134 35.934 38.0 36.8 38.0 32.8 38.0 135-139 35.82984999999999 38.0 36.6 38.0 31.8 38.0 140-144 35.40905 38.0 36.0 38.0 30.2 38.0 145-149 35.26735 38.0 36.0 38.0 28.2 38.0 150-151 32.596000000000004 35.5 30.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 1.0 18 4.0 19 4.0 20 1.0 21 6.0 22 13.0 23 12.0 24 12.0 25 11.0 26 10.0 27 26.0 28 27.0 29 28.0 30 39.0 31 50.0 32 51.0 33 83.0 34 117.0 35 221.0 36 454.0 37 2818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.15 21.25 15.6 27.0 2 25.90738423028786 26.68335419274093 31.389236545682103 16.020025031289112 3 20.906359539308962 29.494241362043066 30.045067601402103 19.55433149724587 4 23.885828743114672 33.475212819228844 22.934401602403607 19.70455683525288 5 23.0980980980981 36.811811811811815 22.722722722722725 17.36736736736737 6 20.91273821464393 37.136409227683046 23.294884653961887 18.655967903711137 7 20.68706118355065 21.464393179538614 37.31193580742227 20.536609829488466 8 22.141424272818455 25.325977933801404 28.385155466399198 24.147442326980944 9 20.737211634904714 25.952858575727184 30.9679037111334 22.342026078234703 10-14 23.60435371419973 28.855896072628777 26.011937603450868 21.52781260972062 15-19 23.791374122367102 27.863590772316947 27.311935807422266 21.03309929789368 20-24 23.063035956070408 28.699664008826037 27.486083947645557 20.751216087458 25-29 23.55475403266206 28.784690912734195 27.286845005510468 20.373710049093276 30-34 23.283283283283282 28.653653653653656 27.4974974974975 20.565565565565567 35-39 24.040626407164655 28.443488267373795 26.852454095161853 20.663431230299693 40-44 23.37538800440573 28.141584059277058 27.46570541704215 21.01732251927506 45-49 24.04029267314824 28.069559987972337 26.911897363937054 20.97824997494237 50-54 23.84437982552893 28.24125137872255 27.29870650757044 20.61566228817808 55-59 23.59460408204202 27.872223058021163 28.13299232736573 20.400180532571085 60-64 23.58840637849764 27.595025574165078 28.15665429746264 20.659913749874637 65-69 24.476610237403587 28.19793649203646 26.995893018130822 20.32956025242913 70-74 24.42343288808845 27.144929711341238 27.60518285056781 20.826454550002502 75-79 23.437343734373435 27.597759775977597 27.992799279927993 20.97209720972097 80-84 24.42 28.09 27.01 20.48 85-89 24.38963378026816 28.201921152691618 26.936161697018214 20.472283370022012 90-94 23.860562957026946 28.373234498647705 27.301412401081837 20.464790143243512 95-99 24.623947051744885 27.13096670677898 28.12876052948255 20.116325711993582 100-104 24.3176801123821 27.55368252056994 27.75436484045756 20.374272526590406 105-109 24.666399117086385 27.515802147085385 27.380355172067823 20.43744356376041 110-114 24.103335841484828 28.111361926260347 27.584650112866814 20.20065211938801 115-119 24.732908662286203 27.511661734463562 27.41636153884737 20.33906806440287 120-124 24.800761866573104 27.768031677610143 27.24675454864418 20.184451907172573 125-129 24.817262441173526 27.846200060078104 27.36557524782217 19.970962250926206 130-134 25.18892948300886 28.40198188278865 26.610279765777488 19.798808868425002 135-139 25.110242533573864 27.440368811385046 27.911405091200642 19.53798356384045 140-144 25.642054574638845 27.668539325842694 26.59510433386838 20.09430176565008 145-149 25.76000802648741 27.892043744356375 26.923848700712348 19.424099528443865 150-151 26.191670847967885 27.420973406924237 27.119919719016554 19.26743602609132 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 1.5 26 3.5 27 4.0 28 3.5 29 4.0 30 6.5 31 9.5 32 20.0 33 27.0 34 33.5 35 51.5 36 73.0 37 97.0 38 125.0 39 160.5 40 196.0 41 219.0 42 261.0 43 291.5 44 293.0 45 310.5 46 291.5 47 256.5 48 251.5 49 216.5 50 167.0 51 139.0 52 120.5 53 96.5 54 65.0 55 47.5 56 39.5 57 31.5 58 22.0 59 14.5 60 11.5 61 8.5 62 5.0 63 4.5 64 2.