Starting /dee2/code/volunteer_pipeline.sh SRR7171431 current disk space = 3087864791040 free memory = 1575577124 SRR7171431 SRAfilesize bbb93dc8de553448b8ce078fe7634db1 SRR7171431.sra SRR7171431.sra file validated SRR7171431 is paired end SRR7171431 is conventional basespace SRR7171431 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96125 33.0 33.0 34.0 32.0 34.0 2 33.183 34.0 33.0 34.0 33.0 34.0 3 33.0245 33.0 33.0 34.0 32.0 34.0 4 32.4135 33.0 33.0 33.0 31.0 34.0 5 33.01075 33.0 33.0 34.0 32.0 34.0 6 36.617 38.0 37.0 38.0 34.0 38.0 7 37.20275 38.0 38.0 38.0 36.0 38.0 8 37.3955 38.0 38.0 38.0 37.0 38.0 9 37.51575 38.0 38.0 38.0 37.0 38.0 10-14 37.4868 38.0 38.0 38.0 37.6 38.0 15-19 37.4207 38.0 38.0 38.0 37.6 38.0 20-24 37.567699999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.581149999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.5495 38.0 38.0 38.0 38.0 38.0 35-39 37.4951 38.0 38.0 38.0 38.0 38.0 40-44 37.4005 38.0 38.0 38.0 37.4 38.0 45-49 37.2959 38.0 38.0 38.0 37.0 38.0 50-54 37.164300000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.25 38.0 38.0 38.0 37.0 38.0 60-64 37.251 38.0 38.0 38.0 37.0 38.0 65-69 37.234899999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.23479999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.18175 38.0 38.0 38.0 36.2 38.0 80-84 37.16065 38.0 38.0 38.0 36.2 38.0 85-89 36.93845 38.0 38.0 38.0 35.6 38.0 90-94 36.9377 38.0 38.0 38.0 35.6 38.0 95-99 36.8577 38.0 38.0 38.0 35.0 38.0 100-104 36.8137 38.0 38.0 38.0 35.0 38.0 105-109 36.645050000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.5354 38.0 38.0 38.0 34.0 38.0 115-119 36.43825 38.0 38.0 38.0 34.0 38.0 120-124 36.31025 38.0 37.8 38.0 33.6 38.0 125-129 36.26575 38.0 37.4 38.0 33.6 38.0 130-134 36.074799999999996 38.0 37.0 38.0 33.0 38.0 135-139 35.894400000000005 38.0 36.2 38.0 32.2 38.0 140-144 35.54200000000001 38.0 36.0 38.0 30.4 38.0 145-149 35.326049999999995 38.0 35.6 38.0 30.2 38.0 150-151 32.67 35.5 30.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 2.0 21 1.0 22 2.0 23 3.0 24 5.0 25 9.0 26 10.0 27 17.0 28 21.0 29 28.0 30 32.0 31 41.0 32 49.0 33 102.0 34 126.0 35 208.0 36 497.0 37 2845.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.47298316159839 10.605679819050012 9.625534053782356 37.29580296556924 2 23.125 14.399999999999999 32.475 30.0 3 20.424999999999997 18.5 25.324999999999996 35.75 4 21.125 27.474999999999998 24.525 26.875 5 22.825 31.65 23.849999999999998 21.675 6 18.725 35.725 25.25 20.3 7 14.549999999999999 26.224999999999998 41.625 17.599999999999998 8 17.724999999999998 26.974999999999998 31.775 23.525 9 18.15 25.0 33.275 23.575 10-14 19.725 29.854999999999997 27.26 23.16 15-19 19.865 28.425 27.955000000000002 23.755000000000003 20-24 19.675 28.465 27.900000000000002 23.96 25-29 19.765 29.054999999999996 27.435 23.745 30-34 19.85 28.345 28.07 23.735 35-39 20.4 28.815 27.450000000000003 23.335 40-44 20.09 28.605000000000004 27.800000000000004 23.505000000000003 45-49 20.09 28.155 27.634999999999998 24.12 50-54 20.1 28.095 28.315 23.49 55-59 20.215 28.1 27.83 23.855 60-64 20.645 28.26 26.950000000000003 24.145 65-69 20.34 28.175 27.455000000000002 24.03 70-74 20.21 27.939999999999998 28.235 23.615 75-79 20.035 27.76 28.01 24.195 80-84 20.65 27.82 27.21 