Starting /dee2/code/volunteer_pipeline.sh SRR7171438 current disk space = 3116777701376 free memory = 1578159032 SRR7171438 SRAfilesize cb44cfb7337fcb9229cdb8f33af49628 SRR7171438.sra SRR7171438.sra file validated SRR7171438 is paired end SRR7171438 is conventional basespace SRR7171438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.555 18.0 18.0 25.0 18.0 32.0 2 23.53875 25.0 18.0 28.0 18.0 31.0 3 26.07275 27.0 18.0 32.0 18.0 32.0 4 28.59025 29.0 27.0 31.0 25.0 33.0 5 31.00925 32.0 32.0 33.0 27.0 33.0 6 36.453 37.0 36.0 38.0 34.0 38.0 7 37.01475 38.0 38.0 38.0 35.0 38.0 8 37.20625 38.0 38.0 38.0 36.0 38.0 9 37.26225 38.0 38.0 38.0 36.0 38.0 10-14 37.314 38.0 38.0 38.0 36.6 38.0 15-19 37.42215 38.0 38.0 38.0 37.2 38.0 20-24 37.4106 38.0 38.0 38.0 37.0 38.0 25-29 37.3137 38.0 38.0 38.0 37.0 38.0 30-34 37.308749999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.247949999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.213350000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.215199999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.17895 38.0 38.0 38.0 36.4 38.0 55-59 37.075149999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.9563 38.0 38.0 38.0 35.6 38.0 65-69 36.82515 38.0 38.0 38.0 35.0 38.0 70-74 36.84595 38.0 38.0 38.0 35.0 38.0 75-79 36.8729 38.0 38.0 38.0 35.2 38.0 80-84 36.65815 38.0 38.0 38.0 34.2 38.0 85-89 36.4208 38.0 38.0 38.0 34.0 38.0 90-94 36.4008 38.0 38.0 38.0 34.0 38.0 95-99 36.464150000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.27715 38.0 37.2 38.0 33.6 38.0 105-109 36.06080000000001 38.0 37.0 38.0 32.6 38.0 110-114 35.9404 38.0 37.0 38.0 31.8 38.0 115-119 35.7303 38.0 36.6 38.0 30.6 38.0 120-124 35.468 38.0 36.0 38.0 28.8 38.0 125-129 35.4113 38.0 35.8 38.0 28.8 38.0 130-134 35.333549999999995 38.0 35.6 38.0 28.6 38.0 135-139 35.044349999999994 38.0 35.0 38.0 27.8 38.0 140-144 34.65214999999999 38.0 34.8 38.0 25.2 38.0 145-149 34.2896 38.0 34.0 38.0 23.2 38.0 150-151 32.140625 36.0 28.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 3.0 23 7.0 24 13.0 25 7.0 26 11.0 27 13.0 28 32.0 29 41.0 30 50.0 31 89.0 32 99.0 33 146.0 34 208.0 35 392.0 36 985.0 37 1901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.11227353916815 8.87981627966318 12.120438887471293 38.887471293697374 2 25.544158118588946 13.485113835376533 33.77533149862397 27.195396547410557 3 21.9 17.150000000000002 27.975 32.975 4 24.675 24.425 23.724999999999998 27.175 5 25.374999999999996 27.750000000000004 25.900000000000002 20.974999999999998 6 19.675 34.075 24.4 21.85 7 14.374999999999998 27.35 40.725 17.549999999999997 8 18.0 25.5 31.4 25.1 9 17.1 24.25 34.949999999999996 23.7 10-14 20.135 28.875 27.405 23.585 15-19 19.865 27.794999999999998 28.255000000000003 24.085 20-24 20.305 27.83 28.18 23.685000000000002 25-29 19.82 28.754999999999995 27.505000000000003 23.919999999999998 30-34 19.415 27.860000000000003 28.18 24.545 35-39 20.419999999999998 28.215 27.894999999999996 23.47 40-44 20.125 28.425 27.325 24.125 45-49 20.31 27.985 28.035 23.669999999999998 50-54 20.165 28.43 27.589999999999996 23.815 55-59 19.845 27.644999999999996 28.585 23.925 60-64 19.66 27.925 28.315 24.099999999999998 65-69 19.994999999999997 