Starting /dee2/code/volunteer_pipeline.sh SRR7171432 current disk space = 3117473177600 free memory = 1582051204 SRR7171432 SRAfilesize 23411601c7b31d27888b4bca294d92bb SRR7171432.sra SRR7171432.sra file validated SRR7171432 is paired end SRR7171432 is conventional basespace SRR7171432 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.05175 18.0 18.0 33.0 18.0 33.0 2 27.1265 28.0 25.0 31.0 18.0 33.0 3 31.13475 32.0 32.0 33.0 27.0 33.0 4 30.815 32.0 31.0 33.0 27.0 33.0 5 31.9 33.0 32.0 33.0 30.0 33.0 6 36.547 38.0 37.0 38.0 34.0 38.0 7 37.196 38.0 38.0 38.0 36.0 38.0 8 37.38 38.0 38.0 38.0 37.0 38.0 9 37.4485 38.0 38.0 38.0 37.0 38.0 10-14 37.450900000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.43965000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.45435 38.0 38.0 38.0 37.2 38.0 25-29 37.44965 38.0 38.0 38.0 37.2 38.0 30-34 37.43915 38.0 38.0 38.0 37.0 38.0 35-39 37.374550000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.3732 38.0 38.0 38.0 37.0 38.0 45-49 37.3799 38.0 38.0 38.0 37.0 38.0 50-54 37.351350000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.224000000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.164 38.0 38.0 38.0 36.0 38.0 65-69 37.08205 38.0 38.0 38.0 36.0 38.0 70-74 37.0548 38.0 38.0 38.0 36.0 38.0 75-79 36.994 38.0 38.0 38.0 36.0 38.0 80-84 37.01925 38.0 38.0 38.0 36.0 38.0 85-89 36.9944 38.0 38.0 38.0 36.0 38.0 90-94 37.00405 38.0 38.0 38.0 36.0 38.0 95-99 36.72115 38.0 38.0 38.0 34.6 38.0 100-104 36.581649999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.6219 38.0 38.0 38.0 34.0 38.0 110-114 36.62425 38.0 38.0 38.0 34.2 38.0 115-119 36.5285 38.0 38.0 38.0 34.0 38.0 120-124 36.462450000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.3311 38.0 38.0 38.0 33.6 38.0 130-134 36.24175 38.0 37.4 38.0 33.6 38.0 135-139 36.0998 38.0 36.6 38.0 33.0 38.0 140-144 35.9478 38.0 36.0 38.0 33.0 38.0 145-149 35.68205 38.0 36.0 38.0 31.2 38.0 150-151 33.8135 37.0 33.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.0 24 4.0 25 8.0 26 13.0 27 13.0 28 16.0 29 35.0 30 41.0 31 48.0 32 60.0 33 107.0 34 128.0 35 234.0 36 574.0 37 2713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.01913393756294 9.969788519637463 10.8257804632427 37.185297079556904 2 24.125 12.575 33.975 29.325000000000003 3 20.599999999999998 18.05 24.675 36.675000000000004 4 25.55 23.875 23.825 26.75 5 24.075 29.175 25.3 21.45 6 20.625 33.375 24.725 21.275 7 15.275 25.7 41.199999999999996 17.825 8 18.025 26.200000000000003 32.25 23.525 9 17.625 23.724999999999998 35.075 23.575 10-14 20.075000000000003 28.935 27.884999999999998 23.105 15-19 20.13 28.43 27.58 23.86 20-24 19.63 27.644999999999996 28.62 24.104999999999997 25-29 19.939999999999998 28.43 27.985 23.645 30-34 20.31 28.255000000000003 27.555000000000003 23.880000000000003 35-39 20.255000000000003 28.77 26.995 23.98 40-44 20.525 28.155 27.575 23.745 45-49 20.025000000000002 28.060000000000002 27.534999999999997 24.38 50-54 20.13 27.935 27.715 24.22 55-59 19.955000000000002 28.660000000000004 27.415 23.97 60-64 20.330000000000002 28.275 27.655 23.74 65-69 20.18 28.595 27.13 24.095 70-74 19.830000000000002 28.194999999999997 27.71 24.265 75-79 20.915 27.515 27.750000000000004 23.82 80-84 20.195 28.13 