24.32 85-89 20.275000000000002 27.905 27.91 23.91 90-94 20.330000000000002 28.07 27.58 24.02 95-99 20.294999999999998 28.335 27.505000000000003 23.865 100-104 20.315 27.99 27.36 24.335 105-109 20.095 27.994999999999997 28.02 23.89 110-114 20.635 28.125 27.395000000000003 23.845 115-119 20.68 28.565 26.889999999999997 23.865 120-124 20.595 27.985 27.195000000000004 24.224999999999998 125-129 21.21 28.16 26.974999999999998 23.655 130-134 21.125 28.355000000000004 26.395000000000003 24.125 135-139 21.495 27.839999999999996 26.515 24.15 140-144 20.810000000000002 28.225 26.640000000000004 24.325 145-149 20.830000000000002 27.925 26.615 24.63 150-151 21.2 28.7 25.575 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 1.5 21 2.0 22 1.0 23 1.5 24 1.0 25 2.0 26 3.5 27 5.5 28 10.5 29 10.0 30 13.0 31 24.5 32 34.0 33 39.5 34 43.0 35 56.5 36 74.5 37 98.5 38 130.0 39 157.5 40 187.5 41 218.0 42 240.5 43 258.0 44 267.0 45 277.5 46 280.5 47 267.0 48 236.5 49 201.5 50 174.0 51 149.5 52 118.0 53 94.0 54 75.0 55 57.0 56 49.0 57 32.0 58 25.5 59 19.0 60 11.0 61 12.5 62 11.0 63 5.5 64 3.0 65 2.5 66 2.5 67 4.0 68 2.5 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.5374999999999996 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 5.237500000000001 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.175000000000001 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.275 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCAG 10 0.006830828 145.0 7 TCGGCGA 10 0.006830828 145.0 145 TCAGCCT 10 0.006830828 145.0 8 >>END_MODULE SRR7171431 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05275 33.0 33.0 34.0 32.0 34.0 2 33.0945 34.0 33.0 34.0 33.0 34.0 3 33.14125 34.0 33.0 34.0 33.0 34.0 4 33.05125 34.0 33.0 34.0 33.0 34.0 5 33.07675 34.0 33.0 34.0 33.0 34.0 6 37.21825 38.0 38.0 38.0 37.0 38.0 7 37.2615 38.0 38.0 38.0 37.0 38.0 8 37.26925 38.0 38.0 38.0 38.0 38.0 9 37.163 38.0 38.0 38.0 37.0 38.0 10-14 37.1299 38.0 38.0 38.0 37.0 38.0 15-19 37.15415 38.0 38.0 38.0 37.0 38.0 20-24 37.19345 38.0 38.0 38.0 37.0 38.0 25-29 37.18725 38.0 38.0 38.0 37.0 38.0 30-34 37.146550000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.19945 38.0 38.0 38.0 37.0 38.0 40-44 37.14475 38.0 38.0 38.0 37.0 38.0 45-49 37.07430000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.047900000000006 38.0 38.0 38.0 36.6 38.0 55-59 36.96145 38.0 38.0 38.0 36.0 38.0 60-64 36.97855 38.0 38.0 38.0 36.0 38.0 65-69 36.97305 38.0 38.0 38.0 36.0 38.0 70-74 36.932 38.0 38.0 38.0 36.0 38.0 75-79 36.9265 38.0 38.0 38.0 36.0 38.0 80-84 36.938599999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.83155000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.7053 38.0 38.0 38.0 35.0 38.0 95-99 36.66955 38.0 38.0 38.0 35.0 38.0 100-104 36.58995 38.0 38.0 38.0 35.0 38.0 105-109 36.4633 38.0 38.0 38.0 34.2 38.0 110-114 36.3542 38.0 38.0 38.0 34.0 38.0 115-119 36.159800000000004 38.0 38.0 38.0 33.2 38.0 120-124 36.12335 38.0 38.0 38.0 33.0 38.0 125-129 35.98475 38.0 37.2 38.0 32.8 38.0 130-134 35.89784999999999 38.0 36.8 38.0 32.2 38.0 135-139 35.5253 38.0 36.2 38.0 31.0 38.0 140-144 35.195550000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.833099999999995 38.0 34.8 38.0 27.0 38.0 150-151 32.15675 35.5 28.