Starting /dee2/code/volunteer_pipeline.sh SRR7171427 current disk space = 3088712941568 free memory = 1513945564 SRR7171427 SRAfilesize eea6e6cc979dddc3439272e4dfa3bbaf SRR7171427.sra SRR7171427.sra file validated SRR7171427 is paired end SRR7171427 is conventional basespace SRR7171427 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.86175 32.0 27.0 33.0 18.0 33.0 2 31.43575 33.0 31.0 33.0 27.0 34.0 3 31.3795 33.0 32.0 33.0 27.0 33.0 4 31.785 33.0 31.0 33.0 29.0 33.0 5 32.18175 33.0 32.0 33.0 31.0 34.0 6 36.0845 38.0 36.0 38.0 33.0 38.0 7 37.0235 38.0 38.0 38.0 36.0 38.0 8 37.4955 38.0 38.0 38.0 37.0 38.0 9 37.4645 38.0 38.0 38.0 37.0 38.0 10-14 37.50534999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.51515 38.0 38.0 38.0 37.6 38.0 20-24 37.51285 38.0 38.0 38.0 37.8 38.0 25-29 37.43365 38.0 38.0 38.0 37.2 38.0 30-34 37.42495 38.0 38.0 38.0 37.0 38.0 35-39 37.412400000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.3263 38.0 38.0 38.0 37.0 38.0 45-49 37.331149999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.3089 38.0 38.0 38.0 37.0 38.0 55-59 37.2741 38.0 38.0 38.0 36.8 38.0 60-64 37.1396 38.0 38.0 38.0 36.0 38.0 65-69 37.064049999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.068000000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.008599999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.913650000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.710449999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.727500000000006 38.0 38.0 38.0 34.6 38.0 95-99 36.70219999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.4893 38.0 38.0 38.0 34.0 38.0 105-109 36.4193 38.0 37.8 38.0 34.0 38.0 110-114 36.299899999999994 38.0 37.2 38.0 33.6 38.0 115-119 36.01415 38.0 37.0 38.0 32.4 38.0 120-124 35.7957 38.0 36.6 38.0 31.8 38.0 125-129 35.64605 38.0 36.0 38.0 31.0 38.0 130-134 35.709450000000004 38.0 36.0 38.0 31.2 38.0 135-139 35.4058 38.0 35.8 38.0 30.4 38.0 140-144 35.030800000000006 38.0 35.0 38.0 27.8 38.0 145-149 34.73125 38.0 35.0 38.0 26.4 38.0 150-151 32.298500000000004 36.5 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 4.0 25 10.0 26 11.0 27 16.0 28 22.0 29 31.0 30 40.0 31 54.0 32 81.0 33 112.0 34 157.0 35 329.0 36 756.0 37 2372.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.316326530612244 13.086734693877549 8.775510204081632 39.82142857142857 2 21.532298447671508 14.672008012018026 32.77416124186279 31.021532298447674 3 21.075 19.15 23.474999999999998 36.3 4 23.974999999999998 26.974999999999998 23.75 25.3 5 22.975 30.225 24.275 22.525000000000002 6 19.45 36.55 23.200000000000003 20.8 7 15.5 25.7 40.425 18.375 8 17.125 26.75 31.825 24.3 9 17.549999999999997 25.15 33.575 23.724999999999998 10-14 19.365 29.965000000000003 26.950000000000003 23.72 15-19 19.495 28.470000000000002 27.944999999999997 24.09 20-24 19.78 28.705000000000002 28.165000000000003 23.35 25-29 19.384999999999998 28.349999999999998 28.12 24.145 30-34 19.975 28.76 27.6 23.665 35-39 19.975 28.994999999999997 27.08 23.95 40-44 19.919999999999998 28.975 27.37 23.735 45-49 19.725 28.875 27.345000000000002 24.055 50-54 19.794999999999998 28.634999999999998 27.345000000000002 24.224999999999998 55-59 20.03 28.51 27.555000000000003 23.905 60-64 19.555 28.46 28.1 23.885 65-69 19.70492623155789 