Starting /dee2/code/volunteer_pipeline.sh SRR7171435 current disk space = 3116189192192 free memory = 1582343216 SRR7171435 SRAfilesize 376ab92afa16bdf50fd2ee2e6f4261f7 SRR7171435.sra SRR7171435.sra file validated SRR7171435 is paired end SRR7171435 is conventional basespace SRR7171435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1795 33.0 32.0 33.0 32.0 33.0 2 26.34375 28.0 18.0 32.0 18.0 33.0 3 30.3105 31.0 29.0 33.0 27.0 33.0 4 32.09475 33.0 32.0 33.0 31.0 33.0 5 32.1285 33.0 32.0 33.0 31.0 33.0 6 35.687 37.0 36.0 38.0 31.0 38.0 7 37.0555 38.0 37.0 38.0 35.0 38.0 8 37.1465 38.0 38.0 38.0 36.0 38.0 9 37.446 38.0 38.0 38.0 37.0 38.0 10-14 37.42635 38.0 38.0 38.0 37.0 38.0 15-19 37.43785 38.0 38.0 38.0 37.0 38.0 20-24 37.477549999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.43445 38.0 38.0 38.0 37.4 38.0 30-34 37.48665 38.0 38.0 38.0 37.6 38.0 35-39 37.413 38.0 38.0 38.0 37.0 38.0 40-44 37.415499999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.3941 38.0 38.0 38.0 37.0 38.0 50-54 37.34895 38.0 38.0 38.0 37.0 38.0 55-59 37.24735 38.0 38.0 38.0 37.0 38.0 60-64 37.27479999999999 38.0 38.0 38.0 36.8 38.0 65-69 37.264250000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.1683 38.0 38.0 38.0 36.4 38.0 75-79 37.147000000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.10744999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.005399999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.97555 38.0 38.0 38.0 36.0 38.0 95-99 36.801849999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.76345 38.0 38.0 38.0 34.8 38.0 105-109 36.61450000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.682500000000005 38.0 38.0 38.0 34.2 38.0 115-119 36.450649999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.34225 38.0 38.0 38.0 34.0 38.0 125-129 36.27915 38.0 37.2 38.0 33.4 38.0 130-134 36.19135 38.0 37.2 38.0 33.4 38.0 135-139 35.9539 38.0 36.2 38.0 32.8 38.0 140-144 35.842200000000005 38.0 36.0 38.0 31.8 38.0 145-149 35.446600000000004 38.0 35.8 38.0 29.6 38.0 150-151 33.738375000000005 36.5 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 3.0 22 0.0 23 3.0 24 7.0 25 8.0 26 11.0 27 12.0 28 17.0 29 29.0 30 34.0 31 42.0 32 62.0 33 84.0 34 144.0 35 219.0 36 601.0 37 2723.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.46680606377418 11.657083115525353 10.245687401986409 38.63042341871406 2 21.8 13.275 32.0 32.925 3 18.85 18.35 26.625 36.175000000000004 4 23.474999999999998 26.325 22.625 27.575 5 24.25 28.425 24.15 23.175 6 18.425 37.025000000000006 25.474999999999998 19.075 7 14.025000000000002 26.1 42.975 16.900000000000002 8 17.424999999999997 27.55 31.3 23.724999999999998 9 17.549999999999997 25.0 33.550000000000004 23.9 10-14 19.939999999999998 29.294999999999998 27.715 23.05 15-19 19.965 28.57 28.175 23.29 20-24 19.52 29.275000000000002 28.32 22.884999999999998 25-29 20.175 29.185 27.58 23.06 30-34 20.02 29.104999999999997 27.794999999999998 23.080000000000002 35-39 20.105 28.74 27.845 23.31 40-44 20.215 28.685 27.800000000000004 23.3 45-49 20.285 28.34 27.689999999999998 23.685000000000002 50-54 19.650000000000002 28.970000000000002 28.205000000000002 23.175 55-59 19.759999999999998 28.084999999999997 28.535 23.62 60-64 19.985 28.720000000000002 28.050000000000004 23.244999999999997 65-69 19.675 28.325 28.57 23.43 70-74 20.315 29.09 27.505000000000003 23.09 75-79 20.275000000000002 28.375 27.77 23.580000000000002 80-84 20.330000000000002 28.185 27.365000000000002 24.12 85-89 20.150000000000002 28.965000000000003 27.525 23.36 90-94 19.905 28.810000000000002 27.639999999999997 23.645 95-99 20.19 28.549999999999997 27.805000000000003 23.455000000000002 100-104 19.915 28.854999999999997 27.555000000000003 23.674999999999997 105-109 20.535 28.560000000000002 27.595 23.31 110-114 20.215 