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 11.0 18 10.0 19 10.0 20 7.0 21 6.0 22 8.0 23 8.0 24 10.0 25 9.0 26 14.0 27 27.0 28 23.0 29 27.0 30 39.0 31 38.0 32 44.0 33 79.0 34 113.0 35 213.0 36 451.0 37 2847.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 20.4 13.850000000000001 25.974999999999998 2 25.93148287071768 27.28182045511378 29.207301825456366 17.57939484871218 3 22.030507626906726 29.732433108277068 28.532133033258315 19.70492623155789 4 23.775 34.675 23.075000000000003 18.475 5 25.03125781445361 34.90872718179545 22.030507626906726 18.02950737684421 6 20.410205102551277 37.5687843921961 24.212106053026513 17.808904452226113 7 20.36018009004502 22.411205602801402 36.99349674837419 20.23511755877939 8 22.736368184092047 26.28814407203602 26.3631815907954 24.61230615307654 9 21.935967983991997 25.337668834417208 29.189594797398698 23.536768384192097 10-14 24.040626407164655 29.09891429429129 25.381497973682894 21.47896132486116 15-19 23.738991192954366 28.047437950360287 27.446957566052845 20.766613290632506 20-24 23.537945870228626 28.53069188053429 27.229976487067887 20.701385762169195 25-29 23.573250637723202 28.3149102185765 27.114490071525033 20.99734907217526 30-34 23.72237223722372 28.007800780078007 27.29272927292729 20.977097709770977 35-39 23.656182809140457 27.58137906895345 27.66638331916596 21.096054802740134 40-44 24.013404691642073 27.784724653628768 27.389586355224328 20.812284299504828 45-49 23.675389002851855 28.31340371241307 27.287737029068893 20.723470255666182 50-54 23.443755004003204 28.3626901521217 27.34187349879904 20.851681345076063 55-59 23.93034078967122 28.16393934844618 27.818645848971624 20.087074012910975 60-64 23.819055244195354 27.787229783827062 27.862289831865496 20.531425140112088 65-69 23.59415649389634 27.32139283570142 28.266960176105666 20.817490494296578 70-74 23.83357503625544 27.71915787368105 27.729159373906086 20.718107716157423 75-79 24.15 28.084999999999997 27.139999999999997 20.625 80-84 24.240000000000002 27.744999999999997 27.555000000000003 20.46 85-89 24.0248049609922 28.025605121024206 27.2004400880176 20.749149829965994 90-94 23.6853955070796 28.16830940111072 27.302746785410513 20.84354830639916 95-99 24.214214214214213 27.482482482482485 27.112112112112115 21.19119119119119 100-104 24.056462108319153 28.386224847332066 27.25998598458304 20.297327059765742 105-109 24.021227595874635 27.976369280064084 27.670972263943128 20.331430860118154 110-114 24.297802032744205 28.23311470485155 26.876282982025735 20.592800280378512 115-119 24.414297156587907 28.3490188225871 27.392871445734883 19.84381257509011 120-124 24.888644212001402 27.816425604324106 27.451078524598366 19.843851659076122 125-129 24.268347591175147 27.94036720196108 27.70523788083446 20.086047326029316 130-134 25.44272136068034 27.49374687343672 26.768384192096047 20.295147573786892 135-139 24.806085172396536 28.203973377370765 26.89786318370615 20.09207826652655 140-144 26.103935115650344 27.22539301091419 26.985080604786223 19.685591268649244 145-149 25.778824000801364 27.737153160372635 26.915756786537116 19.56826605228889 150-151 26.164829659318638 27.85571142284569 26.377755511022045 19.601703406813627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 0.0 26 0.5 27 2.0 28 4.0 29 8.5 30 9.5 31 9.0 32 14.5 33 30.5 34 46.5 35 51.0 36 55.5 37 85.0 38 132.0 39 164.0 40 200.5 41 236.0 42 260.0 43 275.0 44 293.0 45 290.5 46 273.5 47 255.5 48 217.0 49 191.5 50 175.5 51 157.0 52 129.0 53 103.0 54 84.0 55 58.5 56 45.0 57 36.5 58 24.5 59 21.0 60 12.0 61 6.0 62 7.0 63 6.0 64 5.5 65 3.5 66 1.5 67 1.5 68 1.0 69 0.5 70 1.0 71 1.5 72 2.0 73 1.