Starting /dee2/code/volunteer_pipeline.sh SRR7171421 current disk space = 3088740278272 free memory = 1412349768 SRR7171421 SRAfilesize c5702bc777113c38e6e83929288fe700 SRR7171421.sra SRR7171421.sra file validated SRR7171421 is paired end SRR7171421 is conventional basespace SRR7171421 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20275 34.0 33.0 34.0 33.0 34.0 2 33.3635 34.0 33.0 34.0 33.0 34.0 3 33.07225 34.0 33.0 34.0 31.0 34.0 4 33.29175 34.0 33.0 34.0 33.0 34.0 5 33.29275 34.0 33.0 34.0 33.0 34.0 6 36.71425 38.0 37.0 38.0 34.0 38.0 7 37.3225 38.0 38.0 38.0 36.0 38.0 8 37.41925 38.0 38.0 38.0 37.0 38.0 9 37.57075 38.0 38.0 38.0 37.0 38.0 10-14 37.53060000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.46515000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.40935 38.0 38.0 38.0 37.0 38.0 25-29 37.42655 38.0 38.0 38.0 37.0 38.0 30-34 37.5151 38.0 38.0 38.0 38.0 38.0 35-39 36.2902 38.0 37.6 38.0 31.6 38.0 40-44 37.0609 38.0 38.0 38.0 34.6 38.0 45-49 37.37505 38.0 38.0 38.0 37.0 38.0 50-54 37.2318 38.0 38.0 38.0 36.8 38.0 55-59 37.19475 38.0 38.0 38.0 36.8 38.0 60-64 37.202999999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.214 38.0 38.0 38.0 36.4 38.0 70-74 34.4284 33.6 33.6 37.6 31.8 38.0 75-79 35.17805 36.2 35.0 37.8 31.8 38.0 80-84 37.08075 38.0 38.0 38.0 36.0 38.0 85-89 37.06420000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.998549999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.9679 38.0 38.0 38.0 36.0 38.0 100-104 36.87149999999999 38.0 38.0 38.0 35.2 38.0 105-109 36.70575 38.0 38.0 38.0 34.6 38.0 110-114 36.48365 38.0 38.0 38.0 34.0 38.0 115-119 36.43900000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.34374999999999 38.0 38.0 38.0 33.8 38.0 125-129 36.185700000000004 38.0 37.2 38.0 33.2 38.0 130-134 35.98515 38.0 37.0 38.0 32.6 38.0 135-139 36.03995 38.0 36.2 38.0 33.0 38.0 140-144 35.86579999999999 38.0 36.0 38.0 32.4 38.0 145-149 35.683550000000004 38.0 36.0 38.0 31.2 38.0 150-151 33.412375 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 1.0 22 2.0 23 1.0 24 9.0 25 5.0 26 15.0 27 17.0 28 21.0 29 29.0 30 30.0 31 59.0 32 55.0 33 104.0 34 144.0 35 230.0 36 685.0 37 2590.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.19156414762742 10.444388651770023 10.695455686668339 39.66859151393422 2 22.8 14.025000000000002 32.85 30.325000000000003 3 20.25 18.9 24.775 36.075 4 23.35 27.075 22.675 26.900000000000002 5 23.275000000000002 32.125 23.075000000000003 21.525 6 19.6 35.275 25.3 19.825 7 15.525 24.7 41.975 17.8 8 18.45 25.124999999999996 32.45 23.974999999999998 9 17.599999999999998 24.575 33.6 24.224999999999998 10-14 19.470000000000002 29.75 27.57 23.21 15-19 20.46 28.57 27.61 23.36 20-24 19.79 29.005 27.6 23.605 25-29 19.67 28.48 27.715 24.135 30-34 19.005 28.494999999999997 27.875 24.625 35-39 19.525000000000002 29.345 27.195000000000004 23.935000000000002 40-44 19.62 28.99 27.395000000000003 23.995 45-49 19.655 28.754999999999995 27.595 23.995 50-54 20.055 28.155 27.91 23.880000000000003 55-59 19.805 28.23 28.4 23.565 60-64 19.855 28.015 28.1 24.03 65-69 20.79 28.005000000000003 27.6 23.605 70-74 21.025 29.025000000000002 26.075 23.875 75-79 20.119999999999997 27.855 27.839999999999996 24.185000000000002 80-84 20.505000000000003 27.875 28.21 23.41 85-89 20.18 27.485 28.294999999999998 24.04 90-94 20.355 27.644999999999996 