27.675 24.0 85-89 20.395 27.61 27.685 24.310000000000002 90-94 20.674999999999997 28.000000000000004 27.46 23.865 95-99 20.565 27.855 27.200000000000003 24.38 100-104 20.915 27.35 27.744999999999997 23.990000000000002 105-109 20.375 27.800000000000004 27.994999999999997 23.830000000000002 110-114 20.77 27.860000000000003 27.725 23.645 115-119 20.435 28.360000000000003 27.35 23.855 120-124 21.25 27.994999999999997 27.04 23.715 125-129 21.115000000000002 27.450000000000003 27.435 24.0 130-134 20.990000000000002 28.365000000000002 26.540000000000003 24.104999999999997 135-139 20.905 27.810000000000002 27.04 24.245 140-144 21.09 27.79 26.939999999999998 24.18 145-149 20.815 27.675 27.315 24.195 150-151 20.9375 27.762500000000003 26.075 25.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 1.5 27 5.5 28 7.0 29 9.0 30 12.0 31 15.5 32 18.0 33 27.5 34 44.0 35 53.0 36 70.5 37 100.0 38 127.5 39 160.0 40 187.0 41 214.5 42 241.5 43 265.5 44 290.0 45 284.5 46 275.0 47 251.5 48 228.0 49 208.5 50 180.5 51 166.5 52 131.0 53 98.0 54 81.0 55 62.0 56 47.5 57 34.0 58 21.5 59 18.5 60 15.0 61 8.0 62 11.0 63 9.5 64 4.0 65 3.0 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.387499999999999 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.2375 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171432 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88075 33.0 33.0 34.0 32.0 34.0 2 32.98825 34.0 33.0 34.0 32.0 34.0 3 32.9655 34.0 33.0 34.0 32.0 34.0 4 32.98475 34.0 33.0 34.0 32.0 34.0 5 32.96175 34.0 33.0 34.0 32.0 34.0 6 36.9935 38.0 38.0 38.0 36.0 38.0 7 37.0385 38.0 38.0 38.0 36.0 38.0 8 37.016 38.0 38.0 38.0 36.0 38.0 9 37.074 38.0 38.0 38.0 36.0 38.0 10-14 37.06375 38.0 38.0 38.0 36.4 38.0 15-19 36.95855 38.0 38.0 38.0 36.0 38.0 20-24 37.01735 38.0 38.0 38.0 36.0 38.0 25-29 37.01535 38.0 38.0 38.0 36.2 38.0 30-34 37.024350000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.9896 38.0 38.0 38.0 36.0 38.0 40-44 36.3741 37.8 37.4 38.0 33.6 38.0 45-49 36.86024999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.8795 38.0 38.0 38.0 36.0 38.0 55-59 36.8469 38.0 38.0 38.0 35.8 38.0 60-64 36.78195 38.0 38.0 38.0 35.2 38.0 65-69 36.8206 38.0 38.0 38.0 35.6 38.0 70-74 36.805049999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.85635 38.0 38.0 38.0 35.2 38.0 80-84 36.7699 38.0 38.0 38.0 35.2 38.0 85-89 36.713 38.0 38.0 38.0 35.0 38.0 90-94 36.504949999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.46755 38.0 38.0 38.0 34.0 38.0 100-104 36.290000000000006 38.0 38.0 38.0 33.6 38.0 105-109 36.2935 38.0 38.0 38.0 34.0 38.0 110-114 36.214749999999995 38.0 38.0 38.0 33.4 38.0 115-119 36.0972 38.0 38.0 38.0 33.2 38.0 120-124 35.976549999999996 38.0 37.6 38.0 32.2 38.0 125-129 35.93729999999999 38.0 37.0 38.0 32.2 38.0 130-134 35.7593 38.0 36.0 38.0 31.0 38.0 135-139 35.5178 38.0 36.0 38.0 30.0 38.0 140-144 35.175799999999995 38.0 35.8 38.0 28.0 38.0 145-149 35.072199999999995 38.0 35.0 38.0 27.8 38.0 150-151 32.49025 35.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 2.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 4.0 19 2.0 20 7.0 21 4.0 22 8.0 23 8.0 24 13.0 25 17.0 26 25.0 27 35.0 28 32.0 29 31.0 30 43.0 31 61.0 32 74.0 33 88.0 34 148.0 35 212.0 36 472.0 37 2705.