Starting /dee2/code/volunteer_pipeline.sh SRR7171422 current disk space = 3088673918976 free memory = 1411132220 SRR7171422 SRAfilesize 1c90e1abcafe54edbc88d2f2ea4a6211 SRR7171422.sra SRR7171422.sra file validated SRR7171422 is paired end SRR7171422 is conventional basespace SRR7171422 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92575 34.0 33.0 34.0 32.0 34.0 2 33.09325 34.0 33.0 34.0 31.0 34.0 3 32.5985 33.0 33.0 34.0 31.0 34.0 4 33.02 33.0 33.0 34.0 32.0 34.0 5 33.12675 34.0 33.0 34.0 32.0 34.0 6 36.4965 38.0 37.0 38.0 34.0 38.0 7 37.25 38.0 38.0 38.0 36.0 38.0 8 37.3385 38.0 38.0 38.0 37.0 38.0 9 37.4955 38.0 38.0 38.0 37.0 38.0 10-14 37.48315 38.0 38.0 38.0 37.8 38.0 15-19 37.38404999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.52205 38.0 38.0 38.0 38.0 38.0 25-29 37.553999999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5449 38.0 38.0 38.0 38.0 38.0 35-39 37.484950000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.3759 38.0 38.0 38.0 37.2 38.0 45-49 37.298649999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.16575 38.0 38.0 38.0 36.8 38.0 55-59 37.21015 38.0 38.0 38.0 36.8 38.0 60-64 37.2846 38.0 38.0 38.0 37.0 38.0 65-69 37.27405 38.0 38.0 38.0 37.0 38.0 70-74 37.252750000000006 38.0 38.0 38.0 37.0 38.0 75-79 37.187599999999996 38.0 38.0 38.0 36.4 38.0 80-84 37.164100000000005 38.0 38.0 38.0 36.4 38.0 85-89 37.000299999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.9584 38.0 38.0 38.0 35.8 38.0 95-99 36.893 38.0 38.0 38.0 35.4 38.0 100-104 36.81105 38.0 38.0 38.0 35.0 38.0 105-109 36.634499999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.56804999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.4532 38.0 38.0 38.0 34.0 38.0 120-124 36.3902 38.0 38.0 38.0 34.0 38.0 125-129 36.2416 38.0 37.8 38.0 33.6 38.0 130-134 36.085899999999995 38.0 37.2 38.0 33.2 38.0 135-139 35.890600000000006 38.0 36.2 38.0 32.2 38.0 140-144 35.5225 38.0 36.0 38.0 30.4 38.0 145-149 35.25765 38.0 35.8 38.0 29.2 38.0 150-151 32.649375 35.5 30.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 6.0 24 8.0 25 8.0 26 10.0 27 13.0 28 25.0 29 22.0 30 39.0 31 47.0 32 65.0 33 73.0 34 116.0 35 207.0 36 530.0 37 2824.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.32193158953722 12.399396378269618 8.425553319919517 33.85311871227364 2 23.1 15.125 30.725 31.05 3 19.625 20.150000000000002 25.874999999999996 34.35 4 21.7 27.725 22.375 28.199999999999996 5 22.475 32.15 24.525 20.849999999999998 6 19.6 35.449999999999996 24.725 20.225 7 14.575 26.200000000000003 40.25 18.975 8 17.4 26.5 28.625 27.474999999999998 9 17.075000000000003 25.0 33.7 24.224999999999998 10-14 19.73 29.604999999999997 26.515 24.15 15-19 20.165 27.860000000000003 27.85 24.125 20-24 19.875 28.410000000000004 27.855 23.86 25-29 19.869999999999997 28.249999999999996 28.26 23.62 30-34 20.03 28.645 27.639999999999997 23.685000000000002 35-39 20.146043813143944 27.883365009502853 27.82334700410123 24.147244173251973 40-44 20.041002050102506 28.181409070453523 27.83639181959098 23.941197059852993 45-49 20.171008550427523 27.706385319265962 27.76638831941597 24.356217810890545 50-54 19.85 28.694999999999997 27.66 23.794999999999998 55-59 19.86 28.310000000000002 27.445000000000004 24.385 60-64 19.895 28.125 27.62 24.36 65-69 20.474999999999998 28.34 27.400000000000002 23.785 70-74 20.32 27.92 27.389999999999997 24.37 75-79 20.625 27.875 27.265 24.235 80-84 20.415 28.410000000000004 27.405 23.77 85-89 19.994999999999997 28.499999999999996 27.235 24.27 90-94 20.66 28.005000000000003 27.389999999999997 23.945 95-99 20.82 27.18 27.455000000000002 24.545 