Starting /dee2/code/volunteer_pipeline.sh SRR7171433 current disk space = 3119548866560 free memory = 1460196792 SRR7171433 SRAfilesize bdc91c49bd0748ec1b3fbda7fb6c48cc SRR7171433.sra SRR7171433.sra file validated SRR7171433 is paired end SRR7171433 is conventional basespace SRR7171433 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.4015 18.0 18.0 25.0 18.0 27.0 2 19.72 18.0 18.0 18.0 18.0 27.0 3 25.83225 27.0 25.0 27.0 18.0 32.0 4 28.18025 27.0 27.0 32.0 25.0 32.0 5 31.0355 32.0 32.0 33.0 27.0 33.0 6 35.45375 37.0 35.0 38.0 31.0 38.0 7 36.82 38.0 37.0 38.0 34.0 38.0 8 37.0485 38.0 38.0 38.0 36.0 38.0 9 37.203 38.0 38.0 38.0 36.0 38.0 10-14 37.331999999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.384699999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.449850000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.449 38.0 38.0 38.0 37.4 38.0 30-34 37.46925 38.0 38.0 38.0 38.0 38.0 35-39 37.433800000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.35745 38.0 38.0 38.0 37.0 38.0 45-49 37.2696 38.0 38.0 38.0 37.0 38.0 50-54 37.1648 38.0 38.0 38.0 36.2 38.0 55-59 37.1682 38.0 38.0 38.0 36.4 38.0 60-64 37.2393 38.0 38.0 38.0 36.6 38.0 65-69 37.24785 38.0 38.0 38.0 36.8 38.0 70-74 37.19185 38.0 38.0 38.0 36.0 38.0 75-79 37.0961 38.0 38.0 38.0 36.0 38.0 80-84 37.05465 38.0 38.0 38.0 36.0 38.0 85-89 36.8916 38.0 38.0 38.0 35.6 38.0 90-94 36.868849999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.7403 38.0 38.0 38.0 35.0 38.0 100-104 36.712599999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.6031 38.0 38.0 38.0 34.2 38.0 110-114 36.49095 38.0 38.0 38.0 34.0 38.0 115-119 36.30615 38.0 38.0 38.0 34.0 38.0 120-124 36.20405 38.0 37.4 38.0 33.6 38.0 125-129 36.1315 38.0 37.2 38.0 33.0 38.0 130-134 35.893150000000006 38.0 36.6 38.0 32.2 38.0 135-139 35.6901 38.0 36.0 38.0 30.6 38.0 140-144 35.3416 38.0 35.6 38.0 29.4 38.0 145-149 35.112700000000004 38.0 35.2 38.0 28.8 38.0 150-151 32.47075 35.5 29.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 8.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 4.0 25 9.0 26 11.0 27 18.0 28 22.0 29 29.0 30 39.0 31 47.0 32 77.0 33 88.0 34 170.0 35 297.0 36 828.0 37 2346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 2.5634581553154057 45.41342045740136 7.614978637848706 44.40814274943453 2 6.9 23.875 31.974999999999998 37.25 3 17.8 18.35 24.3 39.550000000000004 4 21.975 24.55 22.45 31.025000000000002 5 23.875 28.599999999999998 24.275 23.25 6 20.575 32.95 25.25 21.224999999999998 7 14.95 26.974999999999998 39.925 18.15 8 18.275 25.324999999999996 30.75 25.650000000000002 9 17.75 24.3 33.025 24.925 10-14 19.67 29.5 27.310000000000002 23.52 15-19 19.695 28.175 27.685 24.445 20-24 19.645000000000003 28.585 27.43 24.34 25-29 19.435 28.42 27.845 24.3 30-34 19.625 28.345 27.46 24.57 35-39 20.1 28.01 27.36 24.529999999999998 40-44 19.825 28.08 27.515 24.58 45-49 19.49 28.73 27.055 24.725 50-54 20.055 27.785 27.63 24.529999999999998 55-59 19.965 27.575 28.055000000000003 24.404999999999998 60-64 19.705000000000002 28.139999999999997 27.735 24.42 65-69 20.375 28.055000000000003 27.98 23.59 70-74 19.99 28.24 27.779999999999998 23.990000000000002 75-79 20.43 28.075 27.155 24.34 80-84 20.285 27.805000000000003 27.805000000000003 24.104999999999997 