Starting /dee2/code/volunteer_pipeline.sh SRR7171430 current disk space = 3088728694784 free memory = 1425100144 SRR7171430 SRAfilesize cbd67e13ca03b234b9095c53f11cfaea SRR7171430.sra SRR7171430.sra file validated SRR7171430 is paired end SRR7171430 is conventional basespace SRR7171430 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54275 33.0 33.0 34.0 32.0 34.0 2 31.85975 33.0 32.0 33.0 28.0 34.0 3 32.526 33.0 33.0 34.0 32.0 34.0 4 32.34975 33.0 32.0 33.0 31.0 34.0 5 32.49975 33.0 33.0 33.0 32.0 34.0 6 36.4795 38.0 37.0 38.0 34.0 38.0 7 37.1045 38.0 38.0 38.0 35.0 38.0 8 37.50275 38.0 38.0 38.0 37.0 38.0 9 37.54275 38.0 38.0 38.0 38.0 38.0 10-14 37.62065 38.0 38.0 38.0 38.0 38.0 15-19 37.64975 38.0 38.0 38.0 38.0 38.0 20-24 37.639900000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.627399999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.6205 38.0 38.0 38.0 38.0 38.0 35-39 37.64104999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.60535 38.0 38.0 38.0 38.0 38.0 45-49 37.57045000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.50945 38.0 38.0 38.0 38.0 38.0 55-59 37.51705 38.0 38.0 38.0 37.2 38.0 60-64 37.50055 38.0 38.0 38.0 37.4 38.0 65-69 37.3986 38.0 38.0 38.0 37.0 38.0 70-74 37.38655000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.363350000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.30935 38.0 38.0 38.0 37.0 38.0 85-89 37.29345 38.0 38.0 38.0 36.8 38.0 90-94 37.19539999999999 38.0 38.0 38.0 36.4 38.0 95-99 37.0801 38.0 38.0 38.0 36.0 38.0 100-104 37.05305 38.0 38.0 38.0 36.0 38.0 105-109 36.978500000000004 38.0 38.0 38.0 35.8 38.0 110-114 36.88985 38.0 38.0 38.0 35.2 38.0 115-119 36.86935 38.0 38.0 38.0 35.0 38.0 120-124 36.6744 38.0 38.0 38.0 34.6 38.0 125-129 36.46425000000001 38.0 38.0 38.0 34.0 38.0 130-134 36.4599 38.0 38.0 38.0 34.0 38.0 135-139 36.1939 38.0 37.2 38.0 33.2 38.0 140-144 36.02375000000001 38.0 36.2 38.0 33.0 38.0 145-149 35.82725 38.0 36.0 38.0 32.4 38.0 150-151 33.23975 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 3.0 24 5.0 25 5.0 26 8.0 27 7.0 28 13.0 29 20.0 30 22.0 31 26.0 32 38.0 33 51.0 34 82.0 35 182.0 36 537.0 37 2996.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.816326530612244 12.663526949241236 8.189429618001046 38.330716902145475 2 21.475 16.0 32.85 29.675 3 20.125 19.400000000000002 24.65 35.825 4 21.725 28.875 23.200000000000003 26.200000000000003 5 21.349999999999998 32.675 23.799999999999997 22.175 6 18.825 35.025 25.650000000000002 20.5 7 14.399999999999999 26.25 42.125 17.224999999999998 8 18.925 24.15 32.2 24.725 9 16.3 24.6 35.375 23.724999999999998 10-14 19.935 29.65 27.0 23.415 15-19 19.27 29.125 27.815 23.79 20-24 19.77 29.145 27.495000000000005 23.59 25-29 19.375 29.270000000000003 27.775 23.580000000000002 30-34 19.8 28.455000000000002 27.925 23.82 35-39 20.365 28.37 27.905 23.36 40-44 19.465 28.494999999999997 28.285 23.755000000000003 45-49 20.04 28.315 27.98 23.665 50-54 20.46 28.43 27.839999999999996 23.27 55-59 19.89 28.415000000000003 27.62 24.075 60-64 19.950000000000003 29.26 27.384999999999998 23.405 65-69 19.675 28.4 28.310000000000002 23.615 70-74 19.794999999999998 28.305000000000003 28.410000000000004 23.49 75-79 20.035 28.43 27.805000000000003 23.73 80-84 20.005 28.389999999999997 28.33 23.275000000000002 85-89 19.85 29.17 27.3 23.68 90-94 20.175 28.360000000000003 27.82 23.645 95-99 20.105 28.835 27.735 23.325000000000003 100-104 20.93104655232762 29.051452572628634 27.13135656782839 22.88614430721536 105-109 20.18009004502251 28.86943471735868 27.12856428214107 23.821910955477737 110-114 20.220055013753438 28.60715178794699 