28.24 23.76 95-99 20.169999999999998 28.194999999999997 27.845 23.79 100-104 20.175 27.555000000000003 27.71 24.560000000000002 105-109 20.785 27.38 27.91 23.925 110-114 20.71 28.165000000000003 27.405 23.72 115-119 20.985 28.249999999999996 26.93 23.835 120-124 20.95 27.889999999999997 27.095000000000002 24.065 125-129 20.355 27.834999999999997 27.96 23.849999999999998 130-134 21.065 28.26 26.845000000000002 23.830000000000002 135-139 20.525 28.335 27.04 24.099999999999998 140-144 21.365000000000002 28.035 26.56 24.04 145-149 21.05 27.944999999999997 27.125 23.880000000000003 150-151 20.549999999999997 28.125 26.200000000000003 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.5 20 2.5 21 1.0 22 1.0 23 2.0 24 1.5 25 0.0 26 2.0 27 5.0 28 7.5 29 7.5 30 9.5 31 18.0 32 33.0 33 46.0 34 53.0 35 64.0 36 81.5 37 110.0 38 133.5 39 163.0 40 194.0 41 199.5 42 218.5 43 251.0 44 282.0 45 296.5 46 281.0 47 259.0 48 228.5 49 209.5 50 186.5 51 145.0 52 125.0 53 95.5 54 60.5 55 50.5 56 40.0 57 29.5 58 22.0 59 19.5 60 15.5 61 9.0 62 9.0 63 8.5 64 6.0 65 4.0 66 3.0 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171421 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04975 33.0 33.0 34.0 32.0 34.0 2 33.0605 34.0 33.0 34.0 32.0 34.0 3 33.133 34.0 33.0 34.0 32.0 34.0 4 33.1505 34.0 33.0 34.0 33.0 34.0 5 33.12275 34.0 33.0 34.0 33.0 34.0 6 37.33125 38.0 38.0 38.0 37.0 38.0 7 37.27375 38.0 38.0 38.0 37.0 38.0 8 37.30375 38.0 38.0 38.0 37.0 38.0 9 37.25025 38.0 38.0 38.0 37.0 38.0 10-14 37.26255 38.0 38.0 38.0 37.0 38.0 15-19 37.22279999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.188900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.1286 38.0 38.0 38.0 37.0 38.0 30-34 37.193450000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.10385 38.0 38.0 38.0 36.6 38.0 40-44 36.94595 38.0 38.0 38.0 36.0 38.0 45-49 37.015150000000006 38.0 38.0 38.0 36.2 38.0 50-54 37.07775 38.0 38.0 38.0 36.6 38.0 55-59 37.02545 38.0 38.0 38.0 36.0 38.0 60-64 37.03145 38.0 38.0 38.0 36.0 38.0 65-69 37.047 38.0 38.0 38.0 36.0 38.0 70-74 36.984700000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9201 38.0 38.0 38.0 36.0 38.0 80-84 36.884 38.0 38.0 38.0 35.6 38.0 85-89 36.8395 38.0 38.0 38.0 35.4 38.0 90-94 36.65905 38.0 38.0 38.0 34.6 38.0 95-99 36.70235 38.0 38.0 38.0 34.8 38.0 100-104 36.53025 38.0 38.0 38.0 34.2 38.0 105-109 36.5361 38.0 38.0 38.0 34.0 38.0 110-114 36.3576 38.0 38.0 38.0 34.0 38.0 115-119 36.296350000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.0973 38.0 38.0 38.0 33.2 38.0 125-129 36.00145 38.0 37.2 38.0 32.8 38.0 130-134 36.0048 38.0 37.2 38.0 32.6 38.0 135-139 35.704350000000005 38.0 36.0 38.0 31.2 38.0 140-144 35.53359999999999 38.0 36.0 38.0 30.6 38.0 145-149 35.206900000000005 38.0 35.8 38.0 29.0 38.0 150-151 32.622125 35.5 30.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 5.0 20 5.0 21 2.0 22 3.0 23 12.0 24 13.0 25 16.0 26 18.0 27 21.0 28 22.0 29 34.0 30 31.0 31 46.0 32 67.0 33 110.0 34 124.0 35 202.0 36 440.0 37 2820.