Starting /dee2/code/volunteer_pipeline.sh SRR7171424 current disk space = 3117876375552 free memory = 1578670080 SRR7171424 SRAfilesize 819c8be6956daf3ef7696f9a665153cc SRR7171424.sra SRR7171424.sra file validated SRR7171424 is paired end SRR7171424 is conventional basespace SRR7171424 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.611 33.0 31.0 34.0 18.0 34.0 2 32.1185 33.0 31.0 34.0 29.0 34.0 3 32.81375 33.0 33.0 34.0 32.0 34.0 4 33.013 33.0 33.0 34.0 32.0 34.0 5 32.90225 33.0 33.0 34.0 32.0 34.0 6 36.83775 38.0 37.0 38.0 35.0 38.0 7 37.33975 38.0 38.0 38.0 37.0 38.0 8 37.3915 38.0 38.0 38.0 37.0 38.0 9 37.54525 38.0 38.0 38.0 38.0 38.0 10-14 37.56445 38.0 38.0 38.0 38.0 38.0 15-19 37.52945 38.0 38.0 38.0 38.0 38.0 20-24 37.50105 38.0 38.0 38.0 38.0 38.0 25-29 37.45425 38.0 38.0 38.0 37.0 38.0 30-34 37.4604 38.0 38.0 38.0 37.0 38.0 35-39 37.4319 38.0 38.0 38.0 37.0 38.0 40-44 37.43045 38.0 38.0 38.0 37.2 38.0 45-49 37.4618 38.0 38.0 38.0 37.2 38.0 50-54 37.3917 38.0 38.0 38.0 37.0 38.0 55-59 37.27995 38.0 38.0 38.0 37.0 38.0 60-64 37.217150000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.133449999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.0785 38.0 38.0 38.0 36.0 38.0 75-79 37.06745 38.0 38.0 38.0 36.0 38.0 80-84 36.9815 38.0 38.0 38.0 35.8 38.0 85-89 37.06795 38.0 38.0 38.0 36.0 38.0 90-94 37.04645 38.0 38.0 38.0 36.0 38.0 95-99 36.87075 38.0 38.0 38.0 35.6 38.0 100-104 36.67145000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.68035 38.0 38.0 38.0 34.6 38.0 110-114 36.70754999999999 38.0 38.0 38.0 34.4 38.0 115-119 36.586349999999996 38.0 38.0 38.0 34.2 38.0 120-124 36.466750000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.3239 38.0 38.0 38.0 33.6 38.0 130-134 36.28525 38.0 37.6 38.0 33.6 38.0 135-139 36.07254999999999 38.0 37.0 38.0 33.0 38.0 140-144 35.992149999999995 38.0 36.4 38.0 33.0 38.0 145-149 35.7092 38.0 36.0 38.0 31.2 38.0 150-151 33.90225 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 0.0 22 2.0 23 5.0 24 4.0 25 5.0 26 14.0 27 16.0 28 19.0 29 23.0 30 28.0 31 35.0 32 67.0 33 90.0 34 108.0 35 210.0 36 489.0 37 2882.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.31948315176083 11.654421079300734 9.754243729414744 41.27185203952369 2 20.3 14.149999999999999 33.5 32.05 3 19.475 18.925 24.474999999999998 37.125 4 22.55 26.6 22.225 28.625 5 21.65 32.074999999999996 23.3 22.975 6 18.5 33.5 26.3 21.7 7 13.575000000000001 27.250000000000004 40.025 19.15 8 18.0 25.55 30.325000000000003 26.125 9 16.6 24.9 33.675 24.825 10-14 19.439999999999998 29.18 27.384999999999998 23.995 15-19 18.75 28.74 27.93 24.58 20-24 19.71 28.439999999999998 27.939999999999998 23.91 25-29 19.525000000000002 29.035 27.485 23.955000000000002 30-34 20.055 28.305000000000003 27.785 23.855 35-39 20.122012201220123 28.172817281728175 27.65776577657766 24.04740474047405 40-44 19.615 28.749999999999996 27.74 23.895 45-49 19.869999999999997 28.475 27.66 23.995 50-54 19.395 28.244999999999997 27.935 24.425 55-59 19.73 28.64 27.46 24.169999999999998 60-64 19.74 28.189999999999998 27.650000000000002 24.42 65-69 19.755 28.425 27.665 24.154999999999998 70-74 19.555 28.725 27.51 24.21 75-79 19.925 28.165000000000003 27.58 24.33 80-84 20.135 27.779999999999998 27.500000000000004 24.585 85-89 19.99 28.625 