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.125 19.950000000000003 16.325 27.6 2 25.807259073842303 25.90738423028786 29.561952440550687 18.72340425531915 3 20.85628442663996 28.067100650976464 29.44416624937406 21.632448673009513 4 23.309964947421133 33.29994992488733 23.209814722083124 20.180270405608415 5 23.35419274092616 35.09386733416771 23.829787234042556 17.72215269086358 6 21.824104234527688 36.73264845903282 22.876472062139815 18.566775244299674 7 20.50125313283208 20.676691729323306 37.669172932330824 21.152882205513784 8 21.824104234527688 25.382109746930592 26.609872212478074 26.183913806063643 9 22.525682786269105 25.707842645953395 28.83988975194187 22.92658481583563 10-14 23.075380914194067 29.555934242181237 25.561347233360067 21.807337610264636 15-19 23.120489174017642 28.388131515637532 27.03989574979952 21.45148356054531 20-24 23.443921018342188 28.039490828906484 27.533326651297983 20.98326150145334 25-29 23.522636217948715 28.7109375 26.89803685897436 20.868389423076923 30-34 23.356349444611226 28.394876413489445 27.364154908435907 20.884619233463425 35-39 23.27349102365355 28.324248637295597 27.35410311546732 21.048157223583537 40-44 23.976374011412556 27.83061367504255 26.79947942737011 21.393532886174793 45-49 23.5535741121074 28.15208135049842 27.410709813154337 20.883634724239844 50-54 23.915221966128872 27.99879747469686 27.101914019440827 20.98406653973344 55-59 23.837442373221087 27.93144918821407 27.22489476849068 21.006213670074164 60-64 23.54444333099509 27.658081972141495 27.327387513778934 21.470087183084477 65-69 23.547676282051285 27.498998397435898 27.669270833333332 21.28405448717949 70-74 24.007400740074008 27.972797279727974 27.202720272027204 20.817081708170818 75-79 23.855 27.625 27.765 20.755000000000003 80-84 23.855 28.110000000000003 27.66 20.375 85-89 24.03980796159232 27.340468093618725 27.295459091818365 21.324264852970597 90-94 24.365329728105753 27.57999098693105 27.574983726403286 20.479695558559914 95-99 23.582164328657313 27.53507014028056 28.021042084168336 20.861723446893787 100-104 24.794465610587526 27.190695809103673 27.47643874072589 20.538399839582915 105-109 24.13153541530904 27.63045766705098 27.9011479272144 20.336858990425586 110-114 24.184251415969126 27.928424640368902 27.15653350709238 20.730790436569595 115-119 24.1742268557967 28.259235126058847 27.186607187609646 20.37993083053481 120-124 24.96117817963232 28.066923809046735 26.829634824425185 20.142263186895757 125-129 24.544635708566855 28.98318654923939 26.36108887109688 20.11108887109688 130-134 24.672204984486036 28.04023621259133 26.984285857271544 20.303272945651084 135-139 25.120216389501103 28.185734321779204 26.713083550390703 19.980965738328994 140-144 25.662874041401434 28.10886672347251 26.96105458373014 19.267204651395918 145-149 25.57894736842105 27.62406015037594 26.731829573934835 20.06516290726817 150-151 25.413533834586467 27.355889724310778 27.04260651629073 20.18796992481203 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.0 27 1.5 28 1.5 29 3.5 30 5.0 31 9.0 32 12.0 33 18.0 34 37.0 35 55.5 36 71.0 37 94.0 38 114.5 39 140.5 40 184.5 41 233.0 42 268.5 43 294.5 44 295.0 45 293.0 46 288.0 47 272.5 48 241.0 49 203.5 50 178.5 51 149.5 52 123.0 53 97.0 54 77.0 55 57.5 56 45.0 57 36.5 58 28.5 59 17.0 60 7.5 61 8.0 62 9.5 63 6.5 64 3.5 65 2.0 66 2.0 67 1.