Starting /dee2/code/volunteer_pipeline.sh SRR7171437 current disk space = 3117607964672 free memory = 1581080552 SRR7171437 SRAfilesize 264db61ca32d5b6b7215fdc477edd940 SRR7171437.sra SRR7171437.sra file validated SRR7171437 is paired end SRR7171437 is conventional basespace SRR7171437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.49375 30.0 18.0 32.0 18.0 33.0 2 21.34025 18.0 18.0 25.0 18.0 31.0 3 29.25 32.0 27.0 32.0 27.0 33.0 4 28.68175 30.0 28.0 33.0 15.0 33.0 5 30.90975 32.0 32.0 33.0 27.0 33.0 6 36.0555 37.0 36.0 38.0 33.0 38.0 7 36.7465 38.0 37.0 38.0 34.0 38.0 8 37.315 38.0 38.0 38.0 37.0 38.0 9 37.368 38.0 38.0 38.0 37.0 38.0 10-14 37.418499999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.4473 38.0 38.0 38.0 37.2 38.0 20-24 37.44405 38.0 38.0 38.0 37.0 38.0 25-29 37.34845 38.0 38.0 38.0 37.0 38.0 30-34 37.4058 38.0 38.0 38.0 37.0 38.0 35-39 37.37955000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.34815 38.0 38.0 38.0 37.0 38.0 45-49 37.29 38.0 38.0 38.0 37.0 38.0 50-54 37.25435 38.0 38.0 38.0 36.8 38.0 55-59 37.19715 38.0 38.0 38.0 36.4 38.0 60-64 37.09955 38.0 38.0 38.0 36.0 38.0 65-69 36.9653 38.0 38.0 38.0 36.0 38.0 70-74 37.005250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.93435 38.0 38.0 38.0 35.6 38.0 80-84 36.7556 38.0 38.0 38.0 34.6 38.0 85-89 36.60095 38.0 38.0 38.0 34.0 38.0 90-94 36.58125 38.0 38.0 38.0 34.0 38.0 95-99 36.6785 38.0 38.0 38.0 34.2 38.0 100-104 36.4234 38.0 37.8 38.0 34.0 38.0 105-109 36.23539999999999 38.0 37.4 38.0 33.4 38.0 110-114 36.175149999999995 38.0 37.0 38.0 33.2 38.0 115-119 35.88815000000001 38.0 36.8 38.0 32.0 38.0 120-124 35.66975000000001 38.0 36.4 38.0 30.2 38.0 125-129 35.5961 38.0 36.0 38.0 30.6 38.0 130-134 35.63735 38.0 36.0 38.0 31.0 38.0 135-139 35.24855 38.0 35.6 38.0 28.2 38.0 140-144 34.9871 38.0 35.0 38.0 27.6 38.0 145-149 34.62605 38.0 35.0 38.0 25.4 38.0 150-151 32.452 36.5 29.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 8.0 25 9.0 26 12.0 27 24.0 28 31.0 29 26.0 30 48.0 31 59.0 32 82.0 33 132.0 34 201.0 35 338.0 36 884.0 37 2140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.43627575680489 14.296616636988043 8.547443398626303 41.71966420758077 2 20.995995995995994 20.095095095095093 32.80780780780781 26.101101101101097 3 19.175 20.05 23.799999999999997 36.975 4 20.825 29.65 20.974999999999998 28.549999999999997 5 21.825 32.9 23.474999999999998 21.8 6 19.375 35.9 23.575 21.15 7 14.899999999999999 27.400000000000002 39.800000000000004 17.9 8 16.6 26.75 31.075000000000003 25.575 9 17.1 25.074999999999996 33.775 24.05 10-14 19.355 30.275000000000002 27.49 22.88 15-19 20.044999999999998 27.925 28.244999999999997 23.785 20-24 19.185 27.88 28.64 24.295 25-29 19.175 28.705000000000002 28.33 23.79 30-34 19.93 28.63 28.044999999999998 23.395 35-39 20.26 27.985 27.605 24.15 40-44 19.595000000000002 28.57 28.634999999999998 23.200000000000003 45-49 19.865 28.285 27.625 24.224999999999998 50-54 19.91 28.720000000000002 27.515 23.855 55-59 19.24 28.705000000000002 27.875 24.18 60-64 20.115 28.34 28.16 23.385 65-69 19.975 28.515 28.165000000000003 23.345 70-74 20.07100355017751 28.32641632081604 27.821391069553474 23.781189059452974 