Starting /dee2/code/volunteer_pipeline.sh SRR7171425 current disk space = 3088699203584 free memory = 1450069588 SRR7171425 SRAfilesize cedbf87dae60bed42f76158d2c44ba43 SRR7171425.sra SRR7171425.sra file validated SRR7171425 is paired end SRR7171425 is conventional basespace SRR7171425 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47825 33.0 33.0 34.0 32.0 34.0 2 32.32 33.0 32.0 34.0 30.0 34.0 3 32.40625 33.0 33.0 33.0 31.0 34.0 4 32.9255 33.0 33.0 34.0 32.0 34.0 5 33.2445 33.0 33.0 34.0 33.0 34.0 6 36.80725 38.0 37.0 38.0 34.0 38.0 7 37.32825 38.0 38.0 38.0 36.0 38.0 8 37.59275 38.0 38.0 38.0 38.0 38.0 9 37.661 38.0 38.0 38.0 38.0 38.0 10-14 37.64874999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.683749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6546 38.0 38.0 38.0 38.0 38.0 25-29 37.642999999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.6446 38.0 38.0 38.0 38.0 38.0 35-39 37.6536 38.0 38.0 38.0 38.0 38.0 40-44 37.597500000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.5812 38.0 38.0 38.0 38.0 38.0 50-54 37.51835 38.0 38.0 38.0 38.0 38.0 55-59 37.49655 38.0 38.0 38.0 37.4 38.0 60-64 37.47775 38.0 38.0 38.0 37.4 38.0 65-69 37.45105 38.0 38.0 38.0 37.0 38.0 70-74 37.37245 38.0 38.0 38.0 37.0 38.0 75-79 37.2778 38.0 38.0 38.0 37.0 38.0 80-84 37.23005 38.0 38.0 38.0 36.8 38.0 85-89 37.207 38.0 38.0 38.0 36.2 38.0 90-94 37.08245 38.0 38.0 38.0 36.0 38.0 95-99 37.0608 38.0 38.0 38.0 36.0 38.0 100-104 37.016799999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.9276 38.0 38.0 38.0 35.6 38.0 110-114 36.79255 38.0 38.0 38.0 35.0 38.0 115-119 36.780899999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.60505 38.0 38.0 38.0 34.4 38.0 125-129 36.3749 38.0 37.8 38.0 33.8 38.0 130-134 36.319599999999994 38.0 37.8 38.0 33.6 38.0 135-139 36.0672 38.0 36.6 38.0 33.0 38.0 140-144 35.8668 38.0 36.0 38.0 32.2 38.0 145-149 35.673 38.0 36.0 38.0 31.2 38.0 150-151 33.22275 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 5.0 24 6.0 25 7.0 26 9.0 27 9.0 28 11.0 29 9.0 30 14.0 31 35.0 32 37.0 33 70.0 34 106.0 35 197.0 36 535.0 37 2946.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.47029310800106 12.674940586216001 10.404013731185636 39.45075257459731 2 21.9 14.975 33.175 29.95 3 20.05 18.9 23.45 37.6 4 22.975 25.924999999999997 22.45 28.65 5 22.425 30.4 23.7 23.474999999999998 6 19.675 34.75 25.5 20.075000000000003 7 14.95 26.75 40.125 18.175 8 16.6 25.424999999999997 31.775 26.200000000000003 9 17.175 24.5 33.25 25.074999999999996 10-14 19.415 29.34 27.54 23.705000000000002 15-19 19.585 29.035 27.52 23.86 20-24 20.04 28.27 27.650000000000002 24.04 25-29 19.735 29.235 27.72 23.31 30-34 20.04 28.345 27.905 23.71 35-39 19.625 28.515 27.950000000000003 23.91 40-44 19.785 28.599999999999998 27.565 24.05 45-49 20.02 28.415000000000003 27.634999999999998 23.93 50-54 20.36 28.075 27.37 24.195 55-59 19.685 28.845 27.215 24.255 60-64 19.825 28.22 27.91 24.044999999999998 65-69 19.470000000000002 28.16 28.134999999999998 24.235 70-74 21.18 28.105000000000004 27.415 23.3 75-79 20.175 27.800000000000004 27.779999999999998 24.245 80-84 19.830000000000002 28.9 27.339999999999996 23.93 85-89 20.075000000000003 28.455000000000002 27.355 24.115000000000002 90-94 20.455000000000002 28.410000000000004 27.265 23.87 95-99 20.474999999999998 28.470000000000002 28.17 22.884999999999998 100-104 20.361018050902548 28.521426071303562 26.896344817240863 24.221211060553028 105-109 20.855427713856926 28.009004502251127 27.363681840920464 23.771885942971487 110-114 21.305326331582897 28.22705676419105 27.131782945736433 23.335833958489623 115-119 21.04 28.15 27.334999999999997 23.474999999999998 120-124 20.91 28.194999999999997 27.13 23.765 125-129 20.43 