27.794999999999998 27.834999999999997 24.375 70-74 20.266013300665033 27.976398819940997 28.026401320066004 23.731186559327966 75-79 20.125 27.74 27.889999999999997 24.245 80-84 20.044999999999998 27.73 27.97 24.255 85-89 19.885 27.965 28.535 23.615 90-94 19.905 28.110000000000003 27.975 24.01 95-99 20.89 27.85 27.72 23.54 100-104 20.595 28.13 27.694999999999997 23.580000000000002 105-109 20.724999999999998 27.55 28.005000000000003 23.72 110-114 20.41 27.815 27.875 23.9 115-119 20.833124968745313 27.684152622893432 27.794169125368807 23.68855328299245 120-124 21.345 28.035 26.784999999999997 23.835 125-129 20.62 27.46 27.46 24.46 130-134 21.48 28.065 26.745 23.71 135-139 20.985 27.544999999999998 26.979999999999997 24.490000000000002 140-144 20.68 27.58 27.115000000000002 24.625 145-149 21.305 28.125 26.16 24.41 150-151 20.6125 27.8625 26.2875 25.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 3.0 26 5.0 27 4.5 28 5.0 29 10.5 30 14.5 31 15.5 32 19.5 33 30.0 34 44.5 35 62.5 36 74.5 37 100.5 38 128.0 39 149.0 40 182.0 41 217.0 42 257.0 43 272.0 44 273.0 45 287.0 46 293.5 47 273.5 48 238.5 49 204.5 50 168.5 51 139.5 52 118.0 53 96.5 54 74.5 55 56.0 56 49.0 57 39.0 58 25.0 59 17.0 60 9.0 61 6.5 62 7.0 63 7.0 64 5.0 65 2.5 66 1.5 67 0.5 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.9500000000000002 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.3375 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.487500000000001 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.425000000000001 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.6625 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.762499999999999 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.75 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 11.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAAG 10 0.0068343505 144.975 6 AATGCTG 10 0.0068343505 144.975 9 AGTTCAA 10 0.0068343505 144.975 5 AAAAAAA 40 0.0076626483 18.121876 140-144 >>END_MODULE SRR7171438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.694 33.0 33.0 34.0 32.0 34.0 2 32.761 33.0 33.0 34.0 32.0 34.0 3 32.81725 34.0 33.0 34.0 32.0 34.0 4 32.87475 34.0 33.0 34.0 32.0 34.0 5 32.85875 34.0 33.0 34.0 32.0 34.0 6 36.95275 38.0 38.0 38.0 36.0 38.0 7 36.988 38.0 38.0 38.0 36.0 38.0 8 36.9905 38.0 38.0 38.0 36.0 38.0 9 36.9285 38.0 38.0 38.0 36.0 38.0 10-14 36.83845 38.0 38.0 38.0 35.4 38.0 15-19 36.85600000000001 38.0 38.0 38.0 35.4 38.0 20-24 36.8164 38.0 38.0 38.0 35.2 38.0 25-29 36.86409999999999 38.0 38.0 38.0 35.6 38.0 30-34 36.8275 38.0 38.0 38.0 35.6 38.0 35-39 36.853750000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.81285 38.0 38.0 38.0 35.4 38.0 45-49 36.926700000000004 38.0 38.0 38.0 35.8 38.0 50-54 36.83705 38.0 38.0 38.0 35.4 38.0 55-59 36.756550000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.53445 38.0 38.0 38.0 34.0 38.0 65-69 36.459700000000005 38.0 38.0 38.0 33.8 38.0 70-74 36.4672 38.0 38.0 38.0 34.0 38.0 75-79 36.556349999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.49325 38.0 38.0 38.0 34.0 38.0 85-89 36.349000000000004 38.0 38.0 38.0 33.6 38.0 90-94 36.154900000000005 38.0 37.8 38.0 33.2 38.0 95-99 36.09135 38.0 37.6 38.0 32.8 38.0 100-104 