75-79 19.89 28.03 27.79 24.29 80-84 20.705000000000002 28.505000000000003 27.450000000000003 23.34 85-89 20.205000000000002 27.894999999999996 28.449999999999996 23.45 90-94 19.785 28.96 27.395000000000003 23.86 95-99 20.655 27.834999999999997 27.55 23.96 100-104 20.755000000000003 28.15 27.29 23.805 105-109 20.375 27.82 27.965 23.84 110-114 20.32 28.22 27.93 23.53 115-119 20.510127531882972 28.647161790447612 27.316829207301822 23.52588147036759 120-124 20.435 28.22 27.41 23.935000000000002 125-129 20.435 27.975 27.73 23.86 130-134 20.565 28.17 27.47 23.794999999999998 135-139 21.36 27.355 27.765 23.52 140-144 20.645 27.61 27.779999999999998 23.965 145-149 21.279999999999998 27.775 26.640000000000004 24.305 150-151 20.5875 27.712500000000002 27.237499999999997 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 3.5 27 6.0 28 8.0 29 10.0 30 14.5 31 18.5 32 33.0 33 39.5 34 49.0 35 72.0 36 90.0 37 114.5 38 143.5 39 163.5 40 189.5 41 234.5 42 254.5 43 264.5 44 290.0 45 295.0 46 274.5 47 259.5 48 232.0 49 191.0 50 159.5 51 138.5 52 112.5 53 88.0 54 67.0 55 43.0 56 32.5 57 26.0 58 22.0 59 18.5 60 10.0 61 5.0 62 5.5 63 3.5 64 2.5 65 1.5 66 1.5 67 2.0 68 1.5 69 1.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.037500000000000006 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.2 0.0 0.0 0.025 0.0 86-87 0.2375 0.0 0.0 0.025 0.0 88-89 0.3125 0.0 0.0 0.025 0.0 90-91 0.4125 0.0 0.0 0.025 0.0 92-93 0.525 0.0 0.0 0.025 0.0 94-95 0.75 0.0 0.0 0.025 0.0 96-97 0.875 0.0 0.0 0.025 0.0 98-99 1.1125 0.025 0.0 0.025 0.0 100-101 1.1875 0.025 0.0 0.025 0.0 102-103 1.4625 0.025 0.0 0.025 0.0 104-105 1.6625 0.025 0.0 0.025 0.0 106-107 1.9125 0.025 0.0 0.025 0.0 108-109 2.1375 0.025 0.0 0.025 0.0 110-111 2.5 0.025 0.0 0.025 0.0 112-113 2.8625 0.025 0.0 0.025 0.0 114-115 3.2874999999999996 0.025 0.0 0.025 0.0 116-117 3.6625 0.025 0.0 0.025 0.0 118-119 3.9625 0.025 0.0 0.025 0.0 120-121 4.35 0.025 0.0 0.025 0.0 122-123 4.8625 0.025 0.0 0.025 0.0 124-125 5.2625 0.025 0.0 0.025 0.0 126-127 5.7125 0.025 0.0 0.025 0.0 128-129 6.0875 0.025 0.0 0.025 0.0 130-131 6.525 0.025 0.0 0.025 0.0 132-133 6.887499999999999 0.025 0.0 0.025 0.0 134-135 7.5375 0.025 0.0 0.025 0.0 136-137 8.1375 0.025 0.0 0.025 0.0 138-139 8.7625 0.025 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7405 33.0 33.0 34.0 32.0 34.0 2 32.8285 34.0 33.0 34.0 32.0 34.0 3 32.8295 34.0 33.0 34.0 32.0 34.0 4 32.8215 34.0 33.0 34.0 32.0 34.0 5 32.9165 34.0 33.0 34.0 32.0 34.0 6 37.017 38.0 38.0 38.0 36.0 38.0 7 36.97675 38.0 38.0 38.0 36.0 38.0 8 36.94125 38.0 38.0 38.0 36.0 38.0 9 36.97875 38.0 38.0 38.0 36.0 38.0 10-14 36.90425 38.0 38.0 38.0 35.8 38.0 15-19 36.793699999999994 38.0 38.0 38.0 35.2 38.0 20-24 36.83015 38.0 38.0 38.0 35.6 38.0 25-29 36.89155 38.0 38.0 38.0 35.8 38.0 30-34 36.83085 38.0 38.0 38.0 35.6 38.0 35-39 36.80335 38.0 38.0 38.0 35.6 38.0 40-44 36.831450000000004 38.0 38.0 38.0 35.6 38.0 45-49 36.8667 38.0 38.0 38.0 35.8 38.0 50-54 36.85979999999999 38.0 38.0 38.0 35.6 38.0 55-59 36.7354 38.0 38.0 38.0 35.2 38.0 60-64 36.53190000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.518100000000004 38.0 38.0 38.0 33.8 38.0 70-74 36.5047 38.0 38.0 38.0 