Starting /dee2/code/volunteer_pipeline.sh SRR7171434 current disk space = 3117245161472 free memory = 1572948544 SRR7171434 SRAfilesize b35b8a429211c1dde4356b5ffdcddf14 SRR7171434.sra SRR7171434.sra file validated SRR7171434 is paired end SRR7171434 is conventional basespace SRR7171434 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.3335 18.0 18.0 18.0 18.0 18.0 2 21.62175 18.0 18.0 27.0 18.0 30.0 3 25.1975 27.0 18.0 29.0 18.0 31.0 4 30.0445 32.0 27.0 32.0 27.0 33.0 5 31.94375 33.0 32.0 33.0 32.0 33.0 6 36.229 37.0 36.0 38.0 34.0 38.0 7 36.91025 38.0 37.0 38.0 35.0 38.0 8 37.17025 38.0 38.0 38.0 36.0 38.0 9 37.26275 38.0 38.0 38.0 36.0 38.0 10-14 37.46395 38.0 38.0 38.0 37.0 38.0 15-19 37.52295 38.0 38.0 38.0 37.0 38.0 20-24 37.5247 38.0 38.0 38.0 37.4 38.0 25-29 37.46875 38.0 38.0 38.0 37.0 38.0 30-34 37.5159 38.0 38.0 38.0 37.2 38.0 35-39 37.4823 38.0 38.0 38.0 37.0 38.0 40-44 37.45385 38.0 38.0 38.0 37.0 38.0 45-49 37.403200000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.3466 38.0 38.0 38.0 37.0 38.0 55-59 37.2813 38.0 38.0 38.0 36.8 38.0 60-64 37.281150000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.2173 38.0 38.0 38.0 36.2 38.0 70-74 37.19665 38.0 38.0 38.0 36.0 38.0 75-79 37.174 38.0 38.0 38.0 36.0 38.0 80-84 37.0788 38.0 38.0 38.0 36.0 38.0 85-89 37.00235 38.0 38.0 38.0 36.0 38.0 90-94 36.963300000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.771550000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.687799999999996 38.0 38.0 38.0 34.4 38.0 105-109 36.6558 38.0 38.0 38.0 34.4 38.0 110-114 36.58540000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.4234 38.0 37.6 38.0 34.0 38.0 120-124 36.31795 38.0 37.4 38.0 34.0 38.0 125-129 36.16585 38.0 37.0 38.0 33.2 38.0 130-134 36.03545 38.0 36.6 38.0 32.6 38.0 135-139 35.921049999999994 38.0 36.0 38.0 32.2 38.0 140-144 35.7001 38.0 36.0 38.0 31.4 38.0 145-149 35.37965 38.0 35.4 38.0 30.6 38.0 150-151 33.464 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 0.0 23 0.0 24 5.0 25 4.0 26 9.0 27 11.0 28 17.0 29 26.0 30 40.0 31 43.0 32 62.0 33 101.0 34 151.0 35 268.0 36 903.0 37 2356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.29928928665438 6.0015793629902605 14.661753092919188 42.03737825743617 2 20.849999999999998 10.299999999999999 39.825 29.025000000000002 3 21.0 17.075000000000003 26.400000000000002 35.525 4 24.425 25.7 22.575 27.3 5 24.3 30.275000000000002 24.725 20.7 6 18.9 36.7 24.099999999999998 20.3 7 13.5 26.5 41.825 18.175 8 17.299999999999997 25.924999999999997 31.7 25.074999999999996 9 17.125 24.525 34.150000000000006 24.2 10-14 19.6 30.415 27.515 22.470000000000002 15-19 19.865 28.299999999999997 28.294999999999998 23.54 20-24 19.56 29.54 27.325 23.575 25-29 19.470000000000002 29.28 27.994999999999997 23.255 30-34 20.305 28.134999999999998 28.050000000000004 23.51 35-39 20.03 28.95 27.22 23.799999999999997 40-44 19.725 28.599999999999998 28.005000000000003 23.669999999999998 45-49 20.294999999999998 28.71 27.589999999999996 23.405 50-54 20.349999999999998 28.28 27.750000000000004 23.62 55-59 20.22 28.77 27.63 23.380000000000003 60-64 19.919999999999998 28.720000000000002 27.544999999999998 23.815 65-69 20.34 28.615000000000002 27.639999999999997 23.405 70-74 20.085 28.749999999999996 27.169999999999998 23.995 75-79 20.3 28.595 27.49 23.615 80-84 20.055 28.970000000000002 27.279999999999998 23.695 85-89 19.925 28.685 27.474999999999998 23.915 90-94 20.54 28.660000000000004 27.075 23.724999999999998 95-99 20.535 28.34 27.944999999999997 23.18 100-104 20.25 29.035 27.01 