Starting /dee2/code/volunteer_pipeline.sh SRR7171436 current disk space = 3116568240128 free memory = 1579779640 SRR7171436 SRAfilesize d0ba26e9873b9bd4bccf9b687d6d033a SRR7171436.sra SRR7171436.sra file validated SRR7171436 is paired end SRR7171436 is conventional basespace SRR7171436 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.99175 32.0 27.0 33.0 18.0 33.0 2 31.3565 33.0 31.0 33.0 27.0 34.0 3 31.29575 33.0 31.0 33.0 27.0 33.0 4 31.687 33.0 31.0 33.0 29.0 33.0 5 32.4485 33.0 33.0 33.0 32.0 34.0 6 36.4675 38.0 37.0 38.0 34.0 38.0 7 36.87675 38.0 37.0 38.0 35.0 38.0 8 37.14325 38.0 38.0 38.0 36.0 38.0 9 37.35325 38.0 38.0 38.0 37.0 38.0 10-14 37.4756 38.0 38.0 38.0 37.4 38.0 15-19 37.44455000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.441649999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.41805 38.0 38.0 38.0 37.0 38.0 30-34 37.42465 38.0 38.0 38.0 37.2 38.0 35-39 37.36645 38.0 38.0 38.0 37.0 38.0 40-44 37.267700000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.2742 38.0 38.0 38.0 37.0 38.0 50-54 37.2547 38.0 38.0 38.0 37.0 38.0 55-59 37.195550000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.1075 38.0 38.0 38.0 36.0 38.0 65-69 36.97625000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.013099999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.97435 38.0 38.0 38.0 35.4 38.0 80-84 36.8059 38.0 38.0 38.0 35.0 38.0 85-89 36.659499999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.5792 38.0 38.0 38.0 34.0 38.0 95-99 36.551249999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.412949999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.307050000000004 38.0 37.8 38.0 33.8 38.0 110-114 36.22215 38.0 37.2 38.0 33.4 38.0 115-119 35.96 38.0 37.0 38.0 32.4 38.0 120-124 35.711200000000005 38.0 36.4 38.0 31.0 38.0 125-129 35.6182 38.0 36.0 38.0 31.0 38.0 130-134 35.5997 38.0 36.0 38.0 30.6 38.0 135-139 35.32915 38.0 35.6 38.0 29.2 38.0 140-144 35.024300000000004 38.0 35.0 38.0 27.8 38.0 145-149 34.6387 38.0 35.0 38.0 24.6 38.0 150-151 32.522125 36.5 29.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 5.0 24 4.0 25 9.0 26 14.0 27 21.0 28 37.0 29 42.0 30 41.0 31 55.0 32 87.0 33 106.0 34 152.0 35 291.0 36 737.0 37 2395.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.48706240487062 13.08980213089802 9.665144596651446 36.757990867579906 2 21.07107107107107 15.14014014014014 31.906906906906908 31.88188188188188 3 21.575 20.9 25.074999999999996 32.45 4 23.875 27.025 23.25 25.85 5 22.575 32.025 23.25 22.15 6 18.925 35.05 26.224999999999998 19.8 7 14.149999999999999 25.1 42.35 18.4 8 17.9 26.674999999999997 30.475 24.95 9 18.075 25.124999999999996 33.025 23.775 10-14 19.400000000000002 29.755 27.200000000000003 23.645 15-19 19.405 28.015 28.410000000000004 24.169999999999998 20-24 20.0 28.139999999999997 27.97 23.89 25-29 19.925 28.76 27.74 23.575 30-34 19.905 28.21 27.985 23.9 35-39 20.73 28.185 27.689999999999998 23.395 40-44 20.32 28.165000000000003 28.044999999999998 23.47 45-49 20.155 28.79 27.279999999999998 23.775 50-54 19.85 28.744999999999997 27.215 24.19 55-59 20.05 28.095 28.18 23.674999999999997 60-64 20.635 28.005000000000003 27.860000000000003 23.5 65-69 20.05300795119268 27.909186377956697 27.914187128069212 24.123618542781415 70-74 20.308046206931042 28.029204380657095 27.874181127169074 23.788568285242786 75-79 