34.0 38.0 75-79 36.5585 38.0 38.0 38.0 34.2 38.0 80-84 36.4895 38.0 38.0 38.0 34.0 38.0 85-89 36.293 38.0 38.0 38.0 33.4 38.0 90-94 36.22375 38.0 38.0 38.0 33.2 38.0 95-99 36.1393 38.0 38.0 38.0 33.2 38.0 100-104 36.0264 38.0 37.2 38.0 32.2 38.0 105-109 35.758900000000004 38.0 37.0 38.0 30.8 38.0 110-114 35.61205 38.0 37.0 38.0 29.4 38.0 115-119 35.64829999999999 38.0 36.8 38.0 30.6 38.0 120-124 35.195499999999996 38.0 35.8 38.0 27.6 38.0 125-129 35.31535 38.0 36.0 38.0 28.2 38.0 130-134 35.021249999999995 38.0 35.2 38.0 26.6 38.0 135-139 34.4546 38.0 34.8 38.0 23.2 38.0 140-144 33.99405 38.0 34.0 38.0 21.8 38.0 145-149 33.9562 38.0 33.6 38.0 21.8 38.0 150-151 31.290875 35.5 28.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 7.0 17 12.0 18 8.0 19 5.0 20 6.0 21 9.0 22 12.0 23 8.0 24 14.0 25 18.0 26 27.0 27 37.0 28 52.0 29 45.0 30 46.0 31 68.0 32 94.0 33 121.0 34 167.0 35 283.0 36 621.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55241431073305 21.79134350763072 15.986990242682012 25.66925193895422 2 27.025 26.5 28.449999999999996 18.025 3 21.224999999999998 29.025000000000002 30.275000000000002 19.475 4 23.35 33.900000000000006 24.45 18.3 5 25.825 36.5 21.65 16.025 6 21.825 38.475 22.325 17.375 7 19.425 22.125 38.45 20.0 8 23.075000000000003 25.374999999999996 27.725 23.825 9 22.325 25.6 29.325000000000003 22.75 10-14 22.945 28.585 27.12 21.349999999999998 15-19 22.835 28.349999999999998 27.900000000000002 20.915 20-24 23.119999999999997 28.27 27.900000000000002 20.71 25-29 22.97 29.285 27.250000000000004 20.495 30-34 23.16 28.65 27.57 20.62 35-39 23.505000000000003 28.310000000000002 27.439999999999998 20.745 40-44 23.544999999999998 28.455000000000002 27.52 20.48 45-49 22.439999999999998 28.854999999999997 27.750000000000004 20.955 50-54 23.005 29.154999999999998 27.555000000000003 20.285 55-59 23.42117105855293 28.186409320466023 27.65638281914096 20.73603680184009 60-64 23.205000000000002 28.144999999999996 27.58 21.07 65-69 22.884999999999998 28.775000000000002 27.639999999999997 20.7 70-74 23.775 28.305000000000003 27.615000000000002 20.305 75-79 22.965 28.615000000000002 27.534999999999997 20.885 80-84 23.96 28.189999999999998 27.66 20.19 85-89 23.77 27.794999999999998 27.589999999999996 20.845 90-94 23.515 28.735 27.265 20.485 95-99 23.99239923992399 28.577857785778576 27.42774277427743 20.00200020002 100-104 24.488570999849948 28.559995998599508 27.019456809883458 19.931976191667083 105-109 24.31972789115646 28.42637054821929 27.601040416166466 19.652861144457784 110-114 25.372686343171587 27.908954477238616 27.158579289644823 19.559779889944974 115-119 24.322296689006702 27.9333800140042 27.87836350905272 19.86595978793638 120-124 24.09620481024051 28.026401320066004 27.626381319065953 20.251012550627532 125-129 25.22 27.865000000000002 27.055 19.86 130-134 24.834999999999997 27.500000000000004 27.994999999999997 19.67 135-139 25.217521752175216 27.872787278727873 27.467746774677465 19.44194419441944 140-144 25.80032012805122 27.721088435374146 26.925770308123248 19.55282112845138 145-149 25.724148281554854 28.20551303216769 26.814748111461306 19.255590574816146 150-151 26.169627220415308 26.619964973730298 27.47060295221416 19.73980485364023 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 3.0 28 3.5 29 7.0 30 8.0 31 14.0 32 22.0 33 26.0 34 36.5 35 55.0 36 83.0 37 116.5 38 152.5 39 174.5 40 211.5 41 249.5 42 267.5 43 295.0 44 314.0 45 304.0 46 274.5 47 255.0 48 237.5 49 200.5 50 158.0 51 124.0 52 105.0 53 81.5 54 52.5 55 37.5 56 29.0 57 21.0 58 14.5 59 10.5 60 6.5 61 8.5 62 10.5 63 10.0 64 6.