23.705000000000002 105-109 20.415 28.349999999999998 28.02 23.215 110-114 20.74 28.395 27.339999999999996 23.525 115-119 20.61 29.035 26.745 23.61 120-124 20.84 28.285 27.13 23.745 125-129 20.064999999999998 28.215 27.555000000000003 24.165 130-134 20.31 28.185 27.794999999999998 23.71 135-139 20.835 28.03 27.26 23.875 140-144 20.424999999999997 28.74 26.87 23.965 145-149 20.385 29.189999999999998 26.745 23.68 150-151 20.302537817227154 28.041005125640705 27.00337542192774 24.6530816352044 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 4.5 27 6.0 28 8.0 29 8.5 30 12.0 31 23.5 32 30.5 33 38.0 34 54.0 35 66.0 36 82.5 37 109.5 38 138.0 39 178.0 40 211.0 41 222.0 42 240.5 43 274.0 44 289.0 45 277.5 46 264.5 47 254.5 48 237.0 49 208.5 50 172.5 51 136.0 52 108.0 53 93.5 54 72.0 55 44.0 56 36.5 57 28.5 58 15.0 59 14.0 60 11.5 61 6.0 62 6.0 63 4.0 64 2.5 65 1.5 66 2.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.4000000000000004 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.825 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTATAT 10 0.006843168 144.91249 7 AAAAAAA 195 3.0674125E-4 8.174551 20-24 >>END_MODULE SRR7171434 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9925 33.0 33.0 34.0 32.0 34.0 2 33.11075 34.0 33.0 34.0 33.0 34.0 3 33.18725 34.0 33.0 34.0 33.0 34.0 4 33.122 34.0 33.0 34.0 33.0 34.0 5 33.0375 34.0 33.0 34.0 32.0 34.0 6 37.2885 38.0 38.0 38.0 37.0 38.0 7 37.418 38.0 38.0 38.0 37.0 38.0 8 37.37375 38.0 38.0 38.0 37.0 38.0 9 37.306 38.0 38.0 38.0 37.0 38.0 10-14 37.2448 38.0 38.0 38.0 37.0 38.0 15-19 37.29885 38.0 38.0 38.0 37.0 38.0 20-24 37.2958 38.0 38.0 38.0 37.0 38.0 25-29 37.27295 38.0 38.0 38.0 37.0 38.0 30-34 37.2231 38.0 38.0 38.0 37.0 38.0 35-39 37.19065 38.0 38.0 38.0 36.8 38.0 40-44 37.16125 38.0 38.0 38.0 36.4 38.0 45-49 37.1308 38.0 38.0 38.0 36.0 38.0 50-54 37.05755 38.0 38.0 38.0 36.0 38.0 55-59 37.029399999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.973349999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.95065000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.917500000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.8046 38.0 38.0 38.0 35.2 38.0 80-84 36.69185 38.0 38.0 38.0 34.8 38.0 85-89 36.69315 38.0 38.0 38.0 34.6 38.0 90-94 36.490649999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.40605000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.2564 38.0 37.6 38.0 33.8 38.0 105-109 36.1457 38.0 37.0 38.0 33.2 38.0 110-114 35.827 38.0 37.0 38.0 31.6 38.0 115-119 35.657 38.0 36.4 38.0 31.0 38.0 120-124 35.530199999999994 38.0 36.0 38.0 29.6 38.0 125-129 35.403850000000006 38.0 36.0 38.0 29.2 38.0 130-134 35.0559 38.0 35.2 38.0 27.6 38.0 135-139 34.69915 38.0 35.0 38.0 25.2 38.0 140-144 34.4542 38.0 34.6 38.0 23.4 38.0 145-149 34.12365 38.0 33.6 38.0 23.0 38.0 150-151 31.42 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 1.0 18 4.0 19 3.0 20 7.0 21 6.0 22 4.0 23 9.0 24 12.0 25 5.0 26 15.0 27 25.0 28 18.0 29 35.0 30 36.0 31 75.0 32 79.0 33 112.0 34 169.0 35 355.0 36 699.0 37 2328.