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.825 18.875 16.55 28.749999999999996 2 25.71285642821411 26.313156578289142 30.240120060030012 17.733866933466732 3 21.635817908954476 28.989494747373683 29.164582291145575 20.210105052526263 4 24.662331165582792 33.766883441720864 23.036518259129565 18.534267133566786 5 24.712356178089045 35.4927463731866 22.161080540270135 17.63381690845423 6 19.814861145859393 38.92919689767326 23.46760070052539 17.788341255941955 7 20.41531148361271 22.216662496872654 37.80335251438579 19.564673505128845 8 22.686343171585793 25.662831415707853 27.363681840920464 24.287143571785894 9 21.290968226169625 25.74430823117338 30.422817112834625 22.54190642982237 10-14 23.96297222917188 28.586439829872408 25.974480860645482 21.476107080310232 15-19 23.377533149862398 28.71153365023768 27.23042281711284 20.68051038278709 20-24 23.642732049036777 28.596447335501622 27.285464098073554 20.47535651738804 25-29 23.600340221143743 28.483514284284784 26.782408565567618 21.133736929003852 30-34 23.301990597179152 28.05841752525758 27.58327498249475 21.05631689506852 35-39 23.330000000000002 27.735 27.889999999999997 21.044999999999998 40-44 23.07923169267707 28.841536614645857 27.581032412965182 20.498199279711883 45-49 23.19507679991995 28.258367939160458 27.232701255816284 21.313854005103316 50-54 23.782837127845884 28.166124593445087 27.385539154365773 20.665499124343256 55-59 23.66274706029522 28.096072054040533 27.6257192894671 20.61546159619715 60-64 23.677758318739052 28.591443582687013 27.91593695271454 19.814861145859393 65-69 23.670385750737978 28.033221594036124 27.332766298093762 20.963626357132135 70-74 23.6997399479896 28.920784156831363 26.820364072814563 20.55911182236447 75-79 24.63 27.615000000000002 27.575 20.18 80-84 23.735 27.169999999999998 27.96 21.135 85-89 23.931196559827992 28.261413070653536 27.36136806840342 20.446022301115054 90-94 23.391695847923963 28.224112056028016 27.673836918459227 20.710355177588795 95-99 23.977983487615713 27.695771828871653 27.73580185138854 20.590442832124094 100-104 24.07666900210189 28.065258732859572 27.274547092383145 20.58352517265539 105-109 24.319455564451562 27.847277822257805 27.126701361088873 20.706565252201763 110-114 23.786164781259387 28.216037641405546 27.25498047852638 20.74281709880869 115-119 24.43332499374531 28.226169627220415 27.185389041781338 20.15511633725294 120-124 24.570971131235304 28.358432981437936 27.442837844598987 19.627758042727773 125-129 24.449779911964786 27.270908363345335 27.62605042016807 20.65326130452181 130-134 24.886198789455253 27.52238507328298 27.27727477364814 20.314141363613626 135-139 24.826136989042876 27.627958172812328 27.612948416470708 19.93295642167409 140-144 25.015018021625952 28.16880256307569 26.982378854625548 19.833800560672806 145-149 24.577034738212035 28.426268895785363 27.154870357393136 19.84182600860947 150-151 24.84984984984985 28.290790790790794 27.164664664664667 19.694694694694697 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 2.0 26 2.0 27 1.5 28 3.0 29 6.5 30 10.5 31 12.5 32 15.0 33 22.5 34 34.5 35 48.5 36 69.5 37 100.5 38 141.5 39 171.5 40 203.0 41 241.0 42 263.0 43 276.0 44 295.5 45 296.5 46 279.0 47 274.5 48 242.0 49 202.0 50 168.5 51 137.0 52 112.0 53 91.5 54 77.5 55 55.0 56 37.0 57 22.0 58 16.5 59 14.5 60 10.0 61 12.0 62 10.5 63 5.5 64 3.5 65 2.0 66 0.