20.630000000000003 28.470000000000002 27.229999999999997 23.669999999999998 80-84 20.605 27.905 26.965 24.525 85-89 20.305 27.855 27.72 24.12 90-94 20.65 27.860000000000003 27.694999999999997 23.794999999999998 95-99 20.455000000000002 27.975 27.675 23.895 100-104 20.330000000000002 28.035 28.015 23.62 105-109 20.580000000000002 28.02 27.589999999999996 23.810000000000002 110-114 20.67913582716543 28.440688137627525 27.225445089017803 23.654730946189236 115-119 20.882529517710626 28.24694816890134 27.37142285371223 23.499099459675808 120-124 20.606030301515077 27.77638881944097 27.76638831941597 23.851192559627982 125-129 21.14 28.325 27.195000000000004 23.34 130-134 21.154999999999998 27.99 27.41 23.445 135-139 20.525 28.335 26.815 24.325 140-144 21.29 27.875 27.0 23.835 145-149 20.495 28.225 27.24 24.04 150-151 20.5625 27.8375 26.325 25.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 3.0 26 3.0 27 5.0 28 8.0 29 9.5 30 11.0 31 18.5 32 24.5 33 32.0 34 50.5 35 61.0 36 74.5 37 96.0 38 125.0 39 165.5 40 181.5 41 208.0 42 255.0 43 273.0 44 287.0 45 285.5 46 270.5 47 266.5 48 240.0 49 207.0 50 172.0 51 143.0 52 121.0 53 99.0 54 87.5 55 64.0 56 38.0 57 26.5 58 18.0 59 12.5 60 11.5 61 9.0 62 8.5 63 7.5 64 4.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.06 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.1625 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.3625 0.0 0.0 0.025 0.0 94-95 0.44999999999999996 0.0 0.0 0.025 0.0 96-97 0.5625 0.0 0.0 0.025 0.0 98-99 0.8125 0.0 0.0 0.025 0.0 100-101 0.9875 0.0 0.0 0.025 0.0 102-103 1.0875 0.0 0.0 0.025 0.0 104-105 1.2875 0.0 0.0 0.025 0.0 106-107 1.4 0.0 0.0 0.025 0.0 108-109 1.5750000000000002 0.0 0.0 0.025 0.0 110-111 1.825 0.0 0.0 0.025 0.0 112-113 2.125 0.0 0.0 0.025 0.0 114-115 2.425 0.0 0.0 0.025 0.0 116-117 2.5875000000000004 0.0 0.0 0.025 0.0 118-119 2.8625 0.0 0.0 0.025 0.0 120-121 3.125 0.0 0.0 0.025 0.0 122-123 3.6875 0.0 0.0 0.025 0.0 124-125 4.137499999999999 0.0 0.0 0.025 0.0 126-127 4.574999999999999 0.0 0.0 0.025 0.0 128-129 5.15 0.0 0.0 0.025 0.0 130-131 5.737500000000001 0.0 0.0 0.025 0.0 132-133 6.25 0.0 0.0 0.025 0.0 134-135 6.725 0.0 0.0 0.025 0.0 136-137 7.2625 0.0 0.0 0.025 0.0 138-139 7.8375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171436 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7095 33.0 33.0 34.0 32.0 34.0 2 32.77625 34.0 33.0 34.0 32.0 34.0 3 32.75375 34.0 33.0 34.0 32.0 34.0 4 32.7825 34.0 33.0 34.0 32.0 34.0 5 32.83375 34.0 33.0 34.0 32.0 34.0 6 36.8415 38.0 38.0 38.0 36.0 38.0 7 36.78125 38.0 38.0 38.0 36.0 38.0 8 36.92575 38.0 38.0 38.0 36.0 38.0 9 36.88525 38.0 38.0 38.0 36.0 38.0 10-14 36.7195 38.0 38.0 38.0 35.2 38.0 15-19 36.69665 38.0 38.0 38.0 35.2 38.0 20-24 36.7116 38.0 38.0 38.0 35.2 38.0 25-29 36.756600000000006 38.0 38.0 38.0 35.4 38.0 30-34 36.7116 38.0 38.0 38.0 35.4 38.0 35-39 36.719849999999994 38.0 38.0 38.0 35.4 38.0 40-44 36.6802 38.0 38.0 38.0 35.0 38.0 45-49 36.7595 38.0 38.0 38.0 35.2 38.0 50-54 36.66375 38.0 38.0 38.0 34.8 38.0 55-59 36.59994999999999 38.0 38.0 38.0 34.6 38.0 60-64 36.3905 38.0 38.0 38.0 34.0 38.0 65-69 36.3708 38.0 38.0 38.0 33.8 38.0 70-74 36.3295 38.0 38.0 38.0 33.8 38.0 75-79 36.36255 38.0 38.0 38.0 34.0 38.0 80-84 36.339099999999995 38.0 38.0 38.0 33.6 38.0 85-89 36.145050000000005 38.0 38.0 38.0 33.0 38.0 90-94 35.961 38.0 37.6 38.0 32.2 