Starting /dee2/code/volunteer_pipeline.sh SRR7171429 current disk space = 3088717225984 free memory = 1442495056 SRR7171429 SRAfilesize 7be9efc996153c126ff9f8038f887507 SRR7171429.sra SRR7171429.sra file validated SRR7171429 is paired end SRR7171429 is conventional basespace SRR7171429 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.435 18.0 18.0 32.0 18.0 32.0 2 22.8415 18.0 18.0 27.0 18.0 32.0 3 26.46375 27.0 25.0 32.0 18.0 32.0 4 29.4775 32.0 27.0 32.0 25.0 33.0 5 30.9395 32.0 32.0 33.0 27.0 33.0 6 33.90425 36.0 33.0 37.0 28.0 38.0 7 36.01375 37.0 36.0 38.0 33.0 38.0 8 37.289 38.0 38.0 38.0 36.0 38.0 9 37.4635 38.0 38.0 38.0 37.0 38.0 10-14 37.5218 38.0 38.0 38.0 37.0 38.0 15-19 37.636700000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.59925 38.0 38.0 38.0 38.0 38.0 25-29 37.55105 38.0 38.0 38.0 38.0 38.0 30-34 37.5293 38.0 38.0 38.0 37.8 38.0 35-39 37.5537 38.0 38.0 38.0 38.0 38.0 40-44 37.5286 38.0 38.0 38.0 38.0 38.0 45-49 37.5239 38.0 38.0 38.0 37.6 38.0 50-54 37.439099999999996 38.0 38.0 38.0 37.2 38.0 55-59 37.4146 38.0 38.0 38.0 37.0 38.0 60-64 37.42315 38.0 38.0 38.0 37.0 38.0 65-69 37.3582 38.0 38.0 38.0 37.0 38.0 70-74 37.274249999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.16185 38.0 38.0 38.0 36.0 38.0 80-84 37.1255 38.0 38.0 38.0 36.0 38.0 85-89 37.139700000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.02765 38.0 38.0 38.0 36.0 38.0 95-99 36.8549 38.0 38.0 38.0 35.2 38.0 100-104 36.80409999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.718650000000004 38.0 38.0 38.0 34.6 38.0 110-114 36.556200000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.58155 38.0 38.0 38.0 34.2 38.0 120-124 36.33435 38.0 37.4 38.0 34.0 38.0 125-129 36.221050000000005 38.0 37.0 38.0 33.2 38.0 130-134 36.182550000000006 38.0 37.0 38.0 33.0 38.0 135-139 35.83669999999999 38.0 36.0 38.0 32.0 38.0 140-144 35.63065 38.0 36.0 38.0 31.2 38.0 145-149 35.34024999999999 38.0 35.4 38.0 29.8 38.0 150-151 32.70825 35.5 30.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 8.0 25 3.0 26 6.0 27 10.0 28 16.0 29 25.0 30 32.0 31 34.0 32 67.0 33 90.0 34 149.0 35 283.0 36 834.0 37 2438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.928292046936114 8.161668839634942 10.378096479791395 36.53194263363755 2 22.925 13.600000000000001 35.8 27.675 3 19.5 18.775 26.974999999999998 34.75 4 23.375 27.6 22.1 26.924999999999997 5 22.975 32.675 24.65 19.7 6 19.15 34.825 25.124999999999996 20.9 7 15.174999999999999 25.275 41.625 17.925 8 17.925 25.7 32.2 24.175 9 18.55 23.425 34.125 23.9 10-14 19.855 29.044999999999998 27.22 23.880000000000003 15-19 19.939999999999998 28.444999999999997 27.389999999999997 24.224999999999998 20-24 20.02 28.34 27.944999999999997 23.695 25-29 19.82 28.685 27.615000000000002 23.880000000000003 30-34 20.015 28.51 28.08 23.395 35-39 19.835 29.13 27.0 24.035 40-44 19.855 28.7 27.24 24.205 45-49 19.62 29.42 27.305 23.655 50-54 20.01 28.349999999999998 27.345000000000002 24.295 55-59 20.0 28.555000000000003 27.310000000000002 24.135 60-64 20.145 27.855 27.529999999999998 24.47 65-69 20.625 28.349999999999998 27.61 23.415 70-74 20.21 28.435 27.925 23.43 75-79 20.46 28.315 27.529999999999998 23.695 80-84 20.7 28.17 27.66 23.47 85-89 20.5 27.785 27.750000000000004 23.965 90-94 20.53 27.37 27.779999999999998 24.32 95-99 20.72 27.560000000000002 28.189999999999998 23.53 100-104 20.76434395477965 27.717472862788256 27.622430093542093 23.89575308889 105-109 20.777661011860083 28.484211579842867 27.393284291647902 23.34484311664915 110-114 20.823535297943664 28.0182118376945 27.602941912242958 23.555310952118877 115-119 21.002350822787978 