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.0 5 0.025 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.065 15-19 0.08 20-24 0.055 25-29 0.034999999999999996 30-34 0.01 35-39 0.005 40-44 0.034999999999999996 45-49 0.065 50-54 0.08 55-59 0.08499999999999999 60-64 0.08 65-69 0.06 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.065 95-99 0.1 100-104 0.11 105-109 0.13 110-114 0.135 115-119 0.12 120-124 0.095 125-129 0.055 130-134 0.05 135-139 0.08499999999999999 140-144 0.13 145-149 0.16999999999999998 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863125 spots for SRR7171431.sra Written 863125 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra Read 863112 spots for SRR7171431.sra Written 863112 spots for SRR7171431.sra SRR ids: ['SRR7171431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7pqqaqmo SRR7171431.sra spots: 17262253 blocks: [[1, 863112], [863113, 1726224], [1726225, 2589336], [2589337, 3452448], [3452449, 4315560], [4315561, 5178672], [5178673, 6041784], [6041785, 6904896], [6904897, 7768008], [7768009, 8631120], [8631121, 9494232], [9494233, 10357344], [10357345, 11220456], [11220457, 12083568], [12083569, 12946680], [12946681, 13809792], [13809793, 14672904], [14672905, 15536016], [15536017, 16399128], [16399129, 17262253]] SRR7171431 file size 5827910 SRR7171431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171431 SRR7171431_1.fastq SRR7171431_2.fastq Input file: SRR7171431_1.fastq Paired file: SRR7171431_2.fastq trimmed: SRR7171431-trimmed-pair1.fastq, SRR7171431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:34:31 2025 >> started Thu Feb 13 18:34:49 2025 >> done (18.285s) 17262253 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 1085 ( 0.01%) empty read pairs filtered out after trimming by size control 17261041 (99.99%) read pairs available; of these: 2330015 (13.50%) trimmed read pairs available after processing 14931026 (86.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 1 0.00% 25 6 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 1 0.00% 34 4 0.00% 35 1 0.00% 36 0 0.00% 37 2 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 4 0.00% 43 3 0.00% 44 5 0.00% 45 10 0.00% 46 5 0.00% 47 9 0.00% 48 9 0.00% 49 15 0.00% 50 17 0.00% 51 27 0.00% 52 24 0.00% 53 33 0.00% 54 25 0.00% 55 35 0.00% 56 40 0.00% 57 54 0.00% 58 57 0.00% 59 52 0.00% 60 79 0.00% 61 99 0.00% 62 118 0.00% 63 126 0.00% 64 134 0.00% 65 154 0.00% 66 187 0.00% 67 223 0.00% 68 248 0.00% 69 270 0.00% 70 419 0.00% 71 476 0.00% 72 522 0.00% 73 683 0.00% 74 677 0.00% 75 817 0.00% 76 967 0.01% 77 1073 0.01% 78 1200 0.01% 79 1450 0.01% 80 1693 0.01% 81 1855 0.01% 82 2190 0.01% 83 2499 0.01% 84 2895 0.02% 85 3228 0.02% 86 3589 0.02% 87 4140 0.02% 88 4277 0.02% 89 4812 0.03% 90 5291 0.03% 91 5923 0.03% 92 6628 0.04% 93 7474 0.04% 94 8038 0.05% 95 9084 0.05% 96 9859 0.06% 97 10469 0.06% 98 10994 0.06% 99 11903 0.07% 100 12849 0.07% 101 13581 0.08% 102 15078 0.09% 103 16301 