27.35683920980245 23.815953988497125 115-119 20.57 28.165000000000003 27.750000000000004 23.515 120-124 20.715 28.615000000000002 27.6 23.07 125-129 20.765 28.560000000000002 26.985 23.69 130-134 21.025 28.499999999999996 26.6 23.875 135-139 20.68 28.325 27.589999999999996 23.405 140-144 20.84 28.09 27.555000000000003 23.515 145-149 20.630000000000003 28.02 27.339999999999996 24.01 150-151 21.65 27.987499999999997 26.3 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 2.0 25 2.5 26 2.0 27 5.0 28 7.5 29 9.5 30 13.0 31 19.0 32 30.0 33 41.5 34 57.5 35 74.5 36 82.0 37 114.0 38 146.0 39 166.0 40 188.0 41 221.5 42 267.5 43 281.5 44 284.0 45 292.0 46 281.0 47 254.5 48 227.0 49 197.5 50 166.5 51 144.0 52 116.5 53 82.5 54 66.0 55 46.0 56 27.0 57 20.5 58 16.5 59 11.5 60 8.5 61 5.5 62 3.0 63 3.0 64 1.5 65 1.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.05 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.074999999999999 0.0 0.0 0.0 0.0 138-139 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCTT 10 0.006836113 144.9625 3 >>END_MODULE SRR7171430 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11025 33.0 33.0 34.0 33.0 34.0 2 33.26925 34.0 33.0 34.0 33.0 34.0 3 33.25 34.0 33.0 34.0 33.0 34.0 4 33.2605 34.0 33.0 34.0 33.0 34.0 5 33.247 34.0 33.0 34.0 33.0 34.0 6 37.425 38.0 38.0 38.0 37.0 38.0 7 37.44975 38.0 38.0 38.0 38.0 38.0 8 37.41 38.0 38.0 38.0 38.0 38.0 9 37.4415 38.0 38.0 38.0 37.0 38.0 10-14 37.429 38.0 38.0 38.0 37.8 38.0 15-19 37.43435 38.0 38.0 38.0 37.6 38.0 20-24 37.39005 38.0 38.0 38.0 37.6 38.0 25-29 37.4517 38.0 38.0 38.0 37.8 38.0 30-34 37.437200000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.42845 38.0 38.0 38.0 38.0 38.0 40-44 37.405199999999994 38.0 38.0 38.0 37.2 38.0 45-49 37.325900000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.3173 38.0 38.0 38.0 37.0 38.0 55-59 37.274649999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.278949999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2399 38.0 38.0 38.0 37.0 38.0 70-74 37.185249999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.16945 38.0 38.0 38.0 36.4 38.0 80-84 37.11555 38.0 38.0 38.0 36.2 38.0 85-89 37.022800000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.89955 38.0 38.0 38.0 35.8 38.0 95-99 36.8793 38.0 38.0 38.0 35.4 38.0 100-104 36.77545 38.0 38.0 38.0 35.0 38.0 105-109 36.669650000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.68055 38.0 38.0 38.0 34.6 38.0 115-119 36.4097 38.0 38.0 38.0 34.0 38.0 120-124 36.27105 38.0 37.0 38.0 33.8 38.0 125-129 36.09375 38.0 37.0 38.0 33.2 38.0 130-134 35.870400000000004 38.0 36.4 38.0 31.8 38.0 135-139 35.66565 38.0 36.0 38.0 31.0 38.0 140-144 35.27935 38.0 35.4 38.0 29.2 38.0 145-149 34.705949999999994 38.0 33.0 38.0 26.8 38.0 150-151 31.753124999999997 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 1.0 18 2.0 19 2.0 20 3.0 21 2.0 22 1.0 23 9.0 24 9.0 25 12.0 26 14.0 27 14.0 28 17.0 29 20.0 30 31.0 31 41.0 32 54.0 33 72.0 34 115.0 35 211.0 36 576.0 37 2791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.025 22.025 13.125 26.825 2 26.275 27.1 30.3 16.325 3 20.225 28.525 30.3 20.95 4 23.225 34.525 23.05 19.2 5 24.224999999999998 36.675000000000004 21.675 17.424999999999997 6 20.375 37.125 23.95 18.55 7 19.85 22.05 38.324999999999996 19.775000000000002 8 21.2 25.775 27.400000000000002 25.624999999999996 9 21.5 25.324999999999996 30.7 22.475 10-14 24.055 28.215 26.810000000000002 20.919999999999998 15-19 22.919999999999998 28.189999999999998 28.185 20.705000000000002 20-24 22.68 28.65 27.725 20.945 25-29 23.095 29.25 27.18 20.474999999999998 30-34 23.16 28.410000000000004 