38.0 95-99 35.888349999999996 38.0 37.0 38.0 31.6 38.0 100-104 35.70245 38.0 37.0 38.0 30.2 38.0 105-109 35.53995 38.0 37.0 38.0 29.0 38.0 110-114 35.40469999999999 38.0 36.6 38.0 28.6 38.0 115-119 35.32195 38.0 36.2 38.0 28.0 38.0 120-124 34.848 38.0 35.2 38.0 25.0 38.0 125-129 34.99825 38.0 35.8 38.0 27.0 38.0 130-134 34.79039999999999 38.0 35.0 38.0 25.0 38.0 135-139 34.1904 38.0 34.4 38.0 21.8 38.0 140-144 33.63445 38.0 33.8 38.0 18.6 38.0 145-149 33.594350000000006 38.0 33.4 38.0 21.0 38.0 150-151 30.803375 35.0 26.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 5.0 17 9.0 18 19.0 19 10.0 20 17.0 21 10.0 22 18.0 23 15.0 24 18.0 25 26.0 26 32.0 27 30.0 28 37.0 29 45.0 30 61.0 31 64.0 32 105.0 33 131.0 34 167.0 35 259.0 36 648.0 37 2272.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.216879539193584 20.786376158276983 14.55046331079389 26.446280991735538 2 26.35 26.075 30.3 17.275 3 20.75 27.975 31.4 19.875 4 23.455863965991497 34.33358339584896 23.13078269567392 19.079769942485623 5 24.381095273818453 35.43385846461615 22.48062015503876 17.704426106526633 6 20.775 36.8 22.5 19.925 7 20.125 22.775000000000002 37.25 19.85 8 21.425 27.375 26.875 24.325 9 21.380345086271568 26.231557889472366 29.232308077019255 23.15578894723681 10-14 23.61090272568142 29.177294323580895 26.241560390097522 20.97024256064016 15-19 23.785946486621658 27.38184546136534 27.866966741685424 20.96524131032758 20-24 23.520880220055012 28.592148037009252 27.016754188547136 20.8702175543886 25-29 23.45117255862793 28.32141607080354 27.03635181759088 21.19105955297765 30-34 23.14 28.37 27.644999999999996 20.845 35-39 23.24 28.42 26.97 21.37 40-44 23.39 28.455000000000002 27.3 20.855 45-49 23.524704940988197 27.860572114422883 27.915583116623328 20.699139827965592 50-54 23.23080770192548 27.25681420355089 28.382095523880967 21.13028257064266 55-59 23.248136847896763 27.914770169559343 27.57465112789476 21.26244185464913 60-64 23.31082770692673 28.73718429607402 27.011752938234558 20.940235058764692 65-69 23.81357203580537 27.964194629194377 27.794169125368807 20.428064209631444 70-74 24.145 27.905 27.405 20.544999999999998 75-79 23.919999999999998 27.97 27.51 20.599999999999998 80-84 23.715 28.01 27.76 20.515 85-89 24.205 27.47 27.52 20.805 90-94 23.82238223822382 28.59285928592859 27.33273327332733 20.25202520252025 95-99 23.668283899364777 28.304906717351074 27.659680888310913 20.36712849497324 100-104 24.139483690214128 27.92675605363218 27.156293776265763 20.77746647988793 105-109 23.519111466880126 27.816690014008405 27.736641985191113 20.927556533920352 110-114 24.35704993495447 27.914540178124685 27.128990293205245 20.599419593715602 115-119 24.523487918355094 28.255540547301017 27.515133323327827 19.705838211016058 120-124 25.03751125337601 28.26848054416325 26.43292987896369 20.26107832349705 125-129 24.556227811390567 28.491424571228563 26.761338066903345 20.191009550477524 130-134 24.996249812490625 28.21641082054103 27.001350067503378 19.785989299464973 135-139 25.17255176552966 27.47324197259178 27.348204461338398 20.00600180054016 140-144 26.12698253865012 27.47786060939611 26.777405313453745 19.617751538500023 145-149 25.283962972229173 27.78583937953465 27.185389041781338 19.744808606454843 150-151 25.856892669502123 27.220415311483613 26.80760570427821 20.115086314736054 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.5 26 4.0 27 4.0 28 3.0 29 5.0 30 11.0 31 12.5 32 14.0 33 24.5 34 39.5 35 58.5 36 74.5 37 98.0 38 121.0 39 147.5 40 196.5 41 244.5 42 263.5 43 269.5 44 294.0 45 310.0 46 297.0 47 261.0 48 231.0 49 200.5 50 175.0 51 158.0 52 123.0 53 90.5 54 67.0 55 47.0 56 31.0 57 26.0 58 22.0 59 15.5 60 13.5 61 9.5 62 5.0 63 5.5 64 4.5 65 3.0 66 1.5 67 1.