28.384999999999998 26.935 24.25 130-134 20.93 27.325 27.500000000000004 24.245 135-139 20.655 27.98 26.71 24.654999999999998 140-144 21.07 27.675 26.875 24.38 145-149 21.275 27.71 26.61 24.404999999999998 150-151 20.8625 27.4125 27.037499999999998 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 6.0 28 10.0 29 11.0 30 15.0 31 20.0 32 27.0 33 36.5 34 47.0 35 67.0 36 80.5 37 96.0 38 130.5 39 164.0 40 189.5 41 218.0 42 244.5 43 268.0 44 282.5 45 271.5 46 258.0 47 262.5 48 247.0 49 210.0 50 176.5 51 141.0 52 117.0 53 104.5 54 81.5 55 52.5 56 34.5 57 30.0 58 27.5 59 16.5 60 9.5 61 9.0 62 6.5 63 3.5 64 4.5 65 4.5 66 3.5 67 1.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.05 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.7625 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.9 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.949999999999999 0.0 0.0 0.0 0.0 132-133 7.6375 0.0 0.0 0.0 0.0 134-135 8.2625 0.0 0.0 0.0 0.0 136-137 8.787500000000001 0.0 0.0 0.0 0.0 138-139 9.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACTGT 10 0.006836113 144.9625 3 AAAAAAA 35 0.0035419178 20.70893 140-144 >>END_MODULE SRR7171425 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13775 33.0 33.0 34.0 33.0 34.0 2 33.26575 34.0 33.0 34.0 33.0 34.0 3 33.2855 34.0 33.0 34.0 33.0 34.0 4 33.294 34.0 33.0 34.0 33.0 34.0 5 33.2785 34.0 33.0 34.0 33.0 34.0 6 37.47225 38.0 38.0 38.0 38.0 38.0 7 37.52425 38.0 38.0 38.0 38.0 38.0 8 37.503 38.0 38.0 38.0 38.0 38.0 9 37.47925 38.0 38.0 38.0 38.0 38.0 10-14 37.4894 38.0 38.0 38.0 38.0 38.0 15-19 37.4852 38.0 38.0 38.0 38.0 38.0 20-24 37.470800000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.4798 38.0 38.0 38.0 38.0 38.0 30-34 37.4383 38.0 38.0 38.0 38.0 38.0 35-39 37.43465 38.0 38.0 38.0 38.0 38.0 40-44 37.4333 38.0 38.0 38.0 37.8 38.0 45-49 37.3354 38.0 38.0 38.0 37.4 38.0 50-54 37.3257 38.0 38.0 38.0 37.2 38.0 55-59 37.327749999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.252700000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.22475 38.0 38.0 38.0 37.0 38.0 70-74 37.20725 38.0 38.0 38.0 37.0 38.0 75-79 37.16905 38.0 38.0 38.0 36.8 38.0 80-84 37.12689999999999 38.0 38.0 38.0 36.6 38.0 85-89 37.088499999999996 38.0 38.0 38.0 36.2 38.0 90-94 36.92705 38.0 38.0 38.0 36.0 38.0 95-99 36.898849999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.772149999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.699949999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.7178 38.0 38.0 38.0 34.8 38.0 115-119 36.541250000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.2918 38.0 37.8 38.0 33.6 38.0 125-129 36.1802 38.0 37.4 38.0 33.4 38.0 130-134 36.07815000000001 38.0 37.2 38.0 33.0 38.0 135-139 35.79975 38.0 36.0 38.0 31.6 38.0 140-144 35.4455 38.0 35.8 38.0 30.0 38.0 145-149 34.94035 38.0 34.6 38.0 28.2 38.0 150-151 32.2615 35.5 28.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 3.0 17 5.0 18 8.0 19 2.0 20 2.0 21 4.0 22 4.0 23 6.0 24 10.0 25 5.0 26 16.0 27 12.0 28 9.0 29 22.0 30 25.0 31 29.0 32 45.0 33 65.0 34 111.0 35 192.0 36 526.0 37 2898.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.025 20.65 16.175 28.15 2 26.674999999999997 25.724999999999998 30.275000000000002 17.325 3 21.075 28.449999999999996 30.95 19.525000000000002 4 23.474999999999998 34.4 23.200000000000003 18.925 5 25.224999999999998 35.6 23.125 16.05 6 20.974999999999998 38.175 22.725 18.125 7 20.225 22.475 37.125 20.175 8 22.900000000000002 25.525 27.474999999999998 24.099999999999998 9 21.0 26.775 30.4 21.825 10-14 23.93 28.675 26.565 20.830000000000002 15-19 23.14 27.57 28.21 21.08 20-24 23.875 27.855 27.32 20.95 25-29 23.02 28.845 27.48 20.655 30-34 23.595 28.799999999999997 26.955000000000002 20.65 35-39 