Starting /dee2/code/volunteer_pipeline.sh SRR7171426 current disk space = 3088635953152 free memory = 1446141392 SRR7171426 SRAfilesize 79a0f41c9152cbe964cbc3f6285d4f05 SRR7171426.sra SRR7171426.sra file validated SRR7171426 is paired end SRR7171426 is conventional basespace SRR7171426 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87425 33.0 33.0 34.0 32.0 34.0 2 33.11625 34.0 33.0 34.0 33.0 34.0 3 32.592 33.0 33.0 34.0 31.0 34.0 4 32.577 33.0 33.0 34.0 32.0 34.0 5 33.02825 33.0 33.0 34.0 32.0 34.0 6 36.8265 38.0 37.0 38.0 35.0 38.0 7 37.302 38.0 38.0 38.0 36.0 38.0 8 37.5505 38.0 38.0 38.0 38.0 38.0 9 37.5525 38.0 38.0 38.0 38.0 38.0 10-14 37.5418 38.0 38.0 38.0 38.0 38.0 15-19 37.4231 38.0 38.0 38.0 37.4 38.0 20-24 37.5945 38.0 38.0 38.0 38.0 38.0 25-29 37.5967 38.0 38.0 38.0 38.0 38.0 30-34 37.58705 38.0 38.0 38.0 38.0 38.0 35-39 37.5316 38.0 38.0 38.0 38.0 38.0 40-44 37.4449 38.0 38.0 38.0 37.4 38.0 45-49 37.37185000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.22675 38.0 38.0 38.0 37.0 38.0 55-59 37.286899999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.351150000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.34015 38.0 38.0 38.0 37.0 38.0 70-74 37.3532 38.0 38.0 38.0 37.0 38.0 75-79 37.28554999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.245050000000006 38.0 38.0 38.0 36.4 38.0 85-89 37.0243 38.0 38.0 38.0 35.8 38.0 90-94 36.97385 38.0 38.0 38.0 35.8 38.0 95-99 36.895799999999994 38.0 38.0 38.0 35.2 38.0 100-104 36.938300000000005 38.0 38.0 38.0 35.2 38.0 105-109 36.73094999999999 38.0 38.0 38.0 34.4 38.0 110-114 36.62115 38.0 38.0 38.0 34.4 38.0 115-119 36.49245 38.0 38.0 38.0 34.0 38.0 120-124 36.427749999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.36469999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.190200000000004 38.0 37.6 38.0 33.0 38.0 135-139 35.97975 38.0 36.2 38.0 32.6 38.0 140-144 35.6803 38.0 36.0 38.0 31.6 38.0 145-149 35.460699999999996 38.0 36.0 38.0 30.6 38.0 150-151 32.73375 35.5 30.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 4.0 24 4.0 25 7.0 26 9.0 27 17.0 28 20.0 29 21.0 30 31.0 31 49.0 32 48.0 33 65.0 34 134.0 35 206.0 36 482.0 37 2900.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.136535076690976 10.1081216997737 9.328639678149358 39.42670354538597 2 22.35 13.900000000000002 33.15 30.599999999999998 3 20.8 19.3 24.85 35.05 4 23.3 25.8 22.35 28.549999999999997 5 23.7 29.675 24.0 22.625 6 19.325 35.55 24.325 20.8 7 15.0 25.474999999999998 40.575 18.95 8 18.375 26.05 31.225 24.349999999999998 9 18.3 24.075 34.0 23.625 10-14 20.630000000000003 29.025000000000002 27.22 23.125 15-19 20.345 27.750000000000004 27.765 24.14 20-24 19.75 28.035 28.055000000000003 24.16 25-29 20.02 27.675 28.125 24.18 30-34 20.256012800640033 27.751387569378466 27.801390069503473 24.191209560478026 35-39 20.51512878219555 27.116779194798703 28.057014253563388 24.31107776944236 40-44 19.733946789357873 27.625525105021005 28.345669133826767 24.29485897179436 45-49 20.287028702870288 27.75777577757776 28.237823782378236 23.717371737173718 50-54 20.41 27.534999999999997 27.744999999999997 24.310000000000002 55-59 20.169999999999998 28.365000000000002 27.474999999999998 23.990000000000002 60-64 19.99 28.165000000000003 27.58 24.265 65-69 20.52 27.935 27.075 24.47 70-74 20.255000000000003 27.839999999999996 27.355 24.55 75-79 20.875 27.305 27.73 24.09 80-84 19.994999999999997 27.905 27.6 24.5 85-89 20.9 27.615000000000002 26.88 