27.474999999999998 23.91 90-94 20.605 28.015 27.284999999999997 24.095 95-99 20.225 28.549999999999997 27.6 23.625 100-104 20.585 28.634999999999998 26.76 24.02 105-109 20.02 27.85 28.27 23.86 110-114 20.505000000000003 27.589999999999996 28.07 23.835 115-119 20.035 27.634999999999998 28.105000000000004 24.224999999999998 120-124 20.415 28.33 27.169999999999998 24.085 125-129 20.04 28.395 27.79 23.775 130-134 20.72 28.32 27.095000000000002 23.865 135-139 20.69 28.27 27.26 23.78 140-144 20.580000000000002 27.975 27.105 24.34 145-149 21.005 28.67 26.945000000000004 23.380000000000003 150-151 20.875 28.3625 26.75 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 2.5 25 2.0 26 1.5 27 3.5 28 5.5 29 8.5 30 16.5 31 23.5 32 28.5 33 35.5 34 42.5 35 54.0 36 73.0 37 103.5 38 129.0 39 162.0 40 178.5 41 201.5 42 250.0 43 272.0 44 274.5 45 294.0 46 299.0 47 274.0 48 243.0 49 210.5 50 186.0 51 144.0 52 110.5 53 88.5 54 67.5 55 50.5 56 37.5 57 34.5 58 27.5 59 14.5 60 9.0 61 9.5 62 7.5 63 4.5 64 2.5 65 2.5 66 2.0 67 1.5 68 2.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTGA 10 0.006836113 144.9625 4 ACGCGAT 10 0.006836113 144.9625 145 >>END_MODULE SRR7171424 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.054 33.0 33.0 34.0 32.0 34.0 2 33.05 34.0 33.0 34.0 32.0 34.0 3 33.06675 34.0 33.0 34.0 32.0 34.0 4 33.05075 34.0 33.0 34.0 33.0 34.0 5 33.054 34.0 33.0 34.0 33.0 34.0 6 37.0945 38.0 38.0 38.0 37.0 38.0 7 37.09525 38.0 38.0 38.0 37.0 38.0 8 37.098 38.0 38.0 38.0 37.0 38.0 9 37.11925 38.0 38.0 38.0 37.0 38.0 10-14 37.13645 38.0 38.0 38.0 37.0 38.0 15-19 37.0787 38.0 38.0 38.0 36.8 38.0 20-24 37.11765 38.0 38.0 38.0 37.0 38.0 25-29 37.076750000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.128750000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.13295 38.0 38.0 38.0 36.8 38.0 40-44 36.54165 37.8 37.4 38.0 34.0 38.0 45-49 36.9653 38.0 38.0 38.0 36.4 38.0 50-54 36.9559 38.0 38.0 38.0 36.0 38.0 55-59 36.9524 38.0 38.0 38.0 36.0 38.0 60-64 36.91525 38.0 38.0 38.0 36.0 38.0 65-69 36.86945 38.0 38.0 38.0 36.0 38.0 70-74 36.893899999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.90585 38.0 38.0 38.0 36.0 38.0 80-84 36.885749999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.775 38.0 38.0 38.0 35.2 38.0 90-94 36.64795 38.0 38.0 38.0 35.0 38.0 95-99 36.6406 38.0 38.0 38.0 34.8 38.0 100-104 36.50775 38.0 38.0 38.0 34.4 38.0 105-109 36.3609 38.0 38.0 38.0 34.0 38.0 110-114 36.356449999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.3026 38.0 38.0 38.0 34.0 38.0 120-124 36.07505 38.0 37.4 38.0 33.0 38.0 125-129 35.991150000000005 38.0 37.4 38.0 33.0 38.0 130-134 35.915949999999995 38.0 37.0 38.0 33.0 38.0 135-139 35.6564 38.0 36.2 38.0 31.0 38.0 140-144 35.38255 38.0 36.0 38.0 29.4 38.0 145-149 35.195100000000004 38.0 35.8 38.0 28.2 38.0 150-151 32.803875 35.5 31.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 4.0 17 2.0 18 3.0 19 4.0 20 1.0 21 6.0 22 5.0 23 12.0 24 18.0 25 15.0 26 18.0 27 20.0 28 33.0 29 35.0 30 35.0 31 51.0 32 54.0 33 85.0 34 103.0 35 209.0 36 462.0 37 2815.