28.365000000000002 20.064999999999998 35-39 22.795 28.4 28.095 20.71 40-44 23.35 27.435 27.915 21.3 45-49 23.13 28.285 27.61 20.974999999999998 50-54 23.265 28.000000000000004 28.4 20.335 55-59 23.474999999999998 28.199999999999996 27.794999999999998 20.53 60-64 23.84 27.700000000000003 28.299999999999997 20.16 65-69 22.975 27.485 28.465 21.075 70-74 23.7 28.105000000000004 28.144999999999996 20.05 75-79 23.34 27.800000000000004 28.749999999999996 20.11 80-84 23.75 27.839999999999996 27.99 20.419999999999998 85-89 23.580000000000002 27.755000000000003 28.51 20.155 90-94 23.905 27.62 28.425 20.05 95-99 23.13 28.310000000000002 28.155 20.405 100-104 24.03 28.185 27.125 20.66 105-109 23.474999999999998 27.555000000000003 28.345 20.625 110-114 23.925 27.805000000000003 28.060000000000002 20.21 115-119 24.32 28.139999999999997 27.74 19.8 120-124 24.224999999999998 27.74 28.24 19.794999999999998 125-129 24.265 28.439999999999998 27.79 19.505 130-134 24.91 27.79 27.485 19.814999999999998 135-139 24.915000000000003 28.355000000000004 27.189999999999998 19.54 140-144 25.31 27.66 27.12 19.91 145-149 25.235000000000003 27.825 27.77 19.17 150-151 26.2125 26.474999999999998 28.4125 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 1.5 25 0.5 26 1.5 27 4.0 28 7.5 29 8.5 30 12.0 31 17.0 32 24.0 33 33.0 34 41.0 35 55.0 36 83.0 37 111.5 38 134.5 39 177.0 40 223.5 41 249.0 42 276.5 43 287.0 44 290.5 45 302.0 46 281.5 47 247.0 48 217.5 49 193.5 50 176.5 51 145.0 52 104.0 53 75.0 54 51.5 55 40.0 56 35.5 57 23.0 58 14.5 59 14.5 60 12.0 61 5.5 62 5.5 63 5.5 64 2.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.6375 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.550000000000001 0.0 0.0 0.0 0.0 136-137 7.025 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683304 spots for SRR7171430.sra Written 683304 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra Read 683290 spots for SRR7171430.sra Written 683290 spots for SRR7171430.sra SRR ids: ['SRR7171430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wchx_c9j SRR7171430.sra spots: 13665814 blocks: [[1, 683290], [683291, 1366580], [1366581, 2049870], [2049871, 2733160], [2733161, 3416450], [3416451, 4099740], [4099741, 4783030], [4783031, 5466320], [5466321, 6149610], [6149611, 6832900], [6832901, 7516190], [7516191, 8199480], [8199481, 8882770], [8882771, 9566060], [9566061, 10249350], [10249351, 10932640], [10932641, 11615930], [11615931, 12299220], [12299221, 12982510], [12982511, 13665814]] SRR7171430 file size 4609195 SRR7171430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171430 SRR7171430_1.fastq SRR7171430_2.fastq Input file: SRR7171430_1.fastq Paired file: SRR7171430_2.fastq trimmed: SRR7171430-trimmed-pair1.fastq, SRR7171430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:51:54 2025 >> started Thu Feb 13 17:52:19 2025 >> done (24.180s) 13665814 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 2170 ( 0.02%) empty read pairs filtered out after trimming by size control 13663621 (99.98%) read pairs available; of these: 1600669 (11.71%) trimmed read pairs available after processing 12062952 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 3 0.00% 27 0 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 0 0.00% 37 2 0.00% 38 3 0.00% 39 7 0.00% 40 5 0.00% 41 4 0.00% 42 5 0.00% 43 9 0.00% 44 13 0.00% 45 8 0.00% 46 9 0.00% 47 10 0.00% 48 11 0.00% 49 15 0.00% 50 27 0.00% 51 26 0.00% 52 22 0.00% 53 37 0.00% 54 36 0.00% 55 43 0.00% 56 56 0.00% 57 62 0.00% 58 68 0.00% 59 69 0.00% 60 91 0.00% 61 114 0.00% 62 132 0.00% 63 152 0.00% 64 173 0.00% 65 201 0.00% 66 221 0.00% 67 265 0.00% 68 286 0.00% 