27.849747411594056 27.504626619316763 23.643275146301203 120-124 20.044999999999998 28.08 27.46 24.415 125-129 20.96 28.38 26.905 23.755000000000003 130-134 20.77 28.33 27.029999999999998 23.87 135-139 20.525 28.13 26.884999999999998 24.46 140-144 20.87 28.24 27.295 23.595 145-149 21.044999999999998 28.76 26.515 23.68 150-151 21.3 28.1 26.35 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 0.5 25 0.5 26 2.5 27 6.5 28 7.5 29 8.5 30 10.5 31 12.5 32 27.5 33 39.5 34 49.5 35 70.0 36 90.5 37 121.5 38 137.0 39 148.0 40 178.0 41 214.5 42 232.5 43 252.5 44 285.5 45 275.0 46 259.0 47 263.0 48 229.0 49 203.5 50 181.5 51 139.0 52 116.5 53 97.0 54 80.0 55 59.5 56 43.0 57 36.0 58 31.5 59 25.0 60 17.0 61 11.0 62 7.5 63 6.0 64 6.0 65 4.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.08499999999999999 110-114 0.065 115-119 0.034999999999999996 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.137499999999999 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATTA 10 0.006836113 144.9625 2 TTTTTTT 35 0.0035419178 20.70893 140-144 >>END_MODULE SRR7171429 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09475 33.0 33.0 34.0 32.0 34.0 2 33.194 34.0 33.0 34.0 33.0 34.0 3 33.20175 34.0 33.0 34.0 33.0 34.0 4 33.1735 34.0 33.0 34.0 33.0 34.0 5 33.16125 34.0 33.0 34.0 33.0 34.0 6 37.38775 38.0 38.0 38.0 37.0 38.0 7 37.435 38.0 38.0 38.0 37.0 38.0 8 37.33575 38.0 38.0 38.0 37.0 38.0 9 37.31075 38.0 38.0 38.0 37.0 38.0 10-14 37.367650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.3399 38.0 38.0 38.0 37.0 38.0 20-24 37.335699999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.30315 38.0 38.0 38.0 37.0 38.0 30-34 37.30695 38.0 38.0 38.0 37.0 38.0 35-39 37.26795 38.0 38.0 38.0 37.0 38.0 40-44 37.289049999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.18775 38.0 38.0 38.0 36.8 38.0 50-54 37.1752 38.0 38.0 38.0 36.8 38.0 55-59 37.11035 38.0 38.0 38.0 36.4 38.0 60-64 37.0836 38.0 38.0 38.0 36.2 38.0 65-69 37.05915 38.0 38.0 38.0 36.0 38.0 70-74 36.97265 38.0 38.0 38.0 36.0 38.0 75-79 36.9072 38.0 38.0 38.0 35.8 38.0 80-84 36.83475 38.0 38.0 38.0 35.4 38.0 85-89 36.78845 38.0 38.0 38.0 35.2 38.0 90-94 36.6828 38.0 38.0 38.0 35.0 38.0 95-99 36.55995 38.0 38.0 38.0 34.4 38.0 100-104 36.443200000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.309250000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.27890000000001 38.0 37.8 38.0 33.8 38.0 115-119 36.08905 38.0 37.2 38.0 33.2 38.0 120-124 35.8438 38.0 36.8 38.0 32.0 38.0 125-129 35.715799999999994 38.0 36.2 38.0 31.0 38.0 130-134 35.52595 38.0 36.0 38.0 30.0 38.0 135-139 35.19025 38.0 35.6 38.0 28.2 38.0 140-144 34.8249 38.0 34.6 38.0 26.4 38.0 145-149 34.2487 38.0 33.0 38.0 23.6 38.0 150-151 31.437624999999997 35.5 27.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 3.0 18 7.0 19 7.0 20 7.0 21 4.0 22 1.0 23 9.0 24 10.0 25 6.0 26 19.0 27 20.0 28 19.0 29 25.0 30 30.0 31 53.0 32 59.0 33 88.0 34 142.0 35 294.0 36 621.0 37 2571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9 20.075000000000003 14.85 27.175 2 26.700000000000003 26.650000000000002 29.325000000000003 17.325 3 21.25 28.775000000000002 29.425 20.549999999999997 4 24.025 33.7 23.1 19.175 5 24.3 36.325 21.55 17.825 6 20.625 37.4 23.525 18.45 7 19.3 22.55 37.925 20.225 8 23.1 24.3 28.375 24.224999999999998 9 22.675 24.925 29.675 22.725 10-14 23.515 28.845 26.284999999999997 21.355 15-19 22.585 28.249999999999996 27.455000000000002 21.709999999999997 20-24 22.875 28.439999999999998 27.715 20.97 25-29 23.165 28.22 27.265 21.349999999999998 30-34 22.89 28.610000000000003 27.255000000000003 21.245 35-39 23.405 28.505000000000003 27.325 20.765 