28.672168042010505 27.326831707926978 24.296074018504626 70-74 20.721216364909473 28.0334100230069 27.953386015804742 23.291987596278886 75-79 20.21 27.965 27.74 24.085 80-84 19.759999999999998 28.155 28.105000000000004 23.98 85-89 20.195 28.54 27.36 23.905 90-94 20.25 28.405 27.534999999999997 23.810000000000002 95-99 19.645000000000003 28.205000000000002 28.1 24.05 100-104 20.525 28.555000000000003 27.095000000000002 23.825 105-109 20.165 28.244999999999997 27.894999999999996 23.695 110-114 20.209094092341555 28.172677704967235 27.69746385873643 23.92076434395478 115-119 20.678440986641316 28.578576074448392 27.127632961424926 23.615349977485366 120-124 21.18817822673401 28.0892133820073 27.064059608941342 23.65854878231735 125-129 21.14 28.125 27.12 23.615 130-134 20.685000000000002 28.565 27.345000000000002 23.405 135-139 21.01 28.139999999999997 27.1 23.75 140-144 20.979999999999997 27.88 27.439999999999998 23.7 145-149 21.584999999999997 27.61 27.250000000000004 23.555 150-151 20.875 27.3375 26.687499999999996 25.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 2.5 27 5.0 28 6.5 29 9.0 30 14.0 31 21.5 32 32.0 33 41.0 34 49.0 35 76.5 36 92.0 37 97.5 38 131.5 39 159.0 40 182.5 41 225.5 42 262.0 43 272.0 44 270.0 45 269.5 46 268.5 47 244.5 48 229.0 49 214.0 50 180.0 51 147.5 52 115.5 53 95.5 54 74.5 55 51.0 56 37.0 57 26.5 58 21.5 59 18.5 60 12.5 61 9.0 62 5.5 63 3.5 64 4.5 65 5.5 66 3.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.03 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.065 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.887499999999999 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTT 10 0.006832588 144.9875 2 AATTGTT 10 0.006832588 144.9875 7 >>END_MODULE SRR7171427 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171427_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6975 33.0 33.0 34.0 32.0 34.0 2 32.73475 34.0 33.0 34.0 32.0 34.0 3 32.77275 34.0 33.0 34.0 32.0 34.0 4 32.84025 34.0 33.0 34.0 32.0 34.0 5 32.798 34.0 33.0 34.0 32.0 34.0 6 37.08075 38.0 38.0 38.0 36.0 38.0 7 36.98775 38.0 38.0 38.0 36.0 38.0 8 37.0195 38.0 38.0 38.0 36.0 38.0 9 36.9505 38.0 38.0 38.0 36.0 38.0 10-14 36.86225 38.0 38.0 38.0 35.8 38.0 15-19 36.778 38.0 38.0 38.0 35.4 38.0 20-24 36.80755 38.0 38.0 38.0 35.6 38.0 25-29 36.82685 38.0 38.0 38.0 35.6 38.0 30-34 36.86945000000001 38.0 38.0 38.0 35.8 38.0 35-39 36.839 38.0 38.0 38.0 35.4 38.0 40-44 36.8577 38.0 38.0 38.0 35.8 38.0 45-49 36.89235 38.0 38.0 38.0 35.8 38.0 50-54 36.872699999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.692150000000005 38.0 38.0 38.0 35.0 38.0 60-64 36.527750000000005 38.0 38.0 38.0 34.2 38.0 65-69 36.5021 38.0 38.0 38.0 34.2 38.0 70-74 36.52275 38.0 38.0 38.0 34.2 38.0 75-79 36.5869 38.0 38.0 38.0 34.4 38.0 80-84 36.45455 38.0 38.0 38.0 34.0 38.0 85-89 36.29745 38.0 38.0 38.0 33.6 38.0 90-94 36.17615 38.0 37.8 38.0 32.8 38.0 95-99 36.13075 38.0 37.6 38.0 33.2 38.0 100-104 35.961749999999995 38.0 37.2 38.0 32.2 38.0 105-109 35.676750000000006 38.0 37.0 38.0 30.6 38.0 110-114 35.54055 38.0 36.6 38.0 29.4 38.0 115-119 35.58735 38.0 36.6 38.0 29.8 38.0 120-124 35.206999999999994 38.0 35.8 38.0 27.8 38.0 125-129 35.2303 38.0 35.8 38.0 27.8 38.0 130-134 34.96724999999999 38.0 35.2 38.0 27.2 38.0 