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.025 55-59 0.034999999999999996 60-64 0.025 65-69 0.015 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.034999999999999996 100-104 0.06 105-109 0.06 110-114 0.06999999999999999 115-119 0.055 120-124 0.03 125-129 0.005 130-134 0.005 135-139 0.03 140-144 0.065 145-149 0.075 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79934788061199 99.47500000000001 2 0.1254075746175069 0.25 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.025081514923501375 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.65 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.862500000000001 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTACT 10 0.006830828 145.0 7 >>END_MODULE Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661061 spots for SRR7171436.sra Written 661061 spots for SRR7171436.sra Read 661075 spots for SRR7171436.sra Written 661075 spots for SRR7171436.sra SRR ids: ['SRR7171436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q2rvyiwo SRR7171436.sra spots: 13221234 blocks: [[1, 661061], [661062, 1322122], [1322123, 1983183], [1983184, 2644244], [2644245, 3305305], [3305306, 3966366], [3966367, 4627427], [4627428, 5288488], [5288489, 5949549], [5949550, 6610610], [6610611, 7271671], [7271672, 7932732], [7932733, 8593793], [8593794, 9254854], [9254855, 9915915], [9915916, 10576976], [10576977, 11238037], [11238038, 11899098], [11899099, 12560159], [12560160, 13221234]] SRR7171436 file size 4458542 SRR7171436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171436 SRR7171436_1.fastq SRR7171436_2.fastq Input file: SRR7171436_1.fastq Paired file: SRR7171436_2.fastq trimmed: SRR7171436-trimmed-pair1.fastq, SRR7171436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:35:32 2025 >> started Fri Feb 14 09:35:57 2025 >> done (25.455s) 13221234 read pairs processed; of these: 139 ( 0.00%) short read pairs filtered out after trimming by size control 1315 ( 0.01%) empty read pairs filtered out after trimming by size control 13219780 (99.99%) read pairs available; of these: 1680933 (12.72%) trimmed read pairs available after processing 11538847 (87.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 3 0.00% 33 1 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 4 0.00% 41 5 0.00% 42 5 0.00% 43 2 0.00% 44 8 0.00% 45 4 0.00% 46 5 0.00% 47 7 0.00% 48 8 0.00% 49 11 0.00% 50 14 0.00% 51 17 0.00% 52 25 0.00% 53 26 0.00% 54 28 0.00% 55 35 0.00% 56 28 0.00% 57 30 0.00% 58 53 0.00% 59 68 0.00% 60 92 0.00% 61 87 0.00% 62 110 0.00% 63 114 0.00% 64 124 0.00% 65 153 0.00% 66 192 0.00% 67 206 0.00% 68 256 0.00% 69 290 0.00% 70 353 0.00% 71 420 0.00% 72 486 0.00% 73 598 0.00% 74 595 0.00% 75 809 0.01% 76 847 0.01% 77 967 0.01% 78 1117 0.01% 79 1232 0.01% 80 1375 0.01% 81 1690 0.01% 82 1895 0.01% 83 2236 0.02% 84 2473 0.02% 85 2709 0.02% 86 2975 0.02% 87 3068 0.02% 88 3669 0.03% 89 3870 0.03% 90 4315 0.03% 91 4721 0.04% 92 5339 0.04% 93 5911 0.04% 94 6230 0.05% 95 