40-44 23.18 27.67 28.04 21.11 45-49 24.05 27.625 27.224999999999998 21.099999999999998 50-54 22.720000000000002 28.360000000000003 27.735 21.185000000000002 55-59 23.555 27.834999999999997 27.810000000000002 20.8 60-64 23.435 28.22 27.415 20.93 65-69 23.724999999999998 27.685 27.6 20.990000000000002 70-74 23.665 27.884999999999998 27.500000000000004 20.95 75-79 23.645 27.785 28.23 20.34 80-84 24.04 27.650000000000002 27.200000000000003 21.11 85-89 23.73 27.675 27.91 20.685000000000002 90-94 23.925 28.000000000000004 27.13 20.945 95-99 24.245 27.474999999999998 27.755000000000003 20.525 100-104 23.799999999999997 28.07 27.295 20.835 105-109 23.685000000000002 27.66 27.66 20.995 110-114 24.095 27.82 27.465 20.62 115-119 23.565 29.085 27.155 20.195 120-124 24.45 28.499999999999996 26.790000000000003 20.26 125-129 24.595 28.03 27.265 20.11 130-134 24.84 27.815 27.48 19.865 135-139 24.42 27.694999999999997 27.57 20.315 140-144 25.14 27.884999999999998 26.345000000000002 20.630000000000003 145-149 25.374999999999996 27.775 26.490000000000002 20.36 150-151 24.9125 27.875 26.650000000000002 20.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.0 28 4.5 29 5.0 30 6.5 31 14.5 32 21.5 33 30.5 34 46.0 35 57.0 36 69.5 37 102.0 38 136.0 39 166.5 40 216.5 41 253.5 42 261.5 43 271.0 44 279.0 45 268.0 46 249.0 47 247.0 48 239.5 49 195.0 50 164.5 51 152.0 52 120.5 53 87.5 54 70.5 55 55.5 56 45.0 57 41.0 58 31.5 59 22.0 60 13.5 61 8.0 62 4.0 63 3.5 64 6.5 65 7.0 66 4.5 67 4.0 68 3.5 69 3.0 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.074999999999999 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.875 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGAAT 10 0.006830828 145.0 2 TTGAAGT 10 0.006830828 145.0 3 >>END_MODULE Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696578 spots for SRR7171429.sra Written 696578 spots for SRR7171429.sra Read 696580 spots for SRR7171429.sra Written 696580 spots for SRR7171429.sra SRR ids: ['SRR7171429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgb92_gt SRR7171429.sra spots: 13931562 blocks: [[1, 696578], [696579, 1393156], [1393157, 2089734], [2089735, 2786312], [2786313, 3482890], [3482891, 4179468], [4179469, 4876046], [4876047, 5572624], [5572625, 6269202], [6269203, 6965780], [6965781, 7662358], [7662359, 8358936], [8358937, 9055514], [9055515, 9752092], [9752093, 10448670], [10448671, 11145248], [11145249, 11841826], [11841827, 12538404], [12538405, 13234982], [13234983, 13931562]] SRR7171429 file size 4699248 SRR7171429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171429 SRR7171429_1.fastq SRR7171429_2.fastq Input file: SRR7171429_1.fastq Paired file: SRR7171429_2.fastq trimmed: SRR7171429-trimmed-pair1.fastq, SRR7171429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:50:46 2025 >> started Thu Feb 13 17:51:02 2025 >> done (16.369s) 13931562 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 1435 ( 0.01%) empty read pairs filtered out after trimming by size control 13930113 (99.99%) read pairs available; of these: 1698875 (12.20%) trimmed read pairs available after processing 12231238 (87.