135-139 34.250099999999996 38.0 34.2 38.0 22.6 38.0 140-144 33.817 38.0 33.8 38.0 21.4 38.0 145-149 33.774950000000004 38.0 33.6 38.0 21.0 38.0 150-151 31.06575 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 3.0 17 4.0 18 6.0 19 10.0 20 8.0 21 12.0 22 12.0 23 17.0 24 14.0 25 12.0 26 20.0 27 41.0 28 32.0 29 52.0 30 59.0 31 87.0 32 92.0 33 123.0 34 193.0 35 284.0 36 625.0 37 2293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.77354709418837 21.34268537074148 13.902805611222444 27.980961923847698 2 26.525 25.85 29.349999999999998 18.275 3 20.849999999999998 28.025 31.2 19.925 4 23.042281711283465 34.30072554415812 24.718538904178132 17.938453840380287 5 26.063031515757878 35.09254627313656 21.96098049024512 16.883441720860432 6 21.05 39.2 21.85 17.9 7 20.4 21.025 38.0 20.575 8 21.85 25.8 28.425 23.925 9 22.436218109054526 24.787393696848426 29.364682341170585 23.411705852926463 10-14 23.357846815748662 29.371154134774123 26.154384911701435 21.116614137775777 15-19 23.48526542252464 28.483514284284784 27.397808575574125 20.63341171761645 20-24 23.35817536137648 28.519981993697797 27.364577602160757 20.75726504276497 25-29 23.551177558877946 28.206410320516024 27.246362318115906 20.996049802490123 30-34 23.035 28.235 28.044999999999998 20.685000000000002 35-39 23.415 27.589999999999996 28.125 20.87 40-44 23.14 28.335 28.22 20.305 45-49 23.26698009402821 27.953386015804742 27.70331099329799 21.07632289686906 50-54 23.036518259129565 27.978989494747374 27.85392696348174 21.13056528264132 55-59 23.491444010807566 28.46992895026518 28.02962073451416 20.009006304413088 60-64 23.941759231462022 28.27979585709997 27.769438607024917 20.009006304413088 65-69 24.1222366710013 27.773331999599883 27.74332299689907 20.36110833249975 70-74 24.385 27.655 27.83 20.13 75-79 24.18 27.345000000000002 28.315 20.16 80-84 23.97 27.450000000000003 28.194999999999997 20.385 85-89 24.245 27.075 28.175 20.505000000000003 90-94 23.650912728182043 27.116779194798703 28.182045511377847 21.05026256564141 95-99 23.532943118715295 28.00040022012107 27.94036720196108 20.526289459202562 100-104 23.94352092930102 27.223112357300224 28.234528339675546 20.598838373723215 105-109 24.034850533273246 27.419758650042564 28.205898552901708 20.339492263782486 110-114 24.221331997996995 27.921882824236356 27.45117676514772 20.40560841261893 115-119 24.370463078848562 27.614518147684606 27.969962453066334 20.0450563204005 120-124 24.054432659595758 27.876726035621374 28.096858114868922 19.971983189913946 125-129 24.64123206160308 27.806390319515977 27.87139356967848 19.68098404920246 130-134 25.146257312865643 27.67138356917846 27.51637581879094 19.665983299164957 135-139 24.888666499874905 27.705779334500875 27.795846885163872 19.609707280460345 140-144 25.474390427076553 27.872628047864616 27.191708806889302 19.46127271816953 145-149 25.668502754131197 28.002003004506758 26.795192789183776 19.53430145217827 150-151 25.81372058087131 28.029544316474713 27.1156735102654 19.041061592388584 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 4.5 26 2.5 27 1.5 28 6.0 29 9.0 30 12.5 31 15.5 32 19.5 33 26.0 34 37.5 35 54.5 36 72.5 37 101.5 38 132.0 39 172.5 40 204.5 41 236.5 42 260.5 43 276.5 44 292.0 45 307.5 46 296.5 47 237.5 48 222.5 49 218.5 50 181.0 51 141.5 52 112.0 53 84.5 54 64.5 55 51.5 56 36.0 57 21.0 58 15.5 59 15.5 60 9.5 61 8.0 62 7.5 63 7.5 64 6.5 65 2.5 66 1.5 67 2.