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2 19.2 14.7 28.9 2 26.125 27.525 29.75 16.6 3 19.900000000000002 28.1 30.85 21.15 4 25.025 32.824999999999996 23.25 18.9 5 25.900000000000002 34.425 22.475 17.2 6 19.950000000000003 38.4 23.425 18.224999999999998 7 19.1 20.625 38.5 21.775 8 21.55 25.3 27.675 25.474999999999998 9 21.925 24.875 29.275000000000002 23.925 10-14 23.39 28.999999999999996 25.929999999999996 21.68 15-19 22.985 27.685 27.87 21.46 20-24 22.89 28.355000000000004 28.17 20.585 25-29 23.14 28.244999999999997 27.575 21.04 30-34 22.985 28.38 28.12 20.515 35-39 22.99 28.470000000000002 27.529999999999998 21.01 40-44 23.01 28.134999999999998 28.105000000000004 20.75 45-49 22.845 28.33 28.435 20.39 50-54 23.285 27.83 28.355000000000004 20.53 55-59 23.405 28.305000000000003 28.494999999999997 19.794999999999998 60-64 23.5 27.775 28.21 20.515 65-69 23.375 27.92 28.275 20.43 70-74 23.544999999999998 28.050000000000004 27.97 20.435 75-79 22.985 28.244999999999997 27.98 20.79 80-84 23.325000000000003 27.975 28.12 20.580000000000002 85-89 23.669999999999998 27.79 27.915 20.625 90-94 23.5 27.685 28.000000000000004 20.815 95-99 23.765 27.950000000000003 28.035 20.25 100-104 23.48 27.775 28.165000000000003 20.580000000000002 105-109 23.635 27.794999999999998 28.33 20.24 110-114 24.125 27.755000000000003 27.49 20.630000000000003 115-119 24.46 27.650000000000002 27.500000000000004 20.39 120-124 24.09 28.005000000000003 27.58 20.325 125-129 23.915 28.52 27.384999999999998 20.18 130-134 24.38 28.26 27.450000000000003 19.91 135-139 24.779999999999998 27.775 27.765 19.68 140-144 24.395 28.310000000000002 27.46 19.835 145-149 25.430000000000003 27.694999999999997 27.29 19.585 150-151 24.275 27.650000000000002 27.900000000000002 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.5 25 2.5 26 2.5 27 2.5 28 3.0 29 7.0 30 13.0 31 18.5 32 23.0 33 33.5 34 50.5 35 66.0 36 86.0 37 110.5 38 149.0 39 166.5 40 181.0 41 240.5 42 276.0 43 272.0 44 292.0 45 299.0 46 273.5 47 259.5 48 230.0 49 188.0 50 164.0 51 146.0 52 117.0 53 82.0 54 53.5 55 41.0 56 40.0 57 29.5 58 20.0 59 14.0 60 11.5 61 11.5 62 7.0 63 5.0 64 2.0 65 2.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra Read 782448 spots for SRR7171434.sra Written 782448 spots for SRR7171434.sra Read 782433 spots for SRR7171434.sra Written 782433 spots for SRR7171434.sra SRR ids: ['SRR7171434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5fihzttb SRR7171434.sra spots: 15648675 blocks: [[1, 782433], [782434, 1564866], [1564867, 2347299], [2347300, 3129732], [3129733, 3912165], [3912166, 4694598], [4694599, 5477031], [5477032, 6259464], [6259465, 7041897], [7041898, 7824330], [7824331, 8606763], [8606764, 9389196], [9389197, 10171629], [10171630, 10954062], [10954063, 11736495], [11736496, 12518928], [12518929, 13301361], [13301362, 14083794], [14083795, 14866227], [14866228, 15648675]] SRR7171434 file size 5281122 SRR7171434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171434 SRR7171434_1.fastq SRR7171434_2.fastq Input file: SRR7171434_1.fastq Paired file: SRR7171434_2.fastq trimmed: SRR7171434-trimmed-pair1.fastq, SRR7171434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:58:18 2025 >> started Fri Feb 14 08:58:35 2025 >> done (17.135s) 15648675 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 1529 ( 0.01%) empty read pairs filtered out after trimming by size control 15647122 (99.99%) read pairs available; of these: 1854050 (11.85%) trimmed read pairs available after processing 13793072 (88.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 0 0.00% 33 1 0.00% 34 8 0.00% 35 9 0.00% 36 3 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 8 0.00% 41 10 0.00% 42 7 0.00% 43 12 0.00% 44 8 0.00% 45 17 0.00% 46 15 0.00% 47 9 0.00% 48 18 0.00% 49 21 0.00% 50 27 0.00% 51 29 0.00% 52 35 0.00% 53 33 0.00% 54 63 0.00% 55 75 0.00% 56 50 0.00% 57 80 0.00% 58 78 0.00% 59 100 0.00% 60 128 0.00% 61 158 0.00% 62 198 0.00% 63 211 0.00% 64 217 0.00% 65 264 0.00% 66 304 0.00% 67 375 0.00% 68 425 0.00% 69 472 0.00% 70 587 0.00% 71 623 0.00% 72 719 0.00% 