100-104 20.669999999999998 28.449999999999996 26.8 24.08 105-109 20.974999999999998 27.765 27.544999999999998 23.715 110-114 20.125 28.194999999999997 27.339999999999996 24.34 115-119 20.945 28.42 26.3 24.335 120-124 20.845 28.02 27.42 23.715 125-129 21.09 28.005000000000003 27.13 23.775 130-134 20.46 27.515 27.16 24.865000000000002 135-139 20.89 28.439999999999998 26.365 24.305 140-144 21.33 27.63 26.384999999999998 24.654999999999998 145-149 21.279999999999998 27.54 26.490000000000002 24.69 150-151 21.6875 28.775000000000002 25.4375 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 1.0 26 2.0 27 6.0 28 7.5 29 8.5 30 12.5 31 19.0 32 25.5 33 34.5 34 51.5 35 64.5 36 85.0 37 112.5 38 123.5 39 155.0 40 182.0 41 199.5 42 228.0 43 243.0 44 268.0 45 284.0 46 269.0 47 243.0 48 220.5 49 219.0 50 198.5 51 163.0 52 138.0 53 101.5 54 73.5 55 60.0 56 44.0 57 32.5 58 26.5 59 21.0 60 17.5 61 11.0 62 8.0 63 8.5 64 6.0 65 3.0 66 4.0 67 4.0 68 3.5 69 2.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.037500000000000006 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.075 0.025 0.0 0.0 0.0 68-69 0.075 0.025 0.0 0.0 0.0 70-71 0.125 0.025 0.0 0.0 0.0 72-73 0.125 0.025 0.0 0.0 0.0 74-75 0.125 0.025 0.0 0.0 0.0 76-77 0.125 0.025 0.0 0.0 0.0 78-79 0.1375 0.025 0.0 0.0 0.0 80-81 0.1875 0.025 0.0 0.0 0.0 82-83 0.2375 0.025 0.0 0.0 0.0 84-85 0.2625 0.025 0.0 0.0 0.0 86-87 0.35 0.025 0.0 0.0 0.0 88-89 0.55 0.025 0.0 0.0 0.0 90-91 0.7125 0.025 0.0 0.0 0.0 92-93 0.775 0.025 0.0 0.0 0.0 94-95 0.8374999999999999 0.025 0.0 0.0 0.0 96-97 1.1 0.025 0.0 0.0 0.0 98-99 1.3 0.025 0.0 0.0 0.0 100-101 1.475 0.025 0.0 0.0 0.0 102-103 1.65 0.025 0.0 0.0 0.0 104-105 1.925 0.025 0.0 0.0 0.0 106-107 2.425 0.025 0.0 0.0 0.0 108-109 2.8125 0.025 0.0 0.0 0.0 110-111 3.175 0.025 0.0 0.0 0.0 112-113 3.525 0.025 0.0 0.0 0.0 114-115 4.0 0.025 0.0 0.0 0.0 116-117 4.45 0.025 0.0 0.0 0.0 118-119 4.8125 0.025 0.0 0.0 0.0 120-121 5.375 0.025 0.0 0.0 0.0 122-123 5.8625 0.025 0.0 0.0 0.0 124-125 6.275 0.025 0.0 0.0 0.0 126-127 6.825 0.025 0.0 0.0 0.0 128-129 7.3375 0.025 0.0 0.0 0.0 130-131 7.875 0.025 0.0 0.0 0.0 132-133 8.3625 0.025 0.0 0.0 0.0 134-135 9.1375 0.025 0.0 0.0 0.0 136-137 9.7 0.025 0.0 0.0 0.0 138-139 10.3 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGTA 10 0.0065959026 146.68355 1 >>END_MODULE SRR7171422 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9975 33.0 33.0 34.0 32.0 34.0 2 32.9955 34.0 33.0 34.0 32.0 34.0 3 32.988 34.0 33.0 34.0 33.0 34.0 4 32.975 34.0 33.0 34.0 32.0 34.0 5 32.96325 34.0 33.0 34.0 32.0 34.0 6 37.06425 38.0 38.0 38.0 37.0 38.0 7 37.03575 38.0 38.0 38.0 37.0 38.0 8 36.98175 38.0 38.0 38.0 37.0 38.0 9 36.8665 38.0 38.0 38.0 37.0 38.0 10-14 36.9025 38.0 38.0 38.0 36.8 38.0 15-19 36.929 38.0 38.0 38.0 36.8 38.0 20-24 36.9727 38.0 38.0 38.0 36.8 38.0 25-29 36.982000000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.003299999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0192 38.0 38.0 38.0 37.0 38.0 40-44 36.91895 38.0 38.0 38.0 36.2 38.0 45-49 36.8442 38.0 38.0 38.0 36.0 38.0 50-54 36.79465 38.0 38.0 38.0 36.0 38.0 55-59 36.728750000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.730000000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.7546 38.0 38.0 38.0 36.0 38.0 70-74 36.76605 38.0 38.0 38.0 35.8 38.0 75-79 36.79540000000001 38.0 38.0 38.0 35.6 38.0 80-84 36.76215 38.0 38.0 38.0 35.6 38.0 85-89 36.66205000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.44575 38.0 38.0 38.0 34.2 38.0 95-99 36.413850000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.3091 38.0 38.0 38.0 34.0 38.0 105-109 36.18305 