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.055 15-19 0.065 20-24 0.034999999999999996 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.05 55-59 0.06999999999999999 60-64 0.06999999999999999 65-69 0.03 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.055 100-104 0.13999999999999999 105-109 0.145 110-114 0.15 115-119 0.125 120-124 0.06 125-129 0.005 130-134 0.005 135-139 0.075 140-144 0.135 145-149 0.15 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.42724302588590096 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTATTTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.5375 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.45 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATGG 10 0.006830828 145.0 6 TAACTTA 10 0.006830828 145.0 3 >>END_MODULE Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra Read 827734 spots for SRR7171427.sra Written 827734 spots for SRR7171427.sra Read 827724 spots for SRR7171427.sra Written 827724 spots for SRR7171427.sra SRR ids: ['SRR7171427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjmy4yhq SRR7171427.sra spots: 16554490 blocks: [[1, 827724], [827725, 1655448], [1655449, 2483172], [2483173, 3310896], [3310897, 4138620], [4138621, 4966344], [4966345, 5794068], [5794069, 6621792], [6621793, 7449516], [7449517, 8277240], [8277241, 9104964], [9104965, 9932688], [9932689, 10760412], [10760413, 11588136], [11588137, 12415860], [12415861, 13243584], [13243585, 14071308], [14071309, 14899032], [14899033, 15726756], [15726757, 16554490]] SRR7171427 file size 5588073 SRR7171427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171427 SRR7171427_1.fastq SRR7171427_2.fastq Input file: SRR7171427_1.fastq Paired file: SRR7171427_2.fastq trimmed: SRR7171427-trimmed-pair1.fastq, SRR7171427-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:49:53 2025 >> started Thu Feb 13 17:50:11 2025 >> done (18.110s) 16554490 read pairs processed; of these: 182 ( 0.00%) short read pairs filtered out after trimming by size control 743 ( 0.00%) empty read pairs filtered out after trimming by size control 16553565 (99.99%) read pairs available; of these: 2078516 (12.56%) trimmed read pairs available after processing 14475049 (87.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 6 0.00% 38 3 0.00% 39 3 0.00% 40 5 0.00% 41 4 0.00% 42 11 0.00% 43 5 0.00% 44 4 0.00% 45 4 0.00% 46 3 0.00% 47 6 0.00% 48 8 0.00% 49 11 0.00% 50 6 0.00% 51 9 0.00% 52 18 0.00% 53 17 0.00% 54 16 0.00% 55 31 0.00% 56 32 0.00% 57 25 0.00% 58 47 0.00% 59 49 0.00% 60 73 0.00% 61 56 0.00% 62 97 0.00% 63 104 0.00% 64 116 0.00% 65 134 0.00% 66 164 0.00% 67 190 0.00% 68 195 0.00% 69 246 0.00% 70 296 0.00% 71 334 0.00% 72 417 0.00% 73 536 0.00% 74 588 0.00% 75 670 0.00% 76 771 0.00% 77 869 0.01% 78 977 0.01% 79 1114 0.01% 80 1292 0.01% 81 1463 0.01% 82 1773 0.01% 83 2096 0.01% 84 2389 0.01% 85 2678 0.02% 86 2883 0.02% 87 3179 0.02% 88 3570 0.02% 89 3840 0.02% 90 4278 0.03% 91 4996 0.03% 92 5702 0.03% 93 6155 0.04% 94 6777 0.04% 95 7300 0.04% 96 8146 0.05% 97 8672 0.05% 98 9509 0.06% 99 10020 0.06% 100 10521 0.06% 101 11577 0.07% 102 12653 0.08% 103 13349 0.08% 104 