6980 0.05% 96 7429 0.06% 97 7783 0.06% 98 8284 0.06% 99 8763 0.07% 100 9258 0.07% 101 10062 0.08% 102 10997 0.08% 103 11767 0.09% 104 12514 0.09% 105 13188 0.10% 106 13914 0.11% 107 14586 0.11% 108 15057 0.11% 109 15505 0.12% 110 16279 0.12% 111 17125 0.13% 112 18360 0.14% 113 19660 0.15% 114 20591 0.16% 115 21724 0.16% 116 22460 0.17% 117 23953 0.18% 118 26498 0.20% 119 24831 0.19% 120 24694 0.19% 121 25607 0.19% 122 26889 0.20% 123 27919 0.21% 124 29551 0.22% 125 30423 0.23% 126 31701 0.24% 127 32115 0.24% 128 32502 0.25% 129 33056 0.25% 130 34288 0.26% 131 35042 0.27% 132 36249 0.27% 133 37853 0.29% 134 38578 0.29% 135 40132 0.30% 136 41351 0.31% 137 41644 0.32% 138 42777 0.32% 139 43453 0.33% 140 43386 0.33% 141 44973 0.34% 142 49625 0.38% 143 49012 0.37% 144 49490 0.37% 145 52020 0.39% 146 50765 0.38% 147 54291 0.41% 148 52233 0.40% 149 52638 0.40% 150 57171 0.43% 151 11538847 87.28% 13219780 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.23 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.0 sequence=TTCCCCTCTTCGGCCTTCAAAGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGGCGCGGCTCAACGAAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCCGATAGAACTCGCA criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=13 prefix-density=0.82 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=31.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGT SRR7171436 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:37:07 Started mapping on | Feb 14 09:37:08 Finished on | Feb 14 09:38:59 Mapping speed, Million of reads per hour | 428.75 Number of input reads | 13219780 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12064357 Uniquely mapped reads % | 91.26% Average mapped length | 295.04 Number of splices: Total | 11612471 Number of splices: Annotated (sjdb) | 11401246 Number of splices: GT/AG | 11429198 Number of splices: GC/AG | 143836 Number of splices: AT/AC | 9100 Number of splices: Non-canonical | 30337 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347549 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 145651 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807874 807874 807874 N_multimapping 347549 347549 347549 N_noFeature 263652 11953165 304181 N_ambiguous 128266 828 57108 UnstrandedReadsAssigned:11672439 PositiveStrandReadsAssigned:110364 NegativeStrandReadsAssigned:11703068 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171436-trimmed-pair1.fastq SRR7171436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,219,780 reads, 11,862,423 reads pseudoaligned [quant] estimated average fragment length: 224.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7171436.ke.tsv 34699 SRR7171436.se.tsv 87100 total ==> SRR7171436.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.42 1215 50.1091 Potri.005G024800.1.v4.1 1035 811.421 284 25.9022 Potri.004G059700.1.v4.1 961 737.427 40 4.01426 Potri.007G009000.2.v4.1 1416 1192.42 0 0 Potri.003G141000.2.v4.1 2943 2719.42 450.176 12.251 Potri.016G087400.1.v4.1 270 83.9387 1062.54 936.797 Potri.015G069301.1.v4.1 564 342.605 0 0 Potri.010G195200.1.v4.1 1773 1549.42 272.912 13.0352 Potri.012G127500.1.v4.1 977 753.421 3724 365.794 ==> SRR7171436.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 495 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 78 SRR7171436 completed mapping pipeline successfully