24.605 90-94 20.325 27.965 27.6 24.11 95-99 20.815 27.79 27.26 24.135 100-104 20.845 28.17 26.484999999999996 24.5 105-109 20.849999999999998 27.93 27.375 23.845 110-114 20.685000000000002 27.584999999999997 27.584999999999997 24.145 115-119 21.525 28.23 26.375 23.87 120-124 21.485000000000003 28.57 26.700000000000003 23.244999999999997 125-129 21.33 27.62 26.979999999999997 24.07 130-134 21.44 28.01 26.279999999999998 24.27 135-139 21.215 28.205000000000002 26.185000000000002 24.395 140-144 21.555 28.075 25.759999999999998 24.610000000000003 145-149 22.17 27.950000000000003 26.015 23.865 150-151 20.7875 26.8125 26.5125 25.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 4.5 27 6.0 28 3.5 29 5.5 30 17.0 31 21.5 32 21.5 33 34.0 34 44.0 35 56.5 36 80.5 37 85.5 38 108.5 39 151.5 40 175.5 41 217.0 42 251.5 43 258.5 44 268.5 45 284.5 46 280.0 47 252.5 48 222.0 49 206.5 50 184.0 51 157.5 52 123.5 53 86.5 54 77.0 55 61.0 56 42.5 57 40.0 58 35.0 59 23.0 60 14.0 61 15.5 62 18.0 63 15.5 64 10.5 65 5.0 66 7.0 67 6.0 68 4.0 69 4.0 70 3.0 71 2.5 72 1.5 73 1.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.025 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 6.1375 0.0 0.0 0.0 0.0 122-123 6.7375 0.0 0.0 0.0 0.0 124-125 7.4625 0.0 0.0 0.0 0.0 126-127 8.100000000000001 0.0 0.0 0.0 0.0 128-129 8.775 0.0 0.0 0.0 0.0 130-131 9.475 0.0 0.0 0.0 0.0 132-133 10.1375 0.0 0.0 0.0 0.0 134-135 10.8375 0.0 0.0 0.0 0.0 136-137 11.8625 0.0 0.0 0.0 0.0 138-139 12.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171426 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0175 33.0 33.0 34.0 32.0 34.0 2 33.0545 34.0 33.0 34.0 32.0 34.0 3 33.075 34.0 33.0 34.0 33.0 34.0 4 33.0605 34.0 33.0 34.0 33.0 34.0 5 33.0435 34.0 33.0 34.0 33.0 34.0 6 37.1735 38.0 38.0 38.0 37.0 38.0 7 37.20025 38.0 38.0 38.0 37.0 38.0 8 37.1975 38.0 38.0 38.0 37.0 38.0 9 37.1725 38.0 38.0 38.0 37.0 38.0 10-14 37.09975000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.049549999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.1041 38.0 38.0 38.0 37.0 38.0 25-29 37.141600000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.1368 38.0 38.0 38.0 37.0 38.0 35-39 37.090599999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0827 38.0 38.0 38.0 37.0 38.0 45-49 37.02445000000001 38.0 38.0 38.0 36.8 38.0 50-54 36.921899999999994 38.0 38.0 38.0 36.4 38.0 55-59 36.92945 38.0 38.0 38.0 36.2 38.0 60-64 36.8913 38.0 38.0 38.0 36.0 38.0 65-69 36.90365 38.0 38.0 38.0 36.2 38.0 70-74 36.862 38.0 38.0 38.0 36.0 38.0 75-79 36.8754 38.0 38.0 38.0 35.8 38.0 80-84 36.8111 38.0 38.0 38.0 35.6 38.0 85-89 36.74570000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.62480000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.5507 38.0 38.0 38.0 34.4 38.0 100-104 36.5558 38.0 38.0 38.0 34.4 38.0 105-109 36.372550000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.2833 38.0 38.0 38.0 34.0 38.0 115-119 36.095 38.0 38.0 38.0 33.2 38.0 120-124 35.9901 38.0 37.8 38.0 32.8 38.0 125-129 35.8497 38.0 37.2 38.0 31.8 38.0 130-134 35.72525 38.0 36.4 38.0 31.0 38.0 135-139 35.36705 38.0 36.0 38.0 29.0 38.0 140-144 35.01175 38.0 35.4 38.0 28.0 38.0 145-149 34.68655 38.0 34.2 38.0 25.6 38.0 150-151 31.816375 35.5 27.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 7.0 17 10.0 18 8.0 19 4.0 20 6.0 21 6.0 22 11.0 23 9.0 24 15.0 25 18.0 26 16.0 27 29.0 28 25.0 29 22.0 30 47.0 31 43.0 32 42.0 33 76.0 34 106.0 35 229.0 36 492.0 37 2773.