85-89 20.82 27.810000000000002 27.425 23.945 90-94 20.91 27.169999999999998 27.125 24.795 95-99 20.435 28.060000000000002 27.765 23.74 100-104 20.4 27.860000000000003 27.985 23.755000000000003 105-109 20.4 28.110000000000003 26.965 24.525 110-114 20.695 27.955000000000002 26.895000000000003 24.455 115-119 20.630000000000003 27.515 27.46 24.395 120-124 20.535 27.815 27.42 24.23 125-129 20.77 28.4 26.634999999999998 24.195 130-134 21.6 27.455000000000002 26.924999999999997 24.02 135-139 20.87 27.994999999999997 26.334999999999997 24.8 140-144 21.27 27.634999999999998 26.745 24.349999999999998 145-149 21.404999999999998 27.900000000000002 26.150000000000002 24.545 150-151 21.45 27.8875 26.5125 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 3.0 25 5.0 26 8.0 27 7.5 28 8.5 29 13.5 30 17.5 31 21.0 32 26.0 33 32.0 34 48.5 35 67.0 36 78.5 37 99.0 38 132.0 39 174.5 40 197.0 41 223.5 42 261.0 43 257.0 44 252.0 45 255.0 46 258.5 47 244.0 48 212.5 49 187.0 50 168.5 51 155.5 52 125.0 53 103.5 54 87.0 55 59.0 56 41.5 57 36.5 58 29.5 59 19.5 60 12.0 61 10.0 62 12.5 63 10.0 64 6.0 65 6.0 66 5.0 67 4.0 68 2.5 69 2.0 70 3.0 71 2.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.25 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.3 0.0 0.0 0.0 0.0 124-125 5.949999999999999 0.0 0.0 0.0 0.0 126-127 6.699999999999999 0.0 0.0 0.0 0.0 128-129 7.324999999999999 0.0 0.0 0.0 0.0 130-131 8.05 0.0 0.0 0.0 0.0 132-133 8.6625 0.0 0.0 0.0 0.0 134-135 9.3875 0.0 0.0 0.0 0.0 136-137 10.225 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTTT 10 0.006830828 145.0 3 >>END_MODULE SRR7171433 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9015 33.0 33.0 34.0 32.0 34.0 2 32.95475 34.0 33.0 34.0 32.0 34.0 3 32.99075 34.0 33.0 34.0 32.0 34.0 4 33.02125 34.0 33.0 34.0 32.0 34.0 5 33.02325 34.0 33.0 34.0 32.0 34.0 6 37.01725 38.0 38.0 38.0 37.0 38.0 7 37.02475 38.0 38.0 38.0 37.0 38.0 8 37.09625 38.0 38.0 38.0 37.0 38.0 9 36.99175 38.0 38.0 38.0 37.0 38.0 10-14 36.97795 38.0 38.0 38.0 36.2 38.0 15-19 36.9625 38.0 38.0 38.0 36.6 38.0 20-24 36.97115 38.0 38.0 38.0 36.4 38.0 25-29 37.009699999999995 38.0 38.0 38.0 36.6 38.0 30-34 36.998799999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.950199999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.93085000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.836149999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.7872 38.0 38.0 38.0 35.8 38.0 55-59 36.756449999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.672450000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.69855 38.0 38.0 38.0 35.2 38.0 70-74 36.7099 38.0 38.0 38.0 35.0 38.0 75-79 36.704750000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.659800000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.5793 38.0 38.0 38.0 34.6 38.0 90-94 36.4407 38.0 38.0 38.0 34.2 38.0 95-99 36.3694 38.0 38.0 38.0 34.0 38.0 100-104 36.256299999999996 38.0 38.0 38.0 33.6 38.0 105-109 36.166 38.0 38.0 38.0 33.4 38.0 110-114 36.04585 38.0 38.0 38.0 33.0 38.0 115-119 35.93945000000001 38.0 37.8 38.0 31.8 38.0 120-124 35.80915 38.0 37.6 38.0 31.0 38.0 125-129 35.60345 38.0 36.2 38.0 30.6 38.0 130-134 35.51565 38.0 36.0 38.0 30.0 38.0 135-139 35.101749999999996 38.0 35.4 38.0 27.8 38.0 140-144 34.6728 38.0 34.0 38.0 24.6 38.0 145-149 34.31185 38.0 33.0 38.0 23.8 38.0 150-151 31.77925 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 4.0 16 11.0 17 17.0 18 3.0 19 12.0 20 7.0 21 10.0 22 8.0 23 9.0 24 12.0 25 13.0 26 27.0 27 18.0 28 31.0 29 40.0 30 42.0 31 59.0 32 72.0 33 83.0 34 135.0 35 215.0 36 494.0 37 2676.