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.034999999999999996 105-109 0.04 110-114 0.05 115-119 0.03 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.04 145-149 0.055 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.3015075376884422 0.6 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02512562814070352 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.3625 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCTT 10 0.006830828 145.0 6 >>END_MODULE Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828326 spots for SRR7171437.sra Written 828326 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra Read 828323 spots for SRR7171437.sra Written 828323 spots for SRR7171437.sra SRR ids: ['SRR7171437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_byvs2esn SRR7171437.sra spots: 16566463 blocks: [[1, 828323], [828324, 1656646], [1656647, 2484969], [2484970, 3313292], [3313293, 4141615], [4141616, 4969938], [4969939, 5798261], [5798262, 6626584], [6626585, 7454907], [7454908, 8283230], [8283231, 9111553], [9111554, 9939876], [9939877, 10768199], [10768200, 11596522], [11596523, 12424845], [12424846, 13253168], [13253169, 14081491], [14081492, 14909814], [14909815, 15738137], [15738138, 16566463]] SRR7171437 file size 5592130 SRR7171437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171437 SRR7171437_1.fastq SRR7171437_2.fastq Input file: SRR7171437_1.fastq Paired file: SRR7171437_2.fastq trimmed: SRR7171437-trimmed-pair1.fastq, SRR7171437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:38:07 2025 >> started Fri Feb 14 08:38:24 2025 >> done (16.931s) 16566463 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 1915 ( 0.01%) empty read pairs filtered out after trimming by size control 16564454 (99.99%) read pairs available; of these: 2216541 (13.38%) trimmed read pairs available after processing 14347913 (86.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 3 0.00% 34 4 0.00% 35 1 0.00% 36 2 0.00% 37 2 0.00% 38 3 0.00% 39 2 0.00% 40 4 0.00% 41 6 0.00% 42 4 0.00% 43 11 0.00% 44 16 0.00% 45 17 0.00% 46 8 0.00% 47 16 0.00% 48 20 0.00% 49 22 0.00% 50 32 0.00% 51 41 0.00% 52 30 0.00% 53 45 0.00% 54 45 0.00% 55 56 0.00% 56 55 0.00% 57 58 0.00% 58 107 0.00% 59 125 0.00% 60 111 0.00% 61 135 0.00% 62 138 0.00% 63 169 0.00% 64 244 0.00% 65 277 0.00% 66 303 0.00% 67 345 0.00% 68 398 0.00% 69 467 0.00% 70 577 0.00% 71 640 0.00% 72 750 0.00% 73 891 0.01% 74 1003 0.01% 75 1188 0.01% 76 1376 0.01% 77 1473 0.01% 78 1639 0.01% 79 1917 0.01% 80 2095 0.01% 81 2528 0.02% 82 2901 0.02% 83 3246 0.02% 84 3775 0.02% 85 4045 0.02% 86 4671 0.03% 87 4932 0.03% 88 5287 0.03% 89 5811 0.04% 90 6386 0.04% 91 7150 0.04% 92 7815 0.05% 93 8759 0.05% 94 9466 0.06% 95 10235 0.06% 96 10933 0.07% 97 11581 0.07% 98 12174 