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.5 70 2.0 71 3.0 72 1.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.15 4 0.15 5 0.1 6 0.3 7 0.3 8 0.3 9 0.3 10-14 0.315 15-19 0.3 20-24 0.295 25-29 0.19 30-34 0.1 35-39 0.065 40-44 0.13 45-49 0.22999999999999998 50-54 0.27 55-59 0.295 60-64 0.29 65-69 0.16999999999999998 70-74 0.055 75-79 0.01 80-84 0.0 85-89 0.06 90-94 0.16999999999999998 95-99 0.27999999999999997 100-104 0.33999999999999997 105-109 0.33 110-114 0.325 115-119 0.315 120-124 0.245 125-129 0.13 130-134 0.095 135-139 0.22 140-144 0.32 145-149 0.33 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.5125 0.0 0.0 0.0 0.0 138-139 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGTCA 10 0.006830828 145.0 8 CACAGTC 10 0.006830828 145.0 7 >>END_MODULE Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751340 spots for SRR7171420.sra Written 751340 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra Read 751338 spots for SRR7171420.sra Written 751338 spots for SRR7171420.sra SRR ids: ['SRR7171420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6sjhk63l SRR7171420.sra spots: 15026762 blocks: [[1, 751338], [751339, 1502676], [1502677, 2254014], [2254015, 3005352], [3005353, 3756690], [3756691, 4508028], [4508029, 5259366], [5259367, 6010704], [6010705, 6762042], [6762043, 7513380], [7513381, 8264718], [8264719, 9016056], [9016057, 9767394], [9767395, 10518732], [10518733, 11270070], [11270071, 12021408], [12021409, 12772746], [12772747, 13524084], [13524085, 14275422], [14275423, 15026762]] SRR7171420 file size 5070376 SRR7171420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171420 SRR7171420_1.fastq SRR7171420_2.fastq Input file: SRR7171420_1.fastq Paired file: SRR7171420_2.fastq trimmed: SRR7171420-trimmed-pair1.fastq, SRR7171420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:10:35 2025 >> started Thu Feb 13 17:10:51 2025 >> done (16.486s) 15026762 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 508 ( 0.00%) empty read pairs filtered out after trimming by size control 15026241 (100.00%) read pairs available; of these: 1721832 (11.46%) trimmed read pairs available after processing 13304409 (88.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 3 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 2 0.00% 36 1 0.00% 37 0 0.00% 38 2 0.00% 39 6 0.00% 40 3 0.00% 41 0 0.00% 42 4 0.00% 43 4 0.00% 44 8 0.00% 45 2 0.00% 46 7 0.00% 47 9 0.00% 48 2 0.00% 49 7 0.00% 50 10 0.00% 51 13 0.00% 52 14 0.00% 53 7 0.00% 54 22 0.00% 55 23 0.00% 56 26 0.00% 57 31 0.00% 58 34 0.00% 59 46 0.00% 60 51 0.00% 61 45 0.00% 62 61 0.00% 63 94 0.00% 64 92 0.00% 65 84 0.00% 66 121 0.00% 67 152 0.00% 68 170 0.00% 69 171 0.00% 70 197 0.00% 71 251 0.00% 72 289 0.00% 73 375 0.00% 74 432 0.00% 75 509 0.00% 76 570 0.00% 77 668 0.00% 78 713 0.00% 79 865 0.01% 80 970 0.01% 81 1122 0.01% 82 1386 