38.0 38.0 38.0 34.0 38.0 110-114 36.12065 38.0 38.0 38.0 33.6 38.0 115-119 36.01145 38.0 37.8 38.0 32.8 38.0 120-124 35.824850000000005 38.0 37.6 38.0 32.0 38.0 125-129 35.648250000000004 38.0 37.0 38.0 31.0 38.0 130-134 35.550749999999994 38.0 36.6 38.0 30.2 38.0 135-139 35.09065 38.0 36.0 38.0 28.0 38.0 140-144 34.684000000000005 38.0 34.6 38.0 24.4 38.0 145-149 34.3697 38.0 33.4 38.0 23.4 38.0 150-151 31.774375 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 3.0 9 0.0 10 0.0 11 3.0 12 2.0 13 0.0 14 0.0 15 5.0 16 7.0 17 18.0 18 20.0 19 6.0 20 8.0 21 7.0 22 9.0 23 9.0 24 9.0 25 18.0 26 11.0 27 16.0 28 26.0 29 28.0 30 40.0 31 49.0 32 63.0 33 97.0 34 117.0 35 193.0 36 479.0 37 2754.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.8 20.325 13.775 23.1 2 26.264396594892336 25.7135703555333 29.619429143715575 18.40260390585879 3 22.408612919379067 28.342513770655987 30.27040560841262 18.97846770155233 4 24.34325744308231 33.400050037528146 21.766324743557668 20.490367775831874 5 23.167375531648737 35.976982737052786 22.91718789091819 17.938453840380287 6 19.32330827067669 37.769423558897245 24.385964912280702 18.521303258145362 7 21.20832288794184 21.83504637753823 36.42516921534219 20.53146151917774 8 21.38380546502883 24.843319127600903 27.676109300576584 26.096766106793684 9 21.860115317122087 24.993732765104035 28.703935823514666 24.442216094259212 10-14 24.160064186139802 28.477584996489817 25.694514090863503 21.66783672650687 15-19 23.737399067154822 27.14780079241687 27.634284567932195 21.480515572496113 20-24 23.559500526553332 27.942430168998545 27.190211122812297 21.307858181635826 25-29 24.088541666666664 27.609174679487182 27.549078525641026 20.753205128205128 30-34 23.77664365055539 28.294806364455116 27.023916741719205 20.90463324327029 35-39 23.851696187331132 28.009606724707297 27.314119883918742 20.82457720404283 40-44 23.856520214418115 28.10480436851861 27.31827062772406 20.720404789339213 45-49 23.990772779700116 27.907326613509852 27.39080286846196 20.711097738328068 50-54 23.304574638844304 28.13503210272873 27.523073836276087 21.037319422150883 55-59 23.896468699839488 28.31059390048154 27.39265650080257 20.400280898876407 60-64 24.223882842670143 27.689452831134965 27.40358092181153 20.68308340438337 65-69 23.711391897312474 28.24408343361412 27.080826313678298 20.963698355395106 70-74 24.200410430952502 28.44486711046599 27.123479653636316 20.231242804945193 75-79 24.73994798959792 27.240448089617924 27.365473094618924 20.654130826165233 80-84 24.215 27.375 27.42 20.990000000000002 85-89 23.80880880880881 27.692692692692695 27.717717717717715 20.78078078078078 90-94 24.122543120738065 27.426795026073002 27.68752507019655 20.76313678299238 95-99 24.181006371344 27.7479556514323 27.667686750614557 20.40335122660914 100-104 24.682495858641634 27.3731238391647 26.926359118518146 21.01802118367552 105-109 24.607119546116383 27.53928804538836 27.609579755987347 20.24401265250791 110-114 24.38375420452834 28.14398313168332 27.149957327175063 20.322305336613283 115-119 25.021332128695477 27.490839732971946 27.31516337900918 20.172664759323393 120-124 24.458266452648473 27.954454253611555 27.76384430176565 19.823434991974317 125-129 25.373433583959898 27.588972431077696 27.187969924812027 19.849624060150376 130-134 25.95970732685176 28.345193946075973 26.350606394707825 19.34449233236444 135-139 25.950637102438044 28.012441055483094 26.89876592756095 19.13815591451791 140-144 25.73422360560269 28.15402379637532 26.632863095536923 19.478889502485064 145-149 26.408556794215126 27.97027217033243 26.25288741588832 19.368283619564124 150-151 26.98392767453541 27.68709191361125 26.343545956805624 18.985434455047713 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 2.0 19 2.0 20 1.