23.27 28.825 27.11 20.794999999999998 40-44 23.82 27.79 27.639999999999997 20.75 45-49 23.14 27.37 28.139999999999997 21.349999999999998 50-54 23.549999999999997 28.105000000000004 27.355 20.990000000000002 55-59 23.72 28.005000000000003 27.384999999999998 20.89 60-64 23.935000000000002 27.76 27.97 20.335 65-69 23.805 28.205000000000002 28.02 19.97 70-74 23.765 27.43 28.13 20.674999999999997 75-79 23.69 28.07 27.839999999999996 20.4 80-84 23.849999999999998 27.529999999999998 28.035 20.585 85-89 23.43 27.97 28.13 20.47 90-94 24.04 27.860000000000003 27.58 20.52 95-99 23.995 27.965 27.250000000000004 20.79 100-104 24.205 28.07 27.575 20.150000000000002 105-109 24.43 27.650000000000002 27.785 20.135 110-114 24.88 27.85 27.29 19.98 115-119 24.055 28.299999999999997 27.22 20.424999999999997 120-124 25.330000000000002 27.750000000000004 26.815 20.105 125-129 24.93 28.294999999999998 26.625 20.150000000000002 130-134 24.75 27.634999999999998 27.495000000000005 20.119999999999997 135-139 25.295 27.38 27.42 19.905 140-144 25.595000000000002 28.13 27.084999999999997 19.189999999999998 145-149 25.685000000000002 27.474999999999998 27.150000000000002 19.689999999999998 150-151 25.55 27.375 26.637499999999996 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 0.5 24 1.0 25 2.5 26 1.5 27 2.0 28 3.5 29 5.0 30 10.5 31 17.5 32 23.5 33 32.5 34 37.5 35 51.5 36 72.0 37 99.5 38 136.5 39 175.0 40 206.0 41 234.5 42 262.0 43 278.5 44 289.5 45 283.0 46 270.5 47 265.5 48 244.0 49 207.0 50 171.0 51 129.0 52 108.5 53 96.0 54 67.0 55 51.5 56 40.0 57 27.5 58 23.5 59 15.0 60 12.5 61 11.0 62 6.5 63 5.0 64 2.5 65 2.5 66 2.5 67 0.5 68 2.0 69 2.5 70 2.0 71 2.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.4749999999999996 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.9625 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.7375 0.0 0.0 0.0 0.0 134-135 8.3625 0.0 0.0 0.0 0.0 136-137 8.9375 0.0 0.0 0.0 0.0 138-139 9.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGGGA 10 0.006830828 145.0 9 >>END_MODULE Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762878 spots for SRR7171425.sra Written 762878 spots for SRR7171425.sra Read 762894 spots for SRR7171425.sra Written 762894 spots for SRR7171425.sra SRR ids: ['SRR7171425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bq4stjla SRR7171425.sra spots: 15257576 blocks: [[1, 762878], [762879, 1525756], [1525757, 2288634], [2288635, 3051512], [3051513, 3814390], [3814391, 4577268], [4577269, 5340146], [5340147, 6103024], [6103025, 6865902], [6865903, 7628780], [7628781, 8391658], [8391659, 9154536], [9154537, 9917414], [9917415, 10680292], [10680293, 11443170], [11443171, 12206048], [12206049, 12968926], [12968927, 13731804], [13731805, 14494682], [14494683, 15257576]] SRR7171425 file size 5148591 SRR7171425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171425 SRR7171425_1.fastq SRR7171425_2.fastq Input file: SRR7171425_1.fastq Paired file: SRR7171425_2.fastq trimmed: SRR7171425-trimmed-pair1.fastq, SRR7171425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:34:31 2025 >> started Thu Feb 13 17:34:48 2025 >> done (16.251s) 15257576 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 1143 ( 0.01%) empty read pairs filtered out after trimming by size control 15256400 (99.99%) read pairs available; of these: 2272341 (14.89%) trimmed read pairs available after processing 12984059 (85.