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.05 20.200000000000003 16.45 28.299999999999997 2 26.55 25.95 29.45 18.05 3 20.525 27.35 30.55 21.575 4 23.775 34.449999999999996 22.825 18.95 5 23.45 36.325 22.325 17.9 6 20.305076269067268 36.33408352088022 24.33108277069267 19.02975743935984 7 19.809904952476238 21.810905452726363 37.81890945472736 20.560280140070038 8 21.785892946473236 25.46273136568284 28.23911955977989 24.512256128064035 9 22.536268134067033 24.487243621810904 29.314657328664335 23.66183091545773 10-14 23.676838419209606 28.23411705852926 26.323161580790394 21.765882941470736 15-19 23.362849567261996 28.350592826054328 26.674671069087996 21.61188653759568 20-24 23.451725862931465 28.034017008504254 27.288644322161083 21.225612806403202 25-29 23.582358235823584 27.88278827882788 27.19271927192719 21.342134213421343 30-34 23.735 27.71 27.725 20.830000000000002 35-39 24.03 27.534999999999997 27.63 20.805 40-44 23.970992748187047 27.981995498874717 27.266816704176044 20.78019504876219 45-49 23.491745872936466 27.94897448724362 27.453726863431715 21.105552776388194 50-54 23.940561364887177 27.462850853054487 27.547906138990342 21.048681643067994 55-59 24.086860802561795 28.15971179825878 27.24907435204643 20.50435304713299 60-64 24.179507704622775 28.111867120272166 26.801080648389032 20.90754452671603 65-69 24.526036716522434 27.882547146215796 27.007153218948527 20.58426291831324 70-74 24.82 27.525 26.99 20.665 75-79 24.035 28.08 27.339999999999996 20.544999999999998 80-84 24.545 27.26 27.49 20.705000000000002 85-89 24.29 27.834999999999997 26.974999999999998 20.9 90-94 24.260917412835774 27.927567405332397 27.157220749337203 20.65429443249462 95-99 24.862403682577806 27.539277494245972 27.409186430501354 20.18913239267487 100-104 24.723542656992745 28.116087065298974 27.150362772079063 20.010007505629222 105-109 24.823617713284964 27.630723042281712 27.215411558669 20.330247685764324 110-114 24.148111083312486 28.066049537152864 27.280460345258945 20.505379034275705 115-119 24.988741556167128 27.975981986489867 27.090317738303725 19.94495871903928 120-124 25.472830981687185 28.55498849194436 26.22335634944461 19.748824176923847 125-129 25.023758315410394 27.9697894262992 27.329565347871753 19.67688691041865 130-134 25.397619285785733 27.698309492847855 26.923076923076923 19.980994298289488 135-139 26.031920748486513 27.437834592485117 26.667333766948513 19.862910892079853 140-144 26.014510883162373 27.440580435326495 27.04028021015762 19.504628471353517 145-149 27.166733386709367 27.451961569255406 26.210968775020017 19.170336269015213 150-151 26.948580007506568 26.898536219191794 26.936069060427876 19.216814712873763 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 1.5 24 2.5 25 2.5 26 2.5 27 2.0 28 4.0 29 9.0 30 12.0 31 17.5 32 22.5 33 22.5 34 32.5 35 45.5 36 61.0 37 88.0 38 119.5 39 165.0 40 195.5 41 204.0 42 220.0 43 262.0 44 308.5 45 307.5 46 277.0 47 252.0 48 222.5 49 196.5 