0.01% 83 1543 0.01% 84 1719 0.01% 85 1968 0.01% 86 2228 0.01% 87 2534 0.02% 88 2668 0.02% 89 2913 0.02% 90 3375 0.02% 91 3762 0.03% 92 4232 0.03% 93 4647 0.03% 94 5209 0.03% 95 5670 0.04% 96 6200 0.04% 97 6716 0.04% 98 7140 0.05% 99 7856 0.05% 100 8419 0.06% 101 9039 0.06% 102 9849 0.07% 103 10581 0.07% 104 11271 0.08% 105 12161 0.08% 106 13019 0.09% 107 13696 0.09% 108 14329 0.10% 109 15015 0.10% 110 15670 0.10% 111 16368 0.11% 112 17746 0.12% 113 18719 0.12% 114 19810 0.13% 115 21099 0.14% 116 22256 0.15% 117 24171 0.16% 118 25355 0.17% 119 25322 0.17% 120 25460 0.17% 121 25974 0.17% 122 27291 0.18% 123 28499 0.19% 124 30189 0.20% 125 31083 0.21% 126 32433 0.22% 127 33117 0.22% 128 34381 0.23% 129 35203 0.23% 130 36319 0.24% 131 36555 0.24% 132 38115 0.25% 133 39480 0.26% 134 41189 0.27% 135 42357 0.28% 136 43640 0.29% 137 44305 0.29% 138 45624 0.30% 139 46302 0.31% 140 47625 0.32% 141 50375 0.34% 142 51995 0.35% 143 51164 0.34% 144 56584 0.38% 145 55139 0.37% 146 54149 0.36% 147 56803 0.38% 148 57358 0.38% 149 57155 0.38% 150 62011 0.41% 151 13304409 88.54% 15026241 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=3.2 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=17.85 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=AGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=46.80 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.9 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171420 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:11:43 Started mapping on | Feb 13 17:11:43 Finished on | Feb 13 17:13:29 Mapping speed, Million of reads per hour | 510.33 Number of input reads | 15026241 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14060241 Uniquely mapped reads % | 93.57% Average mapped length | 296.07 Number of splices: Total | 13959702 Number of splices: Annotated (sjdb) | 13718426 Number of splices: GT/AG | 13741502 Number of splices: GC/AG | 174590 Number of splices: AT/AC | 10245 Number of splices: Non-canonical | 33365 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368860 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 91696 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597140 597140 597140 N_multimapping 368860 368860 368860 N_noFeature 310625 13941819 352899 N_ambiguous 139212 865 62680 UnstrandedReadsAssigned:13610404 PositiveStrandReadsAssigned:117557 NegativeStrandReadsAssigned:13644662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171420-trimmed-pair1.fastq SRR7171420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,026,241 reads, 13,665,276 reads pseudoaligned [quant] estimated average fragment length: 227.746 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7171420.ke.tsv 34699 SRR7171420.se.tsv 87100 total ==> SRR7171420.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.25 1040 38.2864 Potri.005G024800.1.v4.1 1035 808.254 312 25.4551 Potri.004G059700.1.v4.1 961 734.259 6 0.538853 Potri.007G009000.2.v4.1 1416 1189.25 0 0 Potri.003G141000.2.v4.1 2943 2716.25 528 12.8184 Potri.016G087400.1.v4.1 270 82.0313 1491 1198.58 Potri.015G069301.1.v4.1 564 339.935 0 0 Potri.010G195200.1.v4.1 1773 1546.25 498 21.2382 Potri.012G127500.1.v4.1 977 750.254 4359 383.131 ==> SRR7171420.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 191 SRR7171420 completed mapping pipeline successfully