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 2 0.00% 29 6 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 1 0.00% 37 1 0.00% 38 1 0.00% 39 1 0.00% 40 4 0.00% 41 6 0.00% 42 5 0.00% 43 6 0.00% 44 8 0.00% 45 5 0.00% 46 4 0.00% 47 15 0.00% 48 13 0.00% 49 18 0.00% 50 23 0.00% 51 23 0.00% 52 27 0.00% 53 34 0.00% 54 38 0.00% 55 40 0.00% 56 35 0.00% 57 76 0.00% 58 70 0.00% 59 100 0.00% 60 101 0.00% 61 130 0.00% 62 141 0.00% 63 160 0.00% 64 191 0.00% 65 223 0.00% 66 248 0.00% 67 293 0.00% 68 341 0.00% 69 407 0.00% 70 454 0.00% 71 529 0.00% 72 634 0.00% 73 764 0.01% 74 838 0.01% 75 1063 0.01% 76 1145 0.01% 77 1266 0.01% 78 1486 0.01% 79 1640 0.01% 80 1947 0.01% 81 2282 0.01% 82 2627 0.02% 83 2973 0.02% 84 3306 0.02% 85 3966 0.03% 86 4246 0.03% 87 4608 0.03% 88 4923 0.03% 89 5651 0.04% 90 6159 0.04% 91 6959 0.05% 92 7670 0.05% 93 8784 0.06% 94 9404 0.06% 95 10324 0.07% 96 11191 0.07% 97 11796 0.08% 98 12497 0.08% 99 13365 0.09% 100 14309 0.09% 101 15227 0.10% 102 16487 0.11% 103 17818 0.12% 104 18732 0.12% 105 20051 0.13% 106 21246 0.14% 107 22370 0.15% 108 22916 0.15% 109 24021 0.16% 110 24575 0.16% 111 26054 0.17% 112 26845 0.18% 113 28622 0.19% 114 30661 0.20% 115 32168 0.21% 116 33158 0.22% 117 33999 0.22% 118 34530 0.23% 119 35297 0.23% 120 36370 0.24% 121 37039 0.24% 122 38577 0.25% 123 40098 0.26% 124 42075 0.28% 125 42381 0.28% 126 44234 0.29% 127 45536 0.30% 128 45704 0.30% 129 46341 0.30% 130 47549 0.31% 131 47973 0.31% 132 49445 0.32% 133 51099 0.33% 134 51969 0.34% 135 53673 0.35% 136 54685 0.36% 137 55120 0.36% 138 56345 0.37% 139 57006 0.37% 140 57133 0.37% 141 58055 0.38% 142 59302 0.39% 143 60115 0.39% 144 61063 0.40% 145 62579 0.41% 146 63698 0.42% 147 64296 0.42% 148 65655 0.43% 149 65128 0.43% 150 65689 0.43% 151 12984059 85.11% 15256400 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=134.96 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.8 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.7 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=35.32 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.6 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171425 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:35:35 Started mapping on | Feb 13 17:35:35 Finished on | Feb 13 17:38:06 Mapping speed, Million of reads per hour | 363.73 Number of input reads | 15256400 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13982993 Uniquely mapped reads % | 91.65% Average mapped length | 293.99 Number of splices: Total | 13166687 Number of splices: Annotated (sjdb) | 12901433 Number of splices: GT/AG | 12957003 Number of splices: GC/AG | 163824 Number of splices: AT/AC | 9968 Number of splices: Non-canonical | 35892 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342064 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 221529 % of reads mapped to too many loci | 1.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 931343 931343 931343 N_multimapping 342064 342064 342064 N_noFeature 388662 13851162 445608 N_ambiguous 145545 1042 69955 UnstrandedReadsAssigned:13448786 PositiveStrandReadsAssigned:130789 NegativeStrandReadsAssigned:13467430 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171425-trimmed-pair1.fastq SRR7171425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,256,400 reads, 13,569,574 reads pseudoaligned [quant] estimated average fragment length: 220.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7171425.ke.tsv 34699 SRR7171425.se.tsv 87100 total ==> SRR7171425.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.22 1593 63.9399 Potri.005G024800.1.v4.1 1035 815.216 842 74.5483 Potri.004G059700.1.v4.1 961 741.221 31 3.01865 Potri.007G009000.2.v4.1 1416 1196.22 0 0 Potri.003G141000.2.v4.1 2943 2723.22 878.118 23.2739 Potri.016G087400.1.v4.1 270 87.6048 911 750.566 Potri.015G069301.1.v4.1 564 346.335 0 0 Potri.010G195200.1.v4.1 1773 1553.22 434 20.1677 Potri.012G127500.1.v4.1 977 757.221 6626 631.578 ==> SRR7171425.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 90 SRR7171425 completed mapping pipeline successfully