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.075 7 0.075 8 0.05 9 0.075 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.065 30-34 0.03 35-39 0.0 40-44 0.04 45-49 0.065 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.065 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.05 95-99 0.075 100-104 0.09 105-109 0.08 110-114 0.11 115-119 0.075 120-124 0.065 125-129 0.04 130-134 0.045 135-139 0.065 140-144 0.12 145-149 0.11 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.0625 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.175 0.0 0.0 0.025 0.0 94-95 0.225 0.0 0.0 0.025 0.0 96-97 0.375 0.0 0.0 0.025 0.0 98-99 0.4375 0.0 0.0 0.025 0.0 100-101 0.525 0.0 0.0 0.025 0.0 102-103 0.6125 0.0 0.0 0.025 0.0 104-105 0.7 0.0 0.0 0.025 0.0 106-107 0.9 0.0 0.0 0.025 0.0 108-109 1.175 0.0 0.0 0.025 0.0 110-111 1.3 0.0 0.0 0.025 0.0 112-113 1.55 0.0 0.0 0.025 0.0 114-115 1.8875 0.0 0.0 0.025 0.0 116-117 2.2875 0.0 0.0 0.025 0.0 118-119 2.5125 0.0 0.0 0.025 0.0 120-121 2.7375 0.0 0.0 0.025 0.0 122-123 2.95 0.0 0.0 0.025 0.0 124-125 3.325 0.0 0.0 0.025 0.0 126-127 3.7249999999999996 0.0 0.0 0.025 0.0 128-129 4.237500000000001 0.0 0.0 0.025 0.0 130-131 4.675000000000001 0.0 0.0 0.025 0.0 132-133 5.112500000000001 0.0 0.0 0.025 0.0 134-135 5.65 0.0 0.0 0.025 0.0 136-137 6.175000000000001 0.0 0.0 0.025 0.0 138-139 6.8125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATGGC 10 0.006830828 145.0 6 CTAAGCT 10 0.006830828 145.0 1 TGAATAC 10 0.006830828 145.0 1 >>END_MODULE Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra Read 885675 spots for SRR7171421.sra Written 885675 spots for SRR7171421.sra Read 885656 spots for SRR7171421.sra Written 885656 spots for SRR7171421.sra SRR ids: ['SRR7171421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fh4isrs SRR7171421.sra spots: 17713139 blocks: [[1, 885656], [885657, 1771312], [1771313, 2656968], [2656969, 3542624], [3542625, 4428280], [4428281, 5313936], [5313937, 6199592], [6199593, 7085248], [7085249, 7970904], [7970905, 8856560], [8856561, 9742216], [9742217, 10627872], [10627873, 11513528], [11513529, 12399184], [12399185, 13284840], [13284841, 14170496], [14170497, 15056152], [15056153, 15941808], [15941809, 16827464], [16827465, 17713139]] SRR7171421 file size 5980701 SRR7171421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171421 SRR7171421_1.fastq SRR7171421_2.fastq Input file: SRR7171421_1.fastq Paired file: SRR7171421_2.fastq trimmed: SRR7171421-trimmed-pair1.fastq, SRR7171421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:01:31 2025 >> started Thu Feb 13 17:02:02 2025 >> done (30.987s) 17713139 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 1688 ( 0.01%) empty read pairs filtered out after trimming by size control 17711423 (99.99%) read pairs available; of these: 2052259 (11.59%) trimmed read pairs available after processing 15659164 (88.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 5 0.00% 41 1 0.00% 42 7 0.00% 43 4 0.00% 44 4 0.00% 45 5 0.00% 46 9 0.00% 47 6 0.00% 48 6 0.00% 49 6 0.00% 50 13 0.00% 51 13 0.00% 52 18 0.00% 53 31 0.00% 54 24 0.00% 55 30 0.00% 56 29 0.00% 57 41 0.00% 58 54 0.00% 59 48 0.00% 60 59 0.00% 61 74 0.00% 62 94 0.00% 63 110 0.00% 64 121 0.00% 65 135 0.00% 66 139 0.00% 67 211 0.00% 68 218 0.00% 69 261 0.00% 70 333 0.00% 71 348 0.00% 72 448 0.00% 73 564 0.00% 74 619 0.00% 75 656 0.00% 76 789 0.00% 77 872 0.00% 78 975 0.01% 79 1205 0.01% 80 1343 0.01% 81 1579 0.01% 82 1786 0.01% 83 2097 0.01% 84 2406 0.01% 85 2640 0.01% 86 2966 0.02% 87 3220 0.02% 88 3679 0.02% 89 3956 0.02% 90 4428 0.03% 91 4971 0.03% 92 5582 0.03% 93 6238 0.04% 94 6964 0.04% 95 7367 0.04% 96 8072 0.05% 97 8695 0.05% 98 