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.95 18.9 14.549999999999999 27.6 2 25.494120590442833 25.293970477858394 30.297723292469353 18.914185639229423 3 20.915686765073804 28.096072054040533 30.197648236177134 20.79059294470853 4 24.893670252689517 33.22491868901676 22.792094070552913 19.089316987740805 5 26.344758568926697 34.450838128596445 21.94145609206905 17.262947210407805 6 21.79134350763072 36.32724543407556 23.517638228671505 18.363772829622217 7 20.200250312891114 20.876095118898625 38.272841051314145 20.650813516896118 8 22.252816020025033 24.030037546933666 28.435544430538172 25.281602002503128 9 22.803504380475594 24.480600750938674 29.86232790988736 22.853566958698373 10-14 23.704630788485606 28.74092615769712 25.847309136420527 21.707133917396746 15-19 24.525657071339175 27.564455569461828 26.668335419274094 21.241551939924904 20-24 23.053817271589487 28.245306633291616 27.404255319148934 21.296620775969963 25-29 23.71515788420157 28.113896812290445 27.133063103638094 21.03788219986989 30-34 23.070381671752287 28.19268670901906 27.307288279725878 21.42964333950278 35-39 24.07842744960736 27.999799929975495 26.719351773120593 21.202420847296555 40-44 23.956560904814335 27.8400560504454 26.9792813532179 21.22410169152237 45-49 23.969962453066334 27.50438047559449 27.269086357947437 21.25657071339174 50-54 23.689612015018774 28.140175219023778 27.043804755944933 21.126408010012515 55-59 23.88986232790989 27.904881101376724 27.479349186483105 20.72590738423029 60-64 23.97496871088861 28.21026282853567 26.948685857321653 20.866082603254068 65-69 23.897482104420085 28.01721980277319 26.505481303499025 21.579816789307703 70-74 23.76425855513308 28.0768461076646 27.026215729437663 21.132679607764658 75-79 24.71370705605841 27.279091863779563 26.979046857028553 21.02815422313347 80-84 24.107410741074105 27.26772677267727 27.512751275127513 21.112111211121114 85-89 23.880746335851132 26.882096943624635 27.717472862788256 21.51968385773598 90-94 24.18281023176653 27.421534764979725 27.85703559092957 20.53861941232417 95-99 23.78592169820767 27.821167517773105 27.69099829778712 20.701912486232104 100-104 24.442998047363943 27.762479347118614 27.417012967506132 20.377509638011315 105-109 24.59443220508712 27.778890446625276 27.067895053074302 20.558782295213298 110-114 25.04631715988183 28.095738821290873 27.13434479995994 19.723599218867356 115-119 25.394282281079455 27.366945376257952 27.316877785009762 19.92189455765283 120-124 25.261576971214016 27.63454317897372 26.60325406758448 20.500625782227786 125-129 25.251514089794284 27.634015716502326 27.338705640922967 19.77576455278042 130-134 25.704419198238327 27.871477904008806 26.74040338321405 19.68369951453881 135-139 26.11764705882353 28.010012515644554 26.77847309136421 19.09386733416771 140-144 26.97276186661326 27.668736230723013 26.13158421790507 19.226917684758664 145-149 26.790185277916873 28.28242363545318 25.6885327991988 19.238858287431146 150-151 26.41462193289935 28.004506760140206 25.550826239359036 20.030045067601403 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 2.5 27 3.5 28 4.5 29 4.5 30 6.5 31 13.5 32 19.5 33 26.0 34 39.0 35 54.0 36 64.5 37 75.5 38 119.0 39 174.0 40 191.0 41 210.5 42 246.5 43 263.5 44 274.0 45 289.0 46 288.5 47 268.0 48 227.0 49 185.0 50 161.5 51 149.5 52 126.5 53 89.0 54 78.5 55 70.0 56 45.0 57 35.0 58 30.0 59 27.5 60 22.5 61 15.0 62 20.5 63 20.5 64 11.0 65 6.5 66 4.0 67 4.0 68 4.5 69 4.0 70 5.0 