50 184.5 51 153.0 52 115.0 53 94.5 54 79.5 55 64.0 56 46.0 57 40.0 58 39.5 59 27.5 60 15.5 61 12.5 62 16.0 63 14.5 64 9.0 65 6.5 66 2.5 67 2.5 68 4.0 69 3.0 70 3.0 71 1.5 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.055 20-24 0.05 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.025 45-49 0.05 50-54 0.065 55-59 0.06999999999999999 60-64 0.06 65-69 0.045 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.045 95-99 0.06999999999999999 100-104 0.075 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.06999999999999999 125-129 0.034999999999999996 130-134 0.03 135-139 0.065 140-144 0.075 145-149 0.08 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.7 0.0 0.0 0.0 0.0 122-123 5.2875 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.675000000000001 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 10.175 0.0 0.0 0.0 0.0 138-139 10.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTAC 10 0.006830828 145.0 7 TTTTTTT 40 0.0076550315 18.125 115-119 >>END_MODULE Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600848 spots for SRR7171433.sra Written 600848 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra Read 600844 spots for SRR7171433.sra Written 600844 spots for SRR7171433.sra SRR ids: ['SRR7171433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__wfn51mk SRR7171433.sra spots: 12016884 blocks: [[1, 600844], [600845, 1201688], [1201689, 1802532], [1802533, 2403376], [2403377, 3004220], [3004221, 3605064], [3605065, 4205908], [4205909, 4806752], [4806753, 5407596], [5407597, 6008440], [6008441, 6609284], [6609285, 7210128], [7210129, 7810972], [7810973, 8411816], [8411817, 9012660], [9012661, 9613504], [9613505, 10214348], [10214349, 10815192], [10815193, 11416036], [11416037, 12016884]] SRR7171433 file size 4050427 SRR7171433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171433 SRR7171433_1.fastq SRR7171433_2.fastq Input file: SRR7171433_1.fastq Paired file: SRR7171433_2.fastq trimmed: SRR7171433-trimmed-pair1.fastq, SRR7171433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:30:47 2025 >> started Fri Feb 14 07:31:02 2025 >> done (14.453s) 12016884 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 1731 ( 0.01%) empty read pairs filtered out after trimming by size control 12015057 (99.98%) read pairs available; of these: 1895917 (15.78%) trimmed read pairs available after processing 10119140 (84.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 3 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 1 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 7 0.00% 42 6 0.00% 43 4 0.00% 44 4 0.00% 45 9 0.00% 46 10 0.00% 47 13 0.00% 48 8 0.00% 49 12 0.00% 50 18 0.00% 51 12 0.00% 52 25 0.00% 53 27 0.00% 54 27 0.00% 55 37 0.00% 56 42 0.00% 57 53 0.00% 58 73 0.00% 59 72 0.00% 60 85 0.00% 61 103 0.00% 62 124 0.00% 63 127 0.00% 64 166 0.00% 65 195 0.00% 66 242 0.00% 67 291 0.00% 68 291 0.00% 69 343 0.00% 70 495 0.00% 71 534 0.00% 72 613 0.01% 73 746 0.01% 74 804 0.01% 75 927 0.01% 76 1075 0.01% 77 1252 0.01% 78 1400 0.01% 79 1684 0.01% 80 1924 0.02% 81 2140 0.02% 82 2444 0.02% 83 2768 0.02% 84 3215 0.03% 85 3538 0.03% 86 3954 0.03% 87 4451 0.04% 88 4882 0.04% 89 5274 0.04% 90 5754 0.05% 91 6281 0.05% 92 7122 0.06% 93 7797 0.06% 94 8555 0.07% 95 9449 0.08% 96 9781 