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.0 28 4.5 29 6.0 30 8.0 31 15.0 32 18.5 33 22.0 34 38.0 35 47.5 36 62.5 37 83.5 38 112.0 39 164.5 40 203.5 41 228.5 42 239.5 43 242.5 44 266.0 45 318.0 46 316.5 47 250.0 48 233.5 49 219.5 50 170.5 51 148.5 52 132.5 53 101.0 54 70.5 55 52.5 56 40.0 57 29.5 58 31.0 59 27.0 60 17.0 61 13.5 62 12.0 63 9.5 64 5.5 65 4.5 66 3.5 67 3.5 68 4.5 69 3.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.075 5 0.075 6 0.25 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.29 15-19 0.305 20-24 0.295 25-29 0.16 30-34 0.06999999999999999 35-39 0.06999999999999999 40-44 0.19499999999999998 45-49 0.295 50-54 0.32 55-59 0.32 60-64 0.305 65-69 0.27999999999999997 70-74 0.105 75-79 0.02 80-84 0.0 85-89 0.1 90-94 0.27999999999999997 95-99 0.335 100-104 0.395 105-109 0.415 110-114 0.40499999999999997 115-119 0.385 120-124 0.32 125-129 0.25 130-134 0.22999999999999998 135-139 0.33 140-144 0.40499999999999997 145-149 0.43 150-151 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72389558232932 99.325 2 0.2259036144578313 0.44999999999999996 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.325 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.275 0.0 0.0 0.0 0.0 126-127 6.8375 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 7.9375 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758823 spots for SRR7171422.sra Written 758823 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra Read 758808 spots for SRR7171422.sra Written 758808 spots for SRR7171422.sra SRR ids: ['SRR7171422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5wvass0_ SRR7171422.sra spots: 15176175 blocks: [[1, 758808], [758809, 1517616], [1517617, 2276424], [2276425, 3035232], [3035233, 3794040], [3794041, 4552848], [4552849, 5311656], [5311657, 6070464], [6070465, 6829272], [6829273, 7588080], [7588081, 8346888], [8346889, 9105696], [9105697, 9864504], [9864505, 10623312], [10623313, 11382120], [11382121, 12140928], [12140929, 12899736], [12899737, 13658544], [13658545, 14417352], [14417353, 15176175]] SRR7171422 file size 5121007 SRR7171422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171422 SRR7171422_1.fastq SRR7171422_2.fastq Input file: SRR7171422_1.fastq Paired file: SRR7171422_2.fastq trimmed: SRR7171422-trimmed-pair1.fastq, SRR7171422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:16:17 2025 >> started Thu Feb 13 17:16:34 2025 >> done (16.925s) 15176175 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 1555 ( 0.01%) empty read pairs filtered out after trimming by size control 15174516 (99.99%) read pairs available; of these: 2537799 (16.72%) trimmed read pairs available after processing 12636717 (83.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 4 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 5 0.00% 34 4 0.00% 35 4 0.00% 36 4 0.00% 37 5 0.00% 38 5 0.00% 39 8 0.00% 40 8 0.00% 41 6 0.00% 42 6 0.00% 43 7 0.00% 44 13 0.00% 45 7 0.00% 46 11 0.00% 47 15 0.00% 48 12 0.00% 49 17 0.00% 50 33 0.00% 51 37 0.00% 52 37 0.00% 53 44 0.00% 54 50 0.00% 55 59 0.00% 56 77 0.00% 57 75 0.00% 58 72 0.00% 59 124 0.00% 60 116 0.00% 61 156 0.00% 62 184 0.00% 63 223 0.00% 64 248 0.00% 65 267 0.00% 66 347 0.00% 67 365 0.00% 68 404 0.00% 69 467 0.00% 70 554 0.00% 71 691 0.00% 72 827 0.01% 73 999 0.01% 74 1129 0.01% 75 1259 0.01% 76 1460 0.01% 77 1650 0.01% 78 1896 0.01% 79 2152 0.01% 80 2475 0.02% 81 2770 0.02% 82 3331 0.02% 83 3670 