14659 0.09% 105 15421 0.09% 106 16721 0.10% 107 17231 0.10% 108 18224 0.11% 109 19053 0.12% 110 19808 0.12% 111 20691 0.12% 112 21986 0.13% 113 23466 0.14% 114 24993 0.15% 115 26491 0.16% 116 27555 0.17% 117 29852 0.18% 118 32987 0.20% 119 31087 0.19% 120 31387 0.19% 121 31866 0.19% 122 32968 0.20% 123 34928 0.21% 124 36534 0.22% 125 37847 0.23% 126 39176 0.24% 127 40550 0.24% 128 41200 0.25% 129 42008 0.25% 130 43406 0.26% 131 43991 0.27% 132 45360 0.27% 133 47136 0.28% 134 48360 0.29% 135 50346 0.30% 136 51536 0.31% 137 52836 0.32% 138 53915 0.33% 139 54900 0.33% 140 55138 0.33% 141 57679 0.35% 142 63819 0.39% 143 61465 0.37% 144 63378 0.38% 145 65936 0.40% 146 63599 0.38% 147 68350 0.41% 148 66329 0.40% 149 66955 0.40% 150 72286 0.44% 151 14475049 87.44% 16553565 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=61.28 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.1 sequence=CCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGGCGCGGCTCAACGAAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCCGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTAC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=3.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=33.94 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171427 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:50:53 Started mapping on | Feb 13 17:50:53 Finished on | Feb 13 17:52:48 Mapping speed, Million of reads per hour | 518.20 Number of input reads | 16553565 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15409783 Uniquely mapped reads % | 93.09% Average mapped length | 295.47 Number of splices: Total | 14535246 Number of splices: Annotated (sjdb) | 14268405 Number of splices: GT/AG | 14312251 Number of splices: GC/AG | 175600 Number of splices: AT/AC | 10429 Number of splices: Non-canonical | 36966 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378401 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 192224 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765381 765381 765381 N_multimapping 378401 378401 378401 N_noFeature 389597 15267824 439772 N_ambiguous 170697 970 78285 UnstrandedReadsAssigned:14849489 PositiveStrandReadsAssigned:140989 NegativeStrandReadsAssigned:14891726 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171427 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171427-trimmed-pair1.fastq SRR7171427-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,553,565 reads, 15,061,798 reads pseudoaligned [quant] estimated average fragment length: 224.985 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7171427.ke.tsv 34699 SRR7171427.se.tsv 87100 total ==> SRR7171427.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.02 2125 70.0791 Potri.005G024800.1.v4.1 1035 811.015 2664 194.339 Potri.004G059700.1.v4.1 961 737.035 23 1.84627 Potri.007G009000.2.v4.1 1416 1192.02 0 0 Potri.003G141000.2.v4.1 2943 2719.02 1012 22.0204 Potri.016G087400.1.v4.1 270 83.7005 1097 775.415 Potri.015G069301.1.v4.1 564 342.176 0 0 Potri.010G195200.1.v4.1 1773 1549.02 598.929 22.8757 Potri.012G127500.1.v4.1 977 753.03 1967 154.542 ==> SRR7171427.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 465 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 89 SRR7171427 completed mapping pipeline successfully