73 927 0.01% 74 991 0.01% 75 1146 0.01% 76 1260 0.01% 77 1547 0.01% 78 1693 0.01% 79 1928 0.01% 80 2181 0.01% 81 2469 0.02% 82 2845 0.02% 83 2970 0.02% 84 3503 0.02% 85 3886 0.02% 86 4111 0.03% 87 4574 0.03% 88 4897 0.03% 89 5308 0.03% 90 5933 0.04% 91 6458 0.04% 92 7056 0.05% 93 7578 0.05% 94 8249 0.05% 95 8830 0.06% 96 9264 0.06% 97 9969 0.06% 98 10832 0.07% 99 11156 0.07% 100 12051 0.08% 101 12529 0.08% 102 13523 0.09% 103 14647 0.09% 104 15327 0.10% 105 16169 0.10% 106 16924 0.11% 107 17077 0.11% 108 18042 0.12% 109 18969 0.12% 110 19428 0.12% 111 20575 0.13% 112 21412 0.14% 113 22551 0.14% 114 23219 0.15% 115 24304 0.16% 116 25094 0.16% 117 25574 0.16% 118 26632 0.17% 119 27551 0.18% 120 28182 0.18% 121 28990 0.19% 122 29939 0.19% 123 31220 0.20% 124 32524 0.21% 125 33395 0.21% 126 34522 0.22% 127 35644 0.23% 128 36080 0.23% 129 37399 0.24% 130 37783 0.24% 131 38415 0.25% 132 39691 0.25% 133 41027 0.26% 134 42171 0.27% 135 43277 0.28% 136 44224 0.28% 137 44623 0.29% 138 45672 0.29% 139 46491 0.30% 140 47138 0.30% 141 47849 0.31% 142 48959 0.31% 143 50063 0.32% 144 51439 0.33% 145 53088 0.34% 146 52961 0.34% 147 54427 0.35% 148 55736 0.36% 149 55149 0.35% 150 57392 0.37% 151 13793072 88.15% 15647122 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.12 fanout-score-rank=20 prefix-density=0.20 prefix-fanout=4.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=385.72 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=34.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.7 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=289.11 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.7 sequence=GAAGAAGAAGAAA SRR7171434 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:59:27 Started mapping on | Feb 14 08:59:27 Finished on | Feb 14 09:01:11 Mapping speed, Million of reads per hour | 541.63 Number of input reads | 15647122 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14762446 Uniquely mapped reads % | 94.35% Average mapped length | 295.27 Number of splices: Total | 14999133 Number of splices: Annotated (sjdb) | 14750426 Number of splices: GT/AG | 14763266 Number of splices: GC/AG | 189379 Number of splices: AT/AC | 10738 Number of splices: Non-canonical | 35750 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378779 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 92971 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 505897 505897 505897 N_multimapping 378779 378779 378779 N_noFeature 358746 14645198 410958 N_ambiguous 139674 772 74107 UnstrandedReadsAssigned:14264026 PositiveStrandReadsAssigned:116476 NegativeStrandReadsAssigned:14277381 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171434-trimmed-pair1.fastq SRR7171434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,647,122 reads, 14,241,566 reads pseudoaligned [quant] estimated average fragment length: 227.987 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7171434.ke.tsv 34699 SRR7171434.se.tsv 87100 total ==> SRR7171434.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.01 732 28.8831 Potri.005G024800.1.v4.1 1035 808.013 162 14.1686 Potri.004G059700.1.v4.1 961 734.018 15 1.44416 Potri.007G009000.2.v4.1 1416 1189.01 0 0 Potri.003G141000.2.v4.1 2943 2716.01 429 11.1624 Potri.016G087400.1.v4.1 270 84.2002 1269 1065.07 Potri.015G069301.1.v4.1 564 339.839 0 0 Potri.010G195200.1.v4.1 1773 1546.01 209 9.55354 Potri.012G127500.1.v4.1 977 750.013 4477 421.842 ==> SRR7171434.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 147 SRR7171434 completed mapping pipeline successfully