0.02% 84 4193 0.03% 85 4610 0.03% 86 5147 0.03% 87 5499 0.04% 88 6082 0.04% 89 6651 0.04% 90 7519 0.05% 91 8361 0.06% 92 9273 0.06% 93 10329 0.07% 94 11315 0.07% 95 12147 0.08% 96 13124 0.09% 97 13629 0.09% 98 14345 0.09% 99 15494 0.10% 100 16461 0.11% 101 17575 0.12% 102 19177 0.13% 103 20395 0.13% 104 21809 0.14% 105 23367 0.15% 106 24266 0.16% 107 24797 0.16% 108 25543 0.17% 109 26896 0.18% 110 27714 0.18% 111 29140 0.19% 112 30758 0.20% 113 32198 0.21% 114 34209 0.23% 115 35654 0.23% 116 37726 0.25% 117 39698 0.26% 118 39784 0.26% 119 40796 0.27% 120 40368 0.27% 121 41143 0.27% 122 42787 0.28% 123 45459 0.30% 124 46642 0.31% 125 48048 0.32% 126 48818 0.32% 127 49874 0.33% 128 50306 0.33% 129 50954 0.34% 130 51820 0.34% 131 52471 0.35% 132 54042 0.36% 133 56042 0.37% 134 57588 0.38% 135 59041 0.39% 136 60263 0.40% 137 60544 0.40% 138 61319 0.40% 139 61345 0.40% 140 62353 0.41% 141 64326 0.42% 142 65123 0.43% 143 68534 0.45% 144 69783 0.46% 145 70892 0.47% 146 69464 0.46% 147 71346 0.47% 148 71079 0.47% 149 69273 0.46% 150 72652 0.48% 151 12636717 83.28% 15174516 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=72.74 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.0 sequence=CTCTGCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGGCCAACGGCACGTGCCTCCGGGGCCAAGAGGCCCCTACTGCAGGTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGCGAATCAACGGTTCCTCTCGTACTAGGTTGGATTACTATTGCGACACTGTCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=24 prefix-density=0.47 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=24.16 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGT SRR7171422 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:17:18 Started mapping on | Feb 13 17:17:19 Finished on | Feb 13 17:19:29 Mapping speed, Million of reads per hour | 420.22 Number of input reads | 15174516 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13588142 Uniquely mapped reads % | 89.55% Average mapped length | 292.79 Number of splices: Total | 13102868 Number of splices: Annotated (sjdb) | 12881346 Number of splices: GT/AG | 12897447 Number of splices: GC/AG | 160626 Number of splices: AT/AC | 10225 Number of splices: Non-canonical | 34570 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386397 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 261145 % of reads mapped to too many loci | 1.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1199978 1199978 1199978 N_multimapping 386397 386397 386397 N_noFeature 299736 13456285 353930 N_ambiguous 144080 1153 65612 UnstrandedReadsAssigned:13144326 PositiveStrandReadsAssigned:130704 NegativeStrandReadsAssigned:13168600 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171422-trimmed-pair1.fastq SRR7171422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,174,516 reads, 13,429,852 reads pseudoaligned [quant] estimated average fragment length: 217.41 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7171422.ke.tsv 34699 SRR7171422.se.tsv 87100 total ==> SRR7171422.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.59 836 30.0331 Potri.005G024800.1.v4.1 1035 818.59 173 13.6782 Potri.004G059700.1.v4.1 961 744.594 21 1.82536 Potri.007G009000.2.v4.1 1416 1199.59 0 0 Potri.003G141000.2.v4.1 2943 2726.59 441 10.4681 Potri.016G087400.1.v4.1 270 90.2309 1383 992.01 Potri.015G069301.1.v4.1 564 349.744 0 0 Potri.010G195200.1.v4.1 1773 1556.59 208 8.64845 Potri.012G127500.1.v4.1 977 760.59 4305 366.33 ==> SRR7171422.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 517 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 150 SRR7171422 completed mapping pipeline successfully