9209 0.05% 99 9921 0.06% 100 10618 0.06% 101 11475 0.06% 102 12324 0.07% 103 13223 0.07% 104 14378 0.08% 105 15406 0.09% 106 16389 0.09% 107 17239 0.10% 108 17876 0.10% 109 18661 0.11% 110 19277 0.11% 111 20231 0.11% 112 21589 0.12% 113 22674 0.13% 114 23932 0.14% 115 25720 0.15% 116 27563 0.16% 117 31020 0.18% 118 32598 0.18% 119 30573 0.17% 120 30377 0.17% 121 31366 0.18% 122 32541 0.18% 123 34055 0.19% 124 35424 0.20% 125 37212 0.21% 126 38293 0.22% 127 39713 0.22% 128 40679 0.23% 129 41077 0.23% 130 42606 0.24% 131 43221 0.24% 132 44775 0.25% 133 46179 0.26% 134 47840 0.27% 135 49271 0.28% 136 50568 0.29% 137 51633 0.29% 138 53391 0.30% 139 53741 0.30% 140 55786 0.31% 141 60616 0.34% 142 60801 0.34% 143 63209 0.36% 144 62472 0.35% 145 65843 0.37% 146 62237 0.35% 147 63977 0.36% 148 67375 0.38% 149 65296 0.37% 150 72200 0.41% 151 15659164 88.41% 17711423 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=7.17 fanout-score-rank=13 prefix-density=0.58 prefix-fanout=3.6 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=67.38 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=35 prefix-density=0.37 prefix-fanout=1.2 sequence=AGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=49.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGT SRR7171421 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:03:22 Started mapping on | Feb 13 17:03:23 Finished on | Feb 13 17:06:45 Mapping speed, Million of reads per hour | 315.65 Number of input reads | 17711423 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16290334 Uniquely mapped reads % | 91.98% Average mapped length | 295.83 Number of splices: Total | 15491849 Number of splices: Annotated (sjdb) | 15184635 Number of splices: GT/AG | 15235831 Number of splices: GC/AG | 201522 Number of splices: AT/AC | 13695 Number of splices: Non-canonical | 40801 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394844 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 172662 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.59% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1026245 1026245 1026245 N_multimapping 394844 394844 394844 N_noFeature 426681 16127614 484315 N_ambiguous 181379 1313 75401 UnstrandedReadsAssigned:15682274 PositiveStrandReadsAssigned:161407 NegativeStrandReadsAssigned:15730618 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171421-trimmed-pair1.fastq SRR7171421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,711,423 reads, 15,890,605 reads pseudoaligned [quant] estimated average fragment length: 230.886 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7171421.ke.tsv 34699 SRR7171421.se.tsv 87100 total ==> SRR7171421.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.11 1070 34.5807 Potri.005G024800.1.v4.1 1035 805.114 221 15.8628 Potri.004G059700.1.v4.1 961 731.122 167 13.1999 Potri.007G009000.2.v4.1 1416 1186.11 0 0 Potri.003G141000.2.v4.1 2943 2713.11 560.129 11.9307 Potri.016G087400.1.v4.1 270 81.6093 1477 1045.89 Potri.015G069301.1.v4.1 564 336.914 0 0 Potri.010G195200.1.v4.1 1773 1543.11 233 8.72575 Potri.012G127500.1.v4.1 977 747.122 10323 798.472 ==> SRR7171421.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 444 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 594 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 261 SRR7171421 completed mapping pipeline successfully