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 0 0.00% 35 2 0.00% 36 5 0.00% 37 6 0.00% 38 2 0.00% 39 3 0.00% 40 7 0.00% 41 7 0.00% 42 15 0.00% 43 3 0.00% 44 8 0.00% 45 6 0.00% 46 15 0.00% 47 6 0.00% 48 11 0.00% 49 24 0.00% 50 23 0.00% 51 20 0.00% 52 25 0.00% 53 33 0.00% 54 43 0.00% 55 51 0.00% 56 32 0.00% 57 45 0.00% 58 73 0.00% 59 82 0.00% 60 90 0.00% 61 105 0.00% 62 131 0.00% 63 159 0.00% 64 168 0.00% 65 229 0.00% 66 223 0.00% 67 255 0.00% 68 317 0.00% 69 378 0.00% 70 415 0.00% 71 476 0.00% 72 593 0.00% 73 707 0.01% 74 763 0.01% 75 905 0.01% 76 920 0.01% 77 1043 0.01% 78 1217 0.01% 79 1446 0.01% 80 1639 0.01% 81 1844 0.01% 82 2258 0.02% 83 2425 0.02% 84 2683 0.02% 85 3122 0.02% 86 3436 0.02% 87 3615 0.03% 88 4025 0.03% 89 4374 0.03% 90 4866 0.03% 91 5355 0.04% 92 5918 0.04% 93 6571 0.05% 94 7311 0.05% 95 7674 0.06% 96 8237 0.06% 97 8664 0.06% 98 9072 0.07% 99 9671 0.07% 100 10433 0.07% 101 11029 0.08% 102 12150 0.09% 103 12913 0.09% 104 13825 0.10% 105 14706 0.11% 106 15146 0.11% 107 15813 0.11% 108 16192 0.12% 109 17071 0.12% 110 17746 0.13% 111 18323 0.13% 112 19399 0.14% 113 20614 0.15% 114 21705 0.16% 115 22925 0.16% 116 23526 0.17% 117 23969 0.17% 118 24936 0.18% 119 24968 0.18% 120 25808 0.19% 121 26644 0.19% 122 27714 0.20% 123 29185 0.21% 124 30509 0.22% 125 31453 0.23% 126 32563 0.23% 127 33058 0.24% 128 33422 0.24% 129 34253 0.25% 130 34709 0.25% 131 35478 0.25% 132 36362 0.26% 133 38162 0.27% 134 39357 0.28% 135 40653 0.29% 136 41541 0.30% 137 42256 0.30% 138 42726 0.31% 139 43223 0.31% 140 43392 0.31% 141 44254 0.32% 142 45011 0.32% 143 45787 0.33% 144 47404 0.34% 145 48998 0.35% 146 49470 0.36% 147 50062 0.36% 148 51354 0.37% 149 50752 0.36% 150 52054 0.37% 151 12231238 87.80% 13930113 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=17 prefix-density=0.72 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=12.56 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.5 sequence=CCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=49.00 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=AGAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCGTATTCGCGAAACCAAATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGATATAAAACCAG SRR7171429 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:52:02 Started mapping on | Feb 13 17:52:02 Finished on | Feb 13 17:54:00 Mapping speed, Million of reads per hour | 424.99 Number of input reads | 13930113 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12837427 Uniquely mapped reads % | 92.16% Average mapped length | 295.20 Number of splices: Total | 12736124 Number of splices: Annotated (sjdb) | 12498616 Number of splices: GT/AG | 12533289 Number of splices: GC/AG | 160015 Number of splices: AT/AC | 9320 Number of splices: Non-canonical | 33500 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321920 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 38083 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.18% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770766 770766 770766 N_multimapping 321920 321920 321920 N_noFeature 329169 12725190 373825 N_ambiguous 132276 637 64387 UnstrandedReadsAssigned:12375982 PositiveStrandReadsAssigned:111600 NegativeStrandReadsAssigned:12399215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171429-trimmed-pair1.fastq SRR7171429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,930,113 reads, 12,376,275 reads pseudoaligned [quant] estimated average fragment length: 233.389 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7171429.ke.tsv 34699 SRR7171429.se.tsv 87100 total ==> SRR7171429.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.61 1044 46.0876 Potri.005G024800.1.v4.1 1035 802.611 224 21.9995 Potri.004G059700.1.v4.1 961 728.642 7 0.757276 Potri.007G009000.2.v4.1 1416 1183.61 0 0 Potri.003G141000.2.v4.1 2943 2710.61 515 14.9765 Potri.016G087400.1.v4.1 270 84.2439 892 834.635 Potri.015G069301.1.v4.1 564 336.152 0 0 Potri.010G195200.1.v4.1 1773 1540.61 360 18.4196 Potri.012G127500.1.v4.1 977 744.622 4205 445.144 ==> SRR7171429.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 183 SRR7171429 completed mapping pipeline successfully