0.09% 104 17091 0.10% 105 18367 0.11% 106 19985 0.12% 107 20394 0.12% 108 21318 0.12% 109 22049 0.13% 110 23075 0.13% 111 24437 0.14% 112 25706 0.15% 113 27156 0.16% 114 28601 0.17% 115 30221 0.18% 116 32113 0.19% 117 34599 0.20% 118 36100 0.21% 119 36768 0.21% 120 36112 0.21% 121 36958 0.21% 122 38292 0.22% 123 39774 0.23% 124 42027 0.24% 125 43016 0.25% 126 44320 0.26% 127 45867 0.27% 128 46091 0.27% 129 47289 0.27% 130 47892 0.28% 131 49570 0.29% 132 51325 0.30% 133 52447 0.30% 134 54215 0.31% 135 55763 0.32% 136 57432 0.33% 137 58333 0.34% 138 58825 0.34% 139 60591 0.35% 140 61576 0.36% 141 63971 0.37% 142 65169 0.38% 143 68729 0.40% 144 70382 0.41% 145 71417 0.41% 146 69181 0.40% 147 70677 0.41% 148 72623 0.42% 149 72224 0.42% 150 74911 0.43% 151 14931026 86.50% 17261041 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=22 prefix-density=0.62 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=33.32 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.0 sequence=TTCCCCTCTTCGGCCTTCAAAGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGGCGCGGCTCAACGAAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCCGATAGAACTCGCA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=3.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=37.50 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171431 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:35:37 Started mapping on | Feb 13 18:35:37 Finished on | Feb 13 18:37:54 Mapping speed, Million of reads per hour | 453.57 Number of input reads | 17261041 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15858609 Uniquely mapped reads % | 91.88% Average mapped length | 294.83 Number of splices: Total | 15578600 Number of splices: Annotated (sjdb) | 15278529 Number of splices: GT/AG | 15336921 Number of splices: GC/AG | 190557 Number of splices: AT/AC | 11932 Number of splices: Non-canonical | 39190 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380255 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 194462 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1022177 1022177 1022177 N_multimapping 380255 380255 380255 N_noFeature 393064 15712055 448448 N_ambiguous 168886 1068 77074 UnstrandedReadsAssigned:15296659 PositiveStrandReadsAssigned:145486 NegativeStrandReadsAssigned:15333087 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171431-trimmed-pair1.fastq SRR7171431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,261,041 reads, 15,486,082 reads pseudoaligned [quant] estimated average fragment length: 223.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7171431.ke.tsv 34699 SRR7171431.se.tsv 87100 total ==> SRR7171431.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.32 1300 41.88 Potri.005G024800.1.v4.1 1035 812.324 959 68.2803 Potri.004G059700.1.v4.1 961 738.334 22 1.72336 Potri.007G009000.2.v4.1 1416 1193.32 0 0 Potri.003G141000.2.v4.1 2943 2720.32 801 17.0301 Potri.016G087400.1.v4.1 270 84.9306 1384.6 942.902 Potri.015G069301.1.v4.1 564 343.574 0 0 Potri.010G195200.1.v4.1 1773 1550.32 337 12.5723 Potri.012G127500.1.v4.1 977 754.334 5524 423.541 ==> SRR7171431.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 497 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 148 SRR7171431 completed mapping pipeline successfully