71 3.0 72 1.0 73 1.0 74 1.0 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.125 20-24 0.125 25-29 0.08499999999999999 30-34 0.045 35-39 0.034999999999999996 40-44 0.09 45-49 0.125 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.11499999999999999 70-74 0.06 75-79 0.015 80-84 0.01 85-89 0.045 90-94 0.11499999999999999 95-99 0.13 100-104 0.135 105-109 0.13999999999999999 110-114 0.145 115-119 0.135 120-124 0.125 125-129 0.105 130-134 0.095 135-139 0.125 140-144 0.13999999999999999 145-149 0.15 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36884625094673 98.4 2 0.4796768492804847 0.95 3 0.07573844988639232 0.22499999999999998 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.025246149962130777 0.15 7 0.025246149962130777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 7 0.17500000000000002 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 6.1375 0.0 0.0 0.0 0.0 122-123 6.725 0.0 0.0 0.0 0.0 124-125 7.4375 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.8125 0.0 0.0 0.0 0.0 130-131 9.5 0.0 0.0 0.0 0.0 132-133 10.175 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.8875 0.0 0.0 0.0 0.0 138-139 12.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGGA 10 0.006830828 145.0 9 TGATAAC 10 0.006830828 145.0 5 CCGAGAC 10 0.006830828 145.0 1 >>END_MODULE Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755414 spots for SRR7171426.sra Written 755414 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra Read 755408 spots for SRR7171426.sra Written 755408 spots for SRR7171426.sra SRR ids: ['SRR7171426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g792_jo6 SRR7171426.sra spots: 15108166 blocks: [[1, 755408], [755409, 1510816], [1510817, 2266224], [2266225, 3021632], [3021633, 3777040], [3777041, 4532448], [4532449, 5287856], [5287857, 6043264], [6043265, 6798672], [6798673, 7554080], [7554081, 8309488], [8309489, 9064896], [9064897, 9820304], [9820305, 10575712], [10575713, 11331120], [11331121, 12086528], [12086529, 12841936], [12841937, 13597344], [13597345, 14352752], [14352753, 15108166]] SRR7171426 file size 5097961 SRR7171426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171426 SRR7171426_1.fastq SRR7171426_2.fastq Input file: SRR7171426_1.fastq Paired file: SRR7171426_2.fastq trimmed: SRR7171426-trimmed-pair1.fastq, SRR7171426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:38:54 2025 >> started Thu Feb 13 17:39:12 2025 >> done (17.299s) 15108166 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 1252 ( 0.01%) empty read pairs filtered out after trimming by size control 15106821 (99.99%) read pairs available; of these: 3122288 (20.67%) trimmed read pairs available after processing 11984533 (79.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 4 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 3 0.00% 36 2 0.00% 37 0 0.00% 38 6 0.00% 39 6 0.00% 40 8 0.00% 41 7 0.00% 42 0 0.00% 43 7 0.00% 44 5 0.00% 45 7 0.00% 46 15 0.00% 47 12 0.00% 48 12 0.00% 49 23 0.00% 50 35 0.00% 51 41 0.00% 52 36 0.00% 53 56 0.00% 54 62 0.00% 55 61 0.00% 56 95 0.00% 57 83 0.00% 58 92 0.00% 59 130 0.00% 60 140 0.00% 61 180 0.00% 62 243 0.00% 63 251 0.00% 64 302 0.00% 65 322 0.00% 66 412 0.00% 67 464 0.00% 68 559 0.00% 69 627 0.00% 70 713 0.00% 71 864 0.01% 72 1134 0.01% 73 1209 0.01% 74 1378 0.01% 75 1609 0.01% 76 1860 0.01% 77 2126 0.01% 78 2455 0.02% 79 2747 0.02% 80 3118 0.02% 81 3642 0.02% 82 4278 0.03% 83 4762 0.03% 84 5448 0.04% 85 6137 0.04% 86 6809 