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.25 20.05 16.075 28.625 2 26.853707414829657 25.851703406813627 29.784569138276552 17.51002004008016 3 20.370834377349034 29.716862941618643 30.51866700075169 19.39363568028063 4 23.30243046855425 33.625657729892254 23.92883988975194 19.143071911801552 5 25.237856785177765 34.2764146219329 22.934401602403607 17.55132699048573 6 21.143717080511664 37.57210935540506 23.25056433408578 18.03360922999749 7 20.045158053186153 22.32814851981937 38.8861013547416 18.740592072252884 8 22.5871145650539 24.492353973426926 28.1774880922537 24.74304336926548 9 23.350890393779782 25.106596438424884 28.843742162026587 22.698771005768748 10-14 23.131333400220726 28.940503662084883 26.642921641416674 21.285241296277714 15-19 23.784678673556414 28.67606481713741 26.62419103998395 20.91506546932223 20-24 23.74862072424516 28.041929982947135 27.53034406660648 20.679105226201226 25-29 23.489024756940964 28.310113260499147 27.71875313220407 20.482108850355818 30-34 23.2567452570456 28.4026630625219 27.336436902437804 21.004154777994692 35-39 23.56824888711049 28.339918971640078 27.664682638923622 20.427149502325815 40-44 23.699103520809338 28.08634246506736 27.305053338007713 20.90950067611559 45-49 23.867054341287346 27.73210346901945 27.551634249047524 20.849207940645677 50-54 23.86181307661452 28.254111512234253 27.466907340553547 20.417168070597675 55-59 23.389320631737277 27.97693657558285 28.082226121835046 20.551516670844823 60-64 24.08623715216846 28.37302582100777 27.330157934319377 20.21057909250439 65-69 23.702144718380435 28.136901182601726 27.73100821807978 20.429945880938064 70-74 24.124824964993 27.735547109421884 27.470494098819763 20.669133826765353 75-79 23.57 28.28 27.575 20.575 80-84 24.09 27.74 27.72 20.45 85-89 23.676838419209606 28.07403701850926 27.818909454727365 20.430215107553774 90-94 23.466626578472642 27.861294848667068 28.20204449789537 20.470034074964925 95-99 23.46805736636245 27.720389128472572 28.16668338180724 20.644870123357737 100-104 23.292689046113704 28.225199458076172 27.56786592403031 20.91424557177982 105-109 24.11059260374329 27.84384565206483 27.557830297556325 20.487731446635557 110-114 23.947619286538558 27.971501680798756 27.815965079524357 20.26491395313833 115-119 24.26370979880588 27.966484371080224 27.615272690783204 20.15453313933069 120-124 24.03609927300075 27.12960641764853 28.498370518927054 20.335923790423667 125-129 24.765910570326973 27.735216063291773 27.55996194481999 19.938911421561265 130-134 24.506858916591572 27.50075097626915 28.246720736958046 19.745669370181236 135-139 24.636591478696744 28.215538847117795 27.303258145363408 19.844611528822057 140-144 25.43274296322312 28.056795946013747 27.299182178515878 19.211278912247252 145-149 26.096337180130458 27.31058705469142 27.51128951329654 19.081786251881585 150-151 25.313597591570495 28.24887104867035 27.282990466633215 19.15454089312594 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 2.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 4.5 27 6.5 28 5.5 29 3.0 30 4.5 31 8.5 32 13.5 33 27.5 34 43.5 35 56.5 36 77.5 37 105.5 38 138.0 39 169.5 40 201.0 41 237.5 42 265.0 43 281.5 44 288.0 45 295.0 46 290.0 47 259.5 48 232.5 49 207.0 50 173.5 51 130.5 52 99.5 53 84.5 54 70.5 55 58.0 56 37.5 57 26.0 58 23.0 59 16.0 60 12.5 61 9.5 62 4.5 63 4.5 64 6.0 65 3.0 66 1.