28.860000000000003 27.29 23.635 115-119 20.355 29.435 27.1 23.11 120-124 20.880000000000003 28.82 27.005000000000003 23.294999999999998 125-129 20.89 28.384999999999998 27.555000000000003 23.169999999999998 130-134 20.76 28.349999999999998 27.735 23.155 135-139 20.535 28.055000000000003 27.839999999999996 23.57 140-144 20.96 27.905 27.01 24.125 145-149 20.830000000000002 28.599999999999998 27.215 23.355 150-151 20.5375 28.799999999999997 26.8125 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 0.5 23 0.5 24 2.0 25 3.5 26 3.5 27 5.5 28 7.5 29 12.0 30 16.5 31 20.0 32 28.5 33 38.0 34 46.5 35 58.5 36 87.5 37 131.0 38 146.5 39 164.5 40 203.5 41 230.5 42 264.0 43 288.5 44 288.5 45 281.5 46 276.0 47 251.0 48 218.5 49 204.5 50 179.0 51 132.5 52 100.0 53 75.0 54 54.0 55 48.5 56 35.5 57 21.0 58 15.5 59 13.5 60 9.5 61 6.0 62 6.5 63 4.5 64 4.0 65 4.0 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.3875 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.512499999999999 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.45 0.0 0.0 0.0 0.0 134-135 6.862500000000001 0.0 0.0 0.0 0.0 136-137 7.55 0.0 0.0 0.0 0.0 138-139 8.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGATA 10 0.0068343505 144.975 2 >>END_MODULE SRR7171435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95425 33.0 33.0 34.0 32.0 34.0 2 33.05225 34.0 33.0 34.0 32.0 34.0 3 33.056 34.0 33.0 34.0 32.0 34.0 4 33.02975 34.0 33.0 34.0 32.0 34.0 5 32.9475 34.0 33.0 34.0 32.0 34.0 6 37.1875 38.0 38.0 38.0 36.0 38.0 7 37.262 38.0 38.0 38.0 37.0 38.0 8 37.16175 38.0 38.0 38.0 37.0 38.0 9 37.116 38.0 38.0 38.0 37.0 38.0 10-14 37.091 38.0 38.0 38.0 36.6 38.0 15-19 37.15605 38.0 38.0 38.0 36.6 38.0 20-24 37.2231 38.0 38.0 38.0 37.0 38.0 25-29 37.148450000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.1674 38.0 38.0 38.0 36.4 38.0 35-39 37.10025 38.0 38.0 38.0 36.4 38.0 40-44 37.0322 38.0 38.0 38.0 36.0 38.0 45-49 37.01285 38.0 38.0 38.0 36.0 38.0 50-54 36.92545 38.0 38.0 38.0 36.0 38.0 55-59 36.88425 38.0 38.0 38.0 35.6 38.0 60-64 36.86845 38.0 38.0 38.0 35.6 38.0 65-69 36.8015 38.0 38.0 38.0 35.2 38.0 70-74 36.840650000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.71685000000001 38.0 38.0 38.0 34.8 38.0 80-84 36.653 38.0 38.0 38.0 34.2 38.0 85-89 36.5972 38.0 38.0 38.0 34.2 38.0 90-94 36.44415 38.0 38.0 38.0 34.0 38.0 95-99 36.4073 38.0 37.8 38.0 33.8 38.0 100-104 36.26865 38.0 37.4 38.0 33.6 38.0 105-109 36.117599999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.82610000000001 38.0 37.0 38.0 31.0 38.0 115-119 35.661350000000006 38.0 36.6 38.0 30.6 38.0 120-124 35.496449999999996 38.0 36.0 38.0 29.6 38.0 125-129 35.350849999999994 38.0 36.0 38.0 28.4 38.0 130-134 35.17645 38.0 35.4 38.0 27.8 38.0 135-139 34.67545 38.0 35.0 38.0 24.6 38.0 140-144 34.379450000000006 38.0 34.4 38.0 23.2 38.0 145-149 34.017199999999995 38.0 33.4 38.0 23.0 38.0 150-151 31.329874999999998 35.5 28.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 2.0 18 3.0 19 2.0 20 2.0 21 7.0 22 10.0 23 13.0 24 11.0 25 9.0 26 15.0 27 22.0 28 38.0 29 44.0 30 48.0 31 59.0 32 87.0 33 126.0 34 167.0 35 300.0 36 701.0 37 2331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 19.650000000000002 15.375 25.8 2 26.950000000000003 24.8 29.325000000000003 18.925 3 20.775 28.825 30.025000000000002 20.375 4 23.7 33.650000000000006 25.0 17.65 5 24.4 34.775 22.375 18.45 6 20.9 37.45 22.675 18.975 7 20.150000000000002 21.125 38.5 20.225 8 22.15 26.174999999999997 27.750000000000004 23.925 9 22.025 24.5 31.125000000000004 22.35 10-14 23.07 29.035 26.615 21.279999999999998 15-19 22.905 28.17 28.08 20.845 20-24 22.675 28.77 27.805000000000003 20.75 25-29 23.25 27.779999999999998 27.750000000000004 21.22 30-34 23.185 28.185 28.599999999999998 20.03 35-39 22.795 28.455000000000002 28.09 20.66 40-44 23.18 