0.05% 87 7391 0.05% 88 8176 0.05% 89 8874 0.06% 90 9927 0.07% 91 11122 0.07% 92 12220 0.08% 93 13498 0.09% 94 15060 0.10% 95 16293 0.11% 96 17505 0.12% 97 18519 0.12% 98 19795 0.13% 99 20860 0.14% 100 22352 0.15% 101 23820 0.16% 102 25377 0.17% 103 27356 0.18% 104 28611 0.19% 105 30384 0.20% 106 31973 0.21% 107 33069 0.22% 108 34127 0.23% 109 35361 0.23% 110 36665 0.24% 111 38507 0.25% 112 40371 0.27% 113 41598 0.28% 114 43442 0.29% 115 46019 0.30% 116 47896 0.32% 117 49995 0.33% 118 51603 0.34% 119 52435 0.35% 120 52191 0.35% 121 52831 0.35% 122 54934 0.36% 123 56906 0.38% 124 58407 0.39% 125 59517 0.39% 126 61517 0.41% 127 62036 0.41% 128 62839 0.42% 129 63237 0.42% 130 64363 0.43% 131 64938 0.43% 132 66284 0.44% 133 67769 0.45% 134 69612 0.46% 135 70511 0.47% 136 71913 0.48% 137 72278 0.48% 138 73406 0.49% 139 73726 0.49% 140 73953 0.49% 141 75374 0.50% 142 75824 0.50% 143 78543 0.52% 144 80169 0.53% 145 80852 0.54% 146 78565 0.52% 147 80761 0.53% 148 81828 0.54% 149 80297 0.53% 150 82101 0.54% 151 11984533 79.33% 15106821 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=3.2 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=15.25 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=2.1 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=24 prefix-density=0.53 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=24.91 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171426 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:39:55 Started mapping on | Feb 13 17:39:55 Finished on | Feb 13 17:42:27 Mapping speed, Million of reads per hour | 357.79 Number of input reads | 15106821 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13126258 Uniquely mapped reads % | 86.89% Average mapped length | 290.94 Number of splices: Total | 12595497 Number of splices: Annotated (sjdb) | 12369308 Number of splices: GT/AG | 12393292 Number of splices: GC/AG | 160572 Number of splices: AT/AC | 9715 Number of splices: Non-canonical | 31918 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367054 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 659536 % of reads mapped to too many loci | 4.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.30% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1613509 1613509 1613509 N_multimapping 367054 367054 367054 N_noFeature 344263 13007585 398585 N_ambiguous 123167 850 58172 UnstrandedReadsAssigned:12658828 PositiveStrandReadsAssigned:117823 NegativeStrandReadsAssigned:12669501 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171426-trimmed-pair1.fastq SRR7171426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,106,821 reads, 13,300,594 reads pseudoaligned [quant] estimated average fragment length: 208.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7171426.ke.tsv 34699 SRR7171426.se.tsv 87100 total ==> SRR7171426.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.5 1440 59.1716 Potri.005G024800.1.v4.1 1035 827.499 263 23.6449 Potri.004G059700.1.v4.1 961 753.499 23 2.27088 Potri.007G009000.2.v4.1 1416 1208.5 0 0 Potri.003G141000.2.v4.1 2943 2735.5 469 12.7551 Potri.016G087400.1.v4.1 270 94.9753 751.586 588.731 Potri.015G069301.1.v4.1 564 358.443 0 0 Potri.010G195200.1.v4.1 1773 1565.5 681 32.3626 Potri.012G127500.1.v4.1 977 769.499 7684 742.897 ==> SRR7171426.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 433 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 541 SRR7171426 completed mapping pipeline successfully