35.904250000000005 38.0 37.0 38.0 31.8 38.0 105-109 35.585750000000004 38.0 37.0 38.0 29.8 38.0 110-114 35.47465 38.0 36.6 38.0 29.0 38.0 115-119 35.46325 38.0 36.2 38.0 29.2 38.0 120-124 35.094550000000005 38.0 35.6 38.0 27.0 38.0 125-129 35.137649999999994 38.0 35.4 38.0 27.6 38.0 130-134 34.9587 38.0 35.2 38.0 26.6 38.0 135-139 34.33415 38.0 34.6 38.0 23.0 38.0 140-144 33.8146 38.0 33.8 38.0 21.8 38.0 145-149 33.627449999999996 38.0 33.4 38.0 21.0 38.0 150-151 30.771250000000002 34.5 26.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 5.0 18 9.0 19 7.0 20 9.0 21 9.0 22 11.0 23 12.0 24 14.0 25 23.0 26 27.0 27 31.0 28 36.0 29 55.0 30 56.0 31 82.0 32 101.0 33 115.0 34 188.0 35 336.0 36 647.0 37 2222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.648032088242665 20.280772123339183 15.818500877412886 28.252694911005268 2 26.8 26.575 28.875 17.75 3 20.75 29.625 29.95 19.675 4 24.375 34.050000000000004 22.375 19.2 5 24.45 36.05 22.225 17.275 6 21.7 37.175000000000004 23.025000000000002 18.099999999999998 7 20.825 21.8 37.275000000000006 20.1 8 21.6 26.424999999999997 26.700000000000003 25.275 9 21.375 26.5 29.049999999999997 23.075000000000003 10-14 23.936196809840492 29.411470573528675 25.646282314115705 21.006050302515124 15-19 23.352335233523352 28.15781578157816 27.482748274827486 21.007100710071008 20-24 23.715 28.194999999999997 27.465 20.625 25-29 23.845 28.53 26.96 20.665 30-34 23.015 28.43 27.725 20.830000000000002 35-39 23.155 27.905 27.834999999999997 21.105 40-44 24.025 28.59 26.650000000000002 20.735 45-49 23.465 28.13 27.705000000000002 20.7 50-54 23.2161608080404 28.07140357017851 28.16140807040352 20.55102755137757 55-59 23.769753950790157 28.11562312462493 27.620524104820966 20.494098819763952 60-64 23.819763952790556 27.745549109821965 27.470494098819763 20.964192838567712 65-69 23.76618830941547 28.606430321516076 27.191359567978402 20.436021801090053 70-74 23.91 28.439999999999998 27.215 20.435 75-79 23.244999999999997 28.255000000000003 28.07 20.43 80-84 24.4 28.09 27.250000000000004 20.26 85-89 23.685000000000002 28.439999999999998 27.405 20.47 90-94 23.32 28.349999999999998 27.52 20.810000000000002 95-99 24.482448244824482 27.73777377737774 27.09270927092709 20.687068706870686 100-104 24.487243621810904 28.08904452226113 27.283641820910454 20.14007003501751 105-109 24.398419130521788 28.61573865626094 26.869778378107963 20.11606383510931 110-114 24.56719703792655 28.249774842389673 26.65866106274392 20.52436705693986 115-119 24.8811965384423 28.38277224751138 26.767045170326647 19.968986043719674 120-124 24.732473247324734 27.83778377837784 27.202720272027204 20.22702270227023 125-129 25.525 28.21 26.355 19.91 130-134 25.259999999999998 28.744999999999997 26.365 19.63 135-139 25.240048009601924 28.630726145229048 26.605321064212845 19.52390478095619 140-144 25.76288144072036 28.30415207603802 26.123061530765384 19.809904952476238 145-149 25.99449587190393 28.401300975731797 26.39979984988742 19.20440330247686 150-151 26.498936037050946 27.825760420578295 25.597696833145577 20.077606709225186 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 3.0 28 2.5 29 4.0 30 9.0 31 15.0 32 22.5 33 33.5 34 38.5 35 46.5 36 81.0 37 101.5 38 116.0 39 156.5 40 204.0 41 247.5 42 286.5 43 297.5 44 285.0 45 273.0 46 264.5 47 262.0 48 234.5 49 200.0 50 174.0 51 148.0 52 118.5 53 85.0 54 63.0 55 49.5 56 42.0 57 33.0 58 20.0 59 14.5 60 13.5 61 14.0 62 9.5 63 4.0 64 3.0 65 4.0 66 3.0 67 1.