28.285 27.92 20.615 45-49 22.884999999999998 27.865000000000002 28.255000000000003 20.995 50-54 23.07 28.035 27.905 20.990000000000002 55-59 23.49 28.265 28.01 20.235 60-64 23.355 27.465 28.595 20.585 65-69 23.085 27.825 28.435 20.655 70-74 23.46 27.815 28.305000000000003 20.419999999999998 75-79 23.315 27.965 28.075 20.645 80-84 23.200000000000003 27.58 28.315 20.905 85-89 23.565 27.58 28.610000000000003 20.244999999999997 90-94 23.669999999999998 28.24 27.965 20.125 95-99 23.380000000000003 27.735 28.415000000000003 20.47 100-104 23.95 28.265 28.09 19.695 105-109 23.71 28.349999999999998 27.98 19.96 110-114 24.42 27.810000000000002 27.744999999999997 20.025000000000002 115-119 24.59 27.73 27.395000000000003 20.285 120-124 23.905 28.975 27.200000000000003 19.919999999999998 125-129 24.14 28.615000000000002 27.705000000000002 19.54 130-134 24.755 28.015 27.495000000000005 19.735 135-139 24.83 28.294999999999998 27.279999999999998 19.595000000000002 140-144 24.825 28.705000000000002 27.065 19.405 145-149 25.130000000000003 28.349999999999998 26.735 19.785 150-151 25.2875 28.050000000000004 27.800000000000004 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 1.0 27 3.5 28 6.5 29 8.0 30 9.0 31 14.5 32 21.5 33 25.0 34 38.5 35 62.0 36 83.5 37 112.5 38 146.0 39 186.5 40 226.0 41 251.0 42 269.0 43 287.0 44 300.5 45 294.0 46 267.0 47 231.5 48 207.0 49 199.5 50 175.0 51 150.5 52 124.0 53 88.5 54 64.5 55 38.5 56 25.0 57 16.5 58 12.5 59 13.0 60 10.0 61 7.5 62 6.0 63 3.5 64 1.5 65 1.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.612500000000001 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.55 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.65 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATA 10 0.006830828 145.0 4 GTTGGCA 10 0.006830828 145.0 145 CGGAAGA 60 4.3742658E-4 48.333332 145 >>END_MODULE Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839452 spots for SRR7171435.sra Written 839452 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra Read 839448 spots for SRR7171435.sra Written 839448 spots for SRR7171435.sra SRR ids: ['SRR7171435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fr_qt1jt SRR7171435.sra spots: 16788964 blocks: [[1, 839448], [839449, 1678896], [1678897, 2518344], [2518345, 3357792], [3357793, 4197240], [4197241, 5036688], [5036689, 5876136], [5876137, 6715584], [6715585, 7555032], [7555033, 8394480], [8394481, 9233928], [9233929, 10073376], [10073377, 10912824], [10912825, 11752272], [11752273, 12591720], [12591721, 13431168], [13431169, 14270616], [14270617, 15110064], [15110065, 15949512], [15949513, 16788964]] SRR7171435 file size 5667528 SRR7171435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171435 SRR7171435_1.fastq SRR7171435_2.fastq Input file: SRR7171435_1.fastq Paired file: SRR7171435_2.fastq trimmed: SRR7171435-trimmed-pair1.fastq, SRR7171435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:52:12 2025 >> started Fri Feb 14 09:52:38 2025 >> done (26.200s) 16788964 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1429 ( 0.01%) empty read pairs filtered out after trimming by size control 16787515 (99.99%) read pairs available; of these: 2236946 (13.33%) trimmed read pairs available after processing 14550569 (86.