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.15 4 0.15 5 0.125 6 0.22499999999999998 7 0.25 8 0.22499999999999998 9 0.22499999999999998 10-14 0.24 15-19 0.24 20-24 0.22999999999999998 25-29 0.16 30-34 0.06999999999999999 35-39 0.015 40-44 0.11 45-49 0.185 50-54 0.21 55-59 0.22 60-64 0.21 65-69 0.16 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.145 95-99 0.2 100-104 0.26 105-109 0.255 110-114 0.245 115-119 0.245 120-124 0.185 125-129 0.08 130-134 0.09 135-139 0.18 140-144 0.245 145-149 0.25 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.32663316582914576 0.65 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 1.9749999999999999 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.9625 0.0 0.0 0.0 0.0 128-129 5.4625 0.0 0.0 0.0 0.0 130-131 6.0875 0.0 0.0 0.0 0.0 132-133 6.637499999999999 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGATC 10 0.006830828 145.0 145 CTCCAGA 10 0.006830828 145.0 1 GTGGATC 10 0.006830828 145.0 7 >>END_MODULE Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872538 spots for SRR7171432.sra Written 872538 spots for SRR7171432.sra Read 872547 spots for SRR7171432.sra Written 872547 spots for SRR7171432.sra SRR ids: ['SRR7171432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0nxs_8o SRR7171432.sra spots: 17450769 blocks: [[1, 872538], [872539, 1745076], [1745077, 2617614], [2617615, 3490152], [3490153, 4362690], [4362691, 5235228], [5235229, 6107766], [6107767, 6980304], [6980305, 7852842], [7852843, 8725380], [8725381, 9597918], [9597919, 10470456], [10470457, 11342994], [11342995, 12215532], [12215533, 13088070], [13088071, 13960608], [13960609, 14833146], [14833147, 15705684], [15705685, 16578222], [16578223, 17450769]] SRR7171432 file size 5891792 SRR7171432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171432 SRR7171432_1.fastq SRR7171432_2.fastq Input file: SRR7171432_1.fastq Paired file: SRR7171432_2.fastq trimmed: SRR7171432-trimmed-pair1.fastq, SRR7171432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:50:26 2025 >> started Fri Feb 14 08:50:46 2025 >> done (19.268s) 17450769 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 978 ( 0.01%) empty read pairs filtered out after trimming by size control 17449767 (99.99%) read pairs available; of these: 2342412 (13.42%) trimmed read pairs available after processing 15107355 (86.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 3 0.00% 34 0 0.00% 35 2 0.00% 36 2 0.00% 37 3 0.00% 38 1 0.00% 39 2 0.00% 40 3 0.00% 41 2 0.00% 42 2 0.00% 43 2 0.00% 44 7 0.00% 45 10 0.00% 46 10 0.00% 47 14 0.00% 48 12 0.00% 49 4 0.00% 50 21 0.00% 51 22 0.00% 52 21 0.00% 53 31 0.00% 54 30 0.00% 55 32 0.00% 56 37 0.00% 57 51 0.00% 58 53 0.00% 59 69 0.00% 60 82 0.00% 61 99 0.00% 62 125 0.00% 63 142 0.00% 64 163 0.00% 65 225 0.00% 66 202 0.00% 67 267 0.00% 68 272 0.00% 69 325 0.00% 70 414 0.00% 71 467 0.00% 72 565 0.00% 73 718 0.00% 74 818 0.00% 75 907 0.01% 76 1057 0.01% 77 1227 0.01% 78 1389 0.01% 79 1651 0.01% 80 1809 0.01% 81 2089 0.01% 82 2380 0.01% 83 2792 0.02% 84 3226 0.02% 85 3458 0.02% 86 3929 0.02% 87 4244 0.02% 88 4707 0.03% 89 5291 