0.07% 99 12978 0.08% 100 14114 0.09% 101 14898 0.09% 102 15757 0.10% 103 17110 0.10% 104 18020 0.11% 105 19178 0.12% 106 20230 0.12% 107 20832 0.13% 108 21630 0.13% 109 22511 0.14% 110 23493 0.14% 111 24412 0.15% 112 25603 0.15% 113 27153 0.16% 114 28650 0.17% 115 30185 0.18% 116 30939 0.19% 117 32610 0.20% 118 35033 0.21% 119 33479 0.20% 120 34015 0.21% 121 35148 0.21% 122 36216 0.22% 123 37492 0.23% 124 39325 0.24% 125 40171 0.24% 126 41916 0.25% 127 42761 0.26% 128 43651 0.26% 129 44268 0.27% 130 45167 0.27% 131 45851 0.28% 132 46988 0.28% 133 48514 0.29% 134 50223 0.30% 135 51311 0.31% 136 53379 0.32% 137 53836 0.33% 138 54582 0.33% 139 55666 0.34% 140 56228 0.34% 141 57246 0.35% 142 61262 0.37% 143 59926 0.36% 144 61954 0.37% 145 64153 0.39% 146 62018 0.37% 147 66200 0.40% 148 64766 0.39% 149 65615 0.40% 150 69300 0.42% 151 14347913 86.62% 16564454 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=17.56 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.4 sequence=AAATCTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=28 prefix-density=0.60 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=42.15 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.6 sequence=GAGAAGGCAATGAGAGATGC SRR7171437 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:39:35 Started mapping on | Feb 14 08:39:36 Finished on | Feb 14 08:41:19 Mapping speed, Million of reads per hour | 578.95 Number of input reads | 16564454 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15438791 Uniquely mapped reads % | 93.20% Average mapped length | 294.61 Number of splices: Total | 15341731 Number of splices: Annotated (sjdb) | 15051746 Number of splices: GT/AG | 15091818 Number of splices: GC/AG | 199592 Number of splices: AT/AC | 11142 Number of splices: Non-canonical | 39179 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423209 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 140673 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 702454 702454 702454 N_multimapping 423209 423209 423209 N_noFeature 375455 15304087 428778 N_ambiguous 158846 1313 76642 UnstrandedReadsAssigned:14904490 PositiveStrandReadsAssigned:133391 NegativeStrandReadsAssigned:14933371 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171437-trimmed-pair1.fastq SRR7171437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,564,454 reads, 15,047,163 reads pseudoaligned [quant] estimated average fragment length: 227.547 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7171437.ke.tsv 34699 SRR7171437.se.tsv 87100 total ==> SRR7171437.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.45 1401 50.1 Potri.005G024800.1.v4.1 1035 808.453 287 22.7422 Potri.004G059700.1.v4.1 961 734.458 11 0.959469 Potri.007G009000.2.v4.1 1416 1189.45 0 0 Potri.003G141000.2.v4.1 2943 2716.45 753.375 17.767 Potri.016G087400.1.v4.1 270 85.854 1413 1054.35 Potri.015G069301.1.v4.1 564 340.251 0 0 Potri.010G195200.1.v4.1 1773 1546.45 696 28.8322 Potri.012G127500.1.v4.1 977 750.453 2880 245.852 ==> SRR7171437.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 444 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 217 SRR7171437 completed mapping pipeline successfully