69 331 0.00% 70 377 0.00% 71 467 0.00% 72 529 0.00% 73 653 0.00% 74 709 0.01% 75 923 0.01% 76 963 0.01% 77 1089 0.01% 78 1242 0.01% 79 1442 0.01% 80 1574 0.01% 81 1828 0.01% 82 2084 0.02% 83 2332 0.02% 84 2633 0.02% 85 2921 0.02% 86 3241 0.02% 87 3512 0.03% 88 3820 0.03% 89 4234 0.03% 90 4639 0.03% 91 5194 0.04% 92 5752 0.04% 93 6041 0.04% 94 6759 0.05% 95 7230 0.05% 96 7872 0.06% 97 8194 0.06% 98 8726 0.06% 99 9440 0.07% 100 10129 0.07% 101 10906 0.08% 102 11701 0.09% 103 12366 0.09% 104 12726 0.09% 105 13738 0.10% 106 14606 0.11% 107 15125 0.11% 108 15885 0.12% 109 16136 0.12% 110 16884 0.12% 111 17730 0.13% 112 18410 0.13% 113 19332 0.14% 114 20268 0.15% 115 21364 0.16% 116 21940 0.16% 117 22981 0.17% 118 23252 0.17% 119 23806 0.17% 120 24268 0.18% 121 25588 0.19% 122 26606 0.19% 123 27488 0.20% 124 28313 0.21% 125 29223 0.21% 126 30105 0.22% 127 30905 0.23% 128 31284 0.23% 129 31676 0.23% 130 32668 0.24% 131 33072 0.24% 132 34689 0.25% 133 36063 0.26% 134 36363 0.27% 135 37549 0.27% 136 38383 0.28% 137 39445 0.29% 138 39886 0.29% 139 40475 0.30% 140 40909 0.30% 141 41952 0.31% 142 42745 0.31% 143 43581 0.32% 144 44461 0.33% 145 45966 0.34% 146 46456 0.34% 147 47317 0.35% 148 47579 0.35% 149 48145 0.35% 150 49263 0.36% 151 12062952 88.29% 13663621 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=14 prefix-density=0.46 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=22.93 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.8 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.90 fanout-score-rank=17 prefix-density=0.62 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=25.28 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=4.1 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7171430 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:53:06 Started mapping on | Feb 13 17:53:07 Finished on | Feb 13 17:54:39 Mapping speed, Million of reads per hour | 534.66 Number of input reads | 13663621 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12885759 Uniquely mapped reads % | 94.31% Average mapped length | 295.44 Number of splices: Total | 12566219 Number of splices: Annotated (sjdb) | 12344124 Number of splices: GT/AG | 12369127 Number of splices: GC/AG | 158422 Number of splices: AT/AC | 9045 Number of splices: Non-canonical | 29625 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323571 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 98916 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454291 454291 454291 N_multimapping 323571 323571 323571 N_noFeature 323145 12774916 368027 N_ambiguous 126740 711 60364 UnstrandedReadsAssigned:12435874 PositiveStrandReadsAssigned:110132 NegativeStrandReadsAssigned:12457368 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171430-trimmed-pair1.fastq SRR7171430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,663,621 reads, 12,447,281 reads pseudoaligned [quant] estimated average fragment length: 232.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7171430.ke.tsv 34699 SRR7171430.se.tsv 87100 total ==> SRR7171430.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.26 754 35.6792 Potri.005G024800.1.v4.1 1035 803.255 141 14.8372 Potri.004G059700.1.v4.1 961 729.262 39 4.52031 Potri.007G009000.2.v4.1 1416 1184.26 0 0 Potri.003G141000.2.v4.1 2943 2711.26 505.306 15.7533 Potri.016G087400.1.v4.1 270 83.3592 855 866.962 Potri.015G069301.1.v4.1 564 335.649 0 0 Potri.010G195200.1.v4.1 1773 1541.26 227 12.4491 Potri.012G127500.1.v4.1 977 745.262 1677 190.2 ==> SRR7171430.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 161 SRR7171430 completed mapping pipeline successfully