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.22499999999999998 4 0.22499999999999998 5 0.15 6 0.325 7 0.35000000000000003 8 0.27499999999999997 9 0.325 10-14 0.33 15-19 0.335 20-24 0.31 25-29 0.22999999999999998 30-34 0.11499999999999999 35-39 0.034999999999999996 40-44 0.165 45-49 0.26 50-54 0.27999999999999997 55-59 0.27499999999999997 60-64 0.27499999999999997 65-69 0.22 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.05 90-94 0.22 95-99 0.29 100-104 0.35500000000000004 105-109 0.35500000000000004 110-114 0.345 115-119 0.345 120-124 0.27499999999999997 125-129 0.145 130-134 0.13 135-139 0.25 140-144 0.345 145-149 0.35000000000000003 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGATA 10 0.0067884917 145.27847 145 >>END_MODULE Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897335 spots for SRR7171424.sra Written 897335 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra Read 897318 spots for SRR7171424.sra Written 897318 spots for SRR7171424.sra SRR ids: ['SRR7171424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7p34epov SRR7171424.sra spots: 17946377 blocks: [[1, 897318], [897319, 1794636], [1794637, 2691954], [2691955, 3589272], [3589273, 4486590], [4486591, 5383908], [5383909, 6281226], [6281227, 7178544], [7178545, 8075862], [8075863, 8973180], [8973181, 9870498], [9870499, 10767816], [10767817, 11665134], [11665135, 12562452], [12562453, 13459770], [13459771, 14357088], [14357089, 15254406], [15254407, 16151724], [16151725, 17049042], [17049043, 17946377]] SRR7171424 file size 6059737 SRR7171424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171424 SRR7171424_1.fastq SRR7171424_2.fastq Input file: SRR7171424_1.fastq Paired file: SRR7171424_2.fastq trimmed: SRR7171424-trimmed-pair1.fastq, SRR7171424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:30:43 2025 >> started Fri Feb 14 08:31:16 2025 >> done (32.696s) 17946377 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 912 ( 0.01%) empty read pairs filtered out after trimming by size control 17945451 (99.99%) read pairs available; of these: 1864960 (10.39%) trimmed read pairs available after processing 16080491 (89.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 2 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 2 0.00% 39 1 0.00% 40 1 0.00% 41 8 0.00% 42 8 0.00% 43 3 0.00% 44 4 0.00% 45 3 0.00% 46 8 0.00% 47 6 0.00% 48 9 0.00% 49 3 0.00% 50 12 0.00% 51 22 0.00% 52 15 0.00% 53 20 0.00% 54 17 0.00% 55 22 0.00% 56 17 0.00% 57 27 0.00% 58 35 0.00% 59 45 0.00% 60 53 0.00% 61 67 0.00% 62 64 0.00% 63 85 0.00% 64 102 0.00% 65 97 0.00% 66 124 0.00% 67 135 0.00% 68 139 0.00% 69 210 0.00% 70 267 0.00% 71 291 0.00% 72 348 0.00% 73 370 0.00% 74 439 0.00% 75 498 0.00% 76 574 0.00% 77 697 0.00% 78 732 0.00% 79 825 0.00% 80 942 0.01% 81 1158 0.01% 82 1399 0.01% 83 1550 0.01% 84 1665 0.01% 85 1955 0.01% 86 2163 0.01% 87 2407 0.01% 88 2637 0.01% 89 2925 0.02% 90 3248 0.02% 91 3754 0.02% 92 4137 0.02% 93 4592 0.03% 94 5126 0.03% 95 5722 0.03% 96 6347 0.04% 97 6791 0.04% 98 7217 0.04% 99 7752 0.04% 100 8432 0.05% 101 8978 0.05% 102 9830 0.05% 103 10815 0.06% 104 11827 0.07% 105 12568 0.07% 106 13486 0.08% 107 14044 0.08% 108 14668 0.08% 109 15508 0.09% 110 16218 0.09% 111 17406 0.10% 112 18366 0.10% 113 19322 0.11% 114 20790 0.12% 115 22278 0.12% 116 23643 0.13% 117 25700 0.14% 118 27482 0.15% 119 26778 0.15% 120 26577 0.15% 121 27685 0.15% 122 28859 0.16% 123 30583 