0.03% 90 5889 0.03% 91 6601 0.04% 92 7167 0.04% 93 7910 0.05% 94 8829 0.05% 95 9452 0.05% 96 10274 0.06% 97 10962 0.06% 98 11759 0.07% 99 12692 0.07% 100 13606 0.08% 101 14431 0.08% 102 15675 0.09% 103 16833 0.10% 104 17799 0.10% 105 18822 0.11% 106 20130 0.12% 107 20940 0.12% 108 22182 0.13% 109 23242 0.13% 110 24003 0.14% 111 25333 0.15% 112 26332 0.15% 113 27581 0.16% 114 29040 0.17% 115 31029 0.18% 116 32049 0.18% 117 34204 0.20% 118 36223 0.21% 119 35657 0.20% 120 35900 0.21% 121 37419 0.21% 122 38425 0.22% 123 40105 0.23% 124 41898 0.24% 125 42714 0.24% 126 44386 0.25% 127 45080 0.26% 128 46692 0.27% 129 47535 0.27% 130 48941 0.28% 131 49624 0.28% 132 51209 0.29% 133 52775 0.30% 134 54353 0.31% 135 55490 0.32% 136 56744 0.33% 137 58193 0.33% 138 59555 0.34% 139 60377 0.35% 140 61456 0.35% 141 63868 0.37% 142 65742 0.38% 143 64870 0.37% 144 70287 0.40% 145 69753 0.40% 146 67804 0.39% 147 70434 0.40% 148 71302 0.41% 149 71230 0.41% 150 76097 0.44% 151 15107355 86.58% 17449767 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=37.56 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=12.8 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=28 prefix-density=0.49 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=41.63 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.2 sequence=GAGAAGGCAATGAGAGATGC SRR7171432 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:51:32 Started mapping on | Feb 14 08:51:32 Finished on | Feb 14 08:54:18 Mapping speed, Million of reads per hour | 378.43 Number of input reads | 17449767 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15942427 Uniquely mapped reads % | 91.36% Average mapped length | 294.76 Number of splices: Total | 15942506 Number of splices: Annotated (sjdb) | 15658870 Number of splices: GT/AG | 15692187 Number of splices: GC/AG | 197976 Number of splices: AT/AC | 12046 Number of splices: Non-canonical | 40297 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467145 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 161643 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1040195 1040195 1040195 N_multimapping 467145 467145 467145 N_noFeature 339548 15805155 392098 N_ambiguous 157304 1058 71815 UnstrandedReadsAssigned:15445575 PositiveStrandReadsAssigned:136214 NegativeStrandReadsAssigned:15478514 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171432-trimmed-pair1.fastq SRR7171432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,449,767 reads, 15,616,564 reads pseudoaligned [quant] estimated average fragment length: 221.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7171432.ke.tsv 34699 SRR7171432.se.tsv 87100 total ==> SRR7171432.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.06 916 30.2592 Potri.005G024800.1.v4.1 1035 814.062 196 14.293 Potri.004G059700.1.v4.1 961 740.073 32 2.56685 Potri.007G009000.2.v4.1 1416 1195.06 0 0 Potri.003G141000.2.v4.1 2943 2722.06 595.157 12.9795 Potri.016G087400.1.v4.1 270 85.8297 1327 917.821 Potri.015G069301.1.v4.1 564 345.018 0 0 Potri.010G195200.1.v4.1 1773 1552.06 338 12.928 Potri.012G127500.1.v4.1 977 756.073 2813 220.867 ==> SRR7171432.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 353 SRR7171432 completed mapping pipeline successfully