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.02 60-64 0.02 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.05 105-109 0.055 110-114 0.06999999999999999 115-119 0.045 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.05 145-149 0.075 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.375 0.0 0.0 0.0 0.0 122-123 5.95 0.0 0.0 0.0 0.0 124-125 6.6625 0.0 0.0 0.0 0.0 126-127 7.225 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.2625 0.0 0.0 0.0 0.0 136-137 10.0625 0.0 0.0 0.0 0.0 138-139 11.149999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTAAC 10 0.006830828 145.0 6 AATGTAA 10 0.006830828 145.0 5 >>END_MODULE Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797128 spots for SRR7171438.sra Written 797128 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra Read 797110 spots for SRR7171438.sra Written 797110 spots for SRR7171438.sra SRR ids: ['SRR7171438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0wn0psz1 SRR7171438.sra spots: 15942218 blocks: [[1, 797110], [797111, 1594220], [1594221, 2391330], [2391331, 3188440], [3188441, 3985550], [3985551, 4782660], [4782661, 5579770], [5579771, 6376880], [6376881, 7173990], [7173991, 7971100], [7971101, 8768210], [8768211, 9565320], [9565321, 10362430], [10362431, 11159540], [11159541, 11956650], [11956651, 12753760], [12753761, 13550870], [13550871, 14347980], [14347981, 15145090], [15145091, 15942218]] SRR7171438 file size 5380594 SRR7171438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171438 SRR7171438_1.fastq SRR7171438_2.fastq Input file: SRR7171438_1.fastq Paired file: SRR7171438_2.fastq trimmed: SRR7171438-trimmed-pair1.fastq, SRR7171438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:25:49 2025 >> started Fri Feb 14 09:26:06 2025 >> done (16.603s) 15942218 read pairs processed; of these: 187 ( 0.00%) short read pairs filtered out after trimming by size control 3696 ( 0.02%) empty read pairs filtered out after trimming by size control 15938335 (99.98%) read pairs available; of these: 2628765 (16.49%) trimmed read pairs available after processing 13309570 (83.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 3 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 1 0.00% 35 3 0.00% 36 5 0.00% 37 4 0.00% 38 1 0.00% 39 9 0.00% 40 8 0.00% 41 9 0.00% 42 9 0.00% 43 20 0.00% 44 11 0.00% 45 17 0.00% 46 22 0.00% 47 20 0.00% 48 21 0.00% 49 31 0.00% 50 51 0.00% 51 41 0.00% 52 56 0.00% 53 73 0.00% 54 75 0.00% 55 80 0.00% 56 105 0.00% 57 112 0.00% 58 123 0.00% 59 169 0.00% 60 202 0.00% 61 268 0.00% 62 284 0.00% 63 339 0.00% 64 370 0.00% 65 428 0.00% 66 502 0.00% 67 560 0.00% 68 705 0.00% 69 739 0.00% 70 973 0.01% 71 1075 0.01% 72 1284 0.01% 73 1510 0.01% 74 1762 0.01% 75 1942 0.01% 76 2205 0.01% 77 2504 0.02% 78 2859 0.02% 79 3244 0.02% 80 3557 0.02% 81 4041 0.03% 82 4665 0.03% 83 5211 0.03% 84 5971 0.04% 85 6694 0.04% 86 7154 0.04% 87 7678 0.05% 88 8193 0.05% 89 8933 0.06% 90 9811 0.06% 91 10568 0.07% 