0.08% 97 10728 0.09% 98 11195 0.09% 99 11858 0.10% 100 12695 0.11% 101 13362 0.11% 102 14415 0.12% 103 15257 0.13% 104 16246 0.14% 105 17232 0.14% 106 18101 0.15% 107 18855 0.16% 108 19775 0.16% 109 20168 0.17% 110 21039 0.18% 111 21807 0.18% 112 22812 0.19% 113 23834 0.20% 114 24993 0.21% 115 25980 0.22% 116 27498 0.23% 117 28898 0.24% 118 30198 0.25% 119 30358 0.25% 120 30274 0.25% 121 30631 0.25% 122 31925 0.27% 123 32911 0.27% 124 33999 0.28% 125 35073 0.29% 126 36496 0.30% 127 36991 0.31% 128 37720 0.31% 129 38442 0.32% 130 39422 0.33% 131 39214 0.33% 132 40615 0.34% 133 41388 0.34% 134 42200 0.35% 135 43655 0.36% 136 44335 0.37% 137 45378 0.38% 138 45821 0.38% 139 46294 0.39% 140 46855 0.39% 141 48230 0.40% 142 49115 0.41% 143 51323 0.43% 144 51739 0.43% 145 52665 0.44% 146 51562 0.43% 147 52390 0.44% 148 53117 0.44% 149 52714 0.44% 150 54802 0.46% 151 10119140 84.22% 12015057 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=18 prefix-density=0.66 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=22.20 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.9 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=24 prefix-density=0.58 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=29.07 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.9 sequence=GAGAAGGCAATGAGAGATGC SRR7171433 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:31:53 Started mapping on | Feb 14 07:31:53 Finished on | Feb 14 07:34:53 Mapping speed, Million of reads per hour | 240.30 Number of input reads | 12015057 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10471834 Uniquely mapped reads % | 87.16% Average mapped length | 293.22 Number of splices: Total | 10151539 Number of splices: Annotated (sjdb) | 9968518 Number of splices: GT/AG | 9985744 Number of splices: GC/AG | 130949 Number of splices: AT/AC | 7988 Number of splices: Non-canonical | 26858 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328690 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 85688 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.11% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1214533 1214533 1214533 N_multimapping 328690 328690 328690 N_noFeature 241959 10380920 280376 N_ambiguous 106856 512 54017 UnstrandedReadsAssigned:10123019 PositiveStrandReadsAssigned:90402 NegativeStrandReadsAssigned:10137441 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171433-trimmed-pair1.fastq SRR7171433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,015,057 reads, 10,251,360 reads pseudoaligned [quant] estimated average fragment length: 221.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7171433.ke.tsv 34699 SRR7171433.se.tsv 87100 total ==> SRR7171433.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.53 1063 55.4994 Potri.005G024800.1.v4.1 1035 814.535 163 18.7806 Potri.004G059700.1.v4.1 961 740.551 11 1.39402 Potri.007G009000.2.v4.1 1416 1195.53 0 0 Potri.003G141000.2.v4.1 2943 2722.53 334.154 11.5187 Potri.016G087400.1.v4.1 270 89.1448 725 763.263 Potri.015G069301.1.v4.1 564 346.406 0 0 Potri.010G195200.1.v4.1 1773 1552.53 757.91 45.8152 Potri.012G127500.1.v4.1 977 756.546 5886 730.16 ==> SRR7171433.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 171 SRR7171433 completed mapping pipeline successfully