0.17% 124 32199 0.18% 125 33483 0.19% 126 34933 0.19% 127 36198 0.20% 128 36756 0.20% 129 37939 0.21% 130 38601 0.22% 131 39897 0.22% 132 41330 0.23% 133 42664 0.24% 134 44307 0.25% 135 46280 0.26% 136 47986 0.27% 137 49005 0.27% 138 50370 0.28% 139 51607 0.29% 140 52429 0.29% 141 55220 0.31% 142 57376 0.32% 143 56800 0.32% 144 62858 0.35% 145 61743 0.34% 146 60760 0.34% 147 63169 0.35% 148 64765 0.36% 149 64633 0.36% 150 69895 0.39% 151 16080491 89.61% 17945451 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=27 prefix-density=0.47 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=104.27 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=18.0 sequence=TTCTTCAATATATTTAAGAAAGCTGAACGGTAGAGTCATAAGCAATCCCAGCCTTCCAATCACTCGGTATAACATTTGCTGCTTGGGCCCAATATGTGACGCCTGCACTGCCACTTACTTGGAACCTCAAGCTGATGGCACCCTTAGGTGGGTTAGGCATATCCCACACTGCCCCATAGGCTCTTCTCATGCCTCTCCATTCCTTGCAATCCTCCTGCCATAACTCCACAGCTAAAATTTCATTTTGGCCAGCTTGGTACAAGAGAATTATAGCCAAGTAATCAGGAAACCTGCTATGCTCATGGACCTTGAACATGAG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=3.0 sequence=ATGTACCCTGACTTGGGTTTCTCAGAGAGCACCACAACCGAGACAATCATTGCAGGTTTTGCACCAGTTCAGATGTTCTTCGAGAGGTCTGAGATGAACT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=90.96 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.0 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7171424 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:32:01 Started mapping on | Feb 14 08:32:01 Finished on | Feb 14 08:34:14 Mapping speed, Million of reads per hour | 485.74 Number of input reads | 17945451 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16875884 Uniquely mapped reads % | 94.04% Average mapped length | 296.60 Number of splices: Total | 16275208 Number of splices: Annotated (sjdb) | 15957285 Number of splices: GT/AG | 16024433 Number of splices: GC/AG | 196226 Number of splices: AT/AC | 11720 Number of splices: Non-canonical | 42829 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390621 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 49492 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 678946 678946 678946 N_multimapping 390621 390621 390621 N_noFeature 433587 16732388 487125 N_ambiguous 177561 837 87127 UnstrandedReadsAssigned:16264736 PositiveStrandReadsAssigned:142659 NegativeStrandReadsAssigned:16301632 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171424-trimmed-pair1.fastq SRR7171424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,945,451 reads, 16,301,303 reads pseudoaligned [quant] estimated average fragment length: 232.44 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR7171424.ke.tsv 34699 SRR7171424.se.tsv 87100 total ==> SRR7171424.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.56 2045 68.4558 Potri.005G024800.1.v4.1 1035 803.56 2515 187.178 Potri.004G059700.1.v4.1 961 729.56 29 2.37723 Potri.007G009000.2.v4.1 1416 1184.56 0 0 Potri.003G141000.2.v4.1 2943 2711.56 1079.53 23.8095 Potri.016G087400.1.v4.1 270 80.0671 1228 917.232 Potri.015G069301.1.v4.1 564 335.205 0 0 Potri.010G195200.1.v4.1 1773 1541.56 543 21.0656 Potri.012G127500.1.v4.1 977 745.56 8145 653.346 ==> SRR7171424.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 541 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 173 SRR7171424 completed mapping pipeline successfully