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 3 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 4 0.00% 34 2 0.00% 35 2 0.00% 36 4 0.00% 37 3 0.00% 38 6 0.00% 39 5 0.00% 40 7 0.00% 41 9 0.00% 42 14 0.00% 43 14 0.00% 44 8 0.00% 45 11 0.00% 46 12 0.00% 47 16 0.00% 48 22 0.00% 49 8 0.00% 50 29 0.00% 51 29 0.00% 52 29 0.00% 53 48 0.00% 54 56 0.00% 55 51 0.00% 56 55 0.00% 57 73 0.00% 58 97 0.00% 59 92 0.00% 60 104 0.00% 61 158 0.00% 62 183 0.00% 63 191 0.00% 64 230 0.00% 65 244 0.00% 66 306 0.00% 67 348 0.00% 68 411 0.00% 69 518 0.00% 70 591 0.00% 71 683 0.00% 72 859 0.01% 73 974 0.01% 74 1119 0.01% 75 1324 0.01% 76 1397 0.01% 77 1562 0.01% 78 1781 0.01% 79 2019 0.01% 80 2411 0.01% 81 2709 0.02% 82 3106 0.02% 83 3398 0.02% 84 3877 0.02% 85 4436 0.03% 86 4732 0.03% 87 5060 0.03% 88 5711 0.03% 89 6170 0.04% 90 6657 0.04% 91 7408 0.04% 92 8340 0.05% 93 9126 0.05% 94 9745 0.06% 95 10429 0.06% 96 11119 0.07% 97 11747 0.07% 98 12599 0.08% 99 13415 0.08% 100 14220 0.08% 101 15352 0.09% 102 16441 0.10% 103 17378 0.10% 104 18360 0.11% 105 19394 0.12% 106 20489 0.12% 107 21194 0.13% 108 21848 0.13% 109 22924 0.14% 110 23705 0.14% 111 24901 0.15% 112 26000 0.15% 113 27181 0.16% 114 28514 0.17% 115 30028 0.18% 116 31011 0.18% 117 32207 0.19% 118 31834 0.19% 119 33490 0.20% 120 34167 0.20% 121 35450 0.21% 122 36818 0.22% 123 38709 0.23% 124 40455 0.24% 125 40805 0.24% 126 42540 0.25% 127 43348 0.26% 128 44363 0.26% 129 45077 0.27% 130 45258 0.27% 131 46832 0.28% 132 48096 0.29% 133 49563 0.30% 134 51202 0.31% 135 52677 0.31% 136 53672 0.32% 137 54450 0.32% 138 55066 0.33% 139 56230 0.33% 140 56448 0.34% 141 57127 0.34% 142 59597 0.36% 143 59768 0.36% 144 62316 0.37% 145 63229 0.38% 146 64052 0.38% 147 65130 0.39% 148 66359 0.40% 149 65870 0.39% 150 67881 0.40% 151 14550569 86.67% 16787515 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=10 prefix-density=0.74 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=19.04 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=CTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCCTAATT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=13 prefix-density=0.82 prefix-fanout=3.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=34.58 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=3.3 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7171435 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:53:30 Started mapping on | Feb 14 09:53:30 Finished on | Feb 14 09:55:53 Mapping speed, Million of reads per hour | 422.62 Number of input reads | 16787515 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15488781 Uniquely mapped reads % | 92.26% Average mapped length | 294.58 Number of splices: Total | 15061331 Number of splices: Annotated (sjdb) | 14777072 Number of splices: GT/AG | 14814956 Number of splices: GC/AG | 194523 Number of splices: AT/AC | 11744 Number of splices: Non-canonical | 40108 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416015 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 127293 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.35% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 882719 882719 882719 N_multimapping 416015 416015 416015 N_noFeature 438761 15339529 506158 N_ambiguous 160001 955 77476 UnstrandedReadsAssigned:14890019 PositiveStrandReadsAssigned:148297 NegativeStrandReadsAssigned:14905147 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171435-trimmed-pair1.fastq SRR7171435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,787,515 reads, 14,946,687 reads pseudoaligned [quant] estimated average fragment length: 224.843 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR7171435.ke.tsv 34699 SRR7171435.se.tsv 87100 total ==> SRR7171435.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.16 1449 54.436 Potri.005G024800.1.v4.1 1035 811.157 250 20.7737 Potri.004G059700.1.v4.1 961 737.166 32 2.92592 Potri.007G009000.2.v4.1 1416 1192.16 0 0 Potri.003G141000.2.v4.1 2943 2719.16 776.493 19.2478 Potri.016G087400.1.v4.1 270 85.8816 812 637.285 Potri.015G069301.1.v4.1 564 342.62 0 0 Potri.010G195200.1.v4.1 1773 1549.16 701.794 30.5346 Potri.012G127500.1.v4.1 977 753.166 3259 291.656 ==> SRR7171435.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 647 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 368 SRR7171435 completed mapping pipeline successfully