92 11743 0.07% 93 12943 0.08% 94 13777 0.09% 95 14692 0.09% 96 15592 0.10% 97 16752 0.11% 98 17529 0.11% 99 18209 0.11% 100 19091 0.12% 101 20263 0.13% 102 21608 0.14% 103 22914 0.14% 104 24117 0.15% 105 25500 0.16% 106 26500 0.17% 107 27332 0.17% 108 28161 0.18% 109 28806 0.18% 110 29910 0.19% 111 30614 0.19% 112 32547 0.20% 113 34049 0.21% 114 35709 0.22% 115 36779 0.23% 116 37770 0.24% 117 39957 0.25% 118 42880 0.27% 119 40932 0.26% 120 41437 0.26% 121 41835 0.26% 122 43528 0.27% 123 44819 0.28% 124 46241 0.29% 125 48035 0.30% 126 49068 0.31% 127 49969 0.31% 128 50827 0.32% 129 51273 0.32% 130 52135 0.33% 131 52717 0.33% 132 54285 0.34% 133 55457 0.35% 134 56618 0.36% 135 58522 0.37% 136 59406 0.37% 137 60616 0.38% 138 60859 0.38% 139 62096 0.39% 140 61852 0.39% 141 63236 0.40% 142 68788 0.43% 143 66817 0.42% 144 67586 0.42% 145 70079 0.44% 146 68301 0.43% 147 72646 0.46% 148 70532 0.44% 149 70234 0.44% 150 74941 0.47% 151 13309570 83.51% 15938335 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=121.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.2 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=36.64 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.6 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171438 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:27:14 Started mapping on | Feb 14 09:27:15 Finished on | Feb 14 09:29:40 Mapping speed, Million of reads per hour | 395.71 Number of input reads | 15938335 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14443842 Uniquely mapped reads % | 90.62% Average mapped length | 292.58 Number of splices: Total | 14232237 Number of splices: Annotated (sjdb) | 13959278 Number of splices: GT/AG | 14001868 Number of splices: GC/AG | 181731 Number of splices: AT/AC | 11867 Number of splices: Non-canonical | 36771 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391073 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 131111 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.89% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1103420 1103420 1103420 N_multimapping 391073 391073 391073 N_noFeature 355812 14316487 412173 N_ambiguous 151854 1012 80160 UnstrandedReadsAssigned:13936176 PositiveStrandReadsAssigned:126343 NegativeStrandReadsAssigned:13951509 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171438-trimmed-pair1.fastq SRR7171438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,938,335 reads, 14,075,713 reads pseudoaligned [quant] estimated average fragment length: 218.704 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7171438.ke.tsv 34699 SRR7171438.se.tsv 87100 total ==> SRR7171438.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.3 1224 47.2297 Potri.005G024800.1.v4.1 1035 817.296 288 24.4788 Potri.004G059700.1.v4.1 961 743.307 21 1.96258 Potri.007G009000.2.v4.1 1416 1198.3 0 0 Potri.003G141000.2.v4.1 2943 2725.3 475.162 12.1117 Potri.016G087400.1.v4.1 270 90.3395 1080 830.47 Potri.015G069301.1.v4.1 564 348.822 0 0 Potri.010G195200.1.v4.1 1773 1555.3 277 12.3721 Potri.012G127500.1.v4.1 977 759.296 10324 944.527 ==> SRR7171438.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 368 SRR7171438 completed mapping pipeline successfully