Starting /dee2/code/volunteer_pipeline.sh SRR7171439 current disk space = 3088755953664 free memory = 1450488640 SRR7171439 SRAfilesize 7766f07eec2f1c3ee6d5d1212823f15b SRR7171439.sra SRR7171439.sra file validated SRR7171439 is paired end SRR7171439 is conventional basespace SRR7171439 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.80575 33.0 31.0 33.0 25.0 34.0 2 28.35575 31.0 27.0 33.0 18.0 33.0 3 31.5585 33.0 32.0 33.0 28.0 33.0 4 32.35825 33.0 33.0 33.0 32.0 34.0 5 32.5625 33.0 33.0 33.0 32.0 34.0 6 36.873 38.0 37.0 38.0 35.0 38.0 7 37.25525 38.0 38.0 38.0 36.0 38.0 8 37.47175 38.0 38.0 38.0 37.0 38.0 9 37.5445 38.0 38.0 38.0 37.0 38.0 10-14 37.535900000000005 38.0 38.0 38.0 37.6 38.0 15-19 37.531150000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.50940000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.50535 38.0 38.0 38.0 37.8 38.0 30-34 37.4982 38.0 38.0 38.0 37.8 38.0 35-39 37.433099999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.435700000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.43595 38.0 38.0 38.0 37.0 38.0 50-54 37.37965 38.0 38.0 38.0 37.0 38.0 55-59 37.2977 38.0 38.0 38.0 37.0 38.0 60-64 37.2324 38.0 38.0 38.0 37.0 38.0 65-69 37.09785000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.0111 38.0 38.0 38.0 36.0 38.0 75-79 37.0306 38.0 38.0 38.0 36.0 38.0 80-84 36.932550000000006 38.0 38.0 38.0 35.8 38.0 85-89 37.0415 38.0 38.0 38.0 36.0 38.0 90-94 37.02555 38.0 38.0 38.0 36.0 38.0 95-99 36.90565 38.0 38.0 38.0 35.6 38.0 100-104 36.7415 38.0 38.0 38.0 34.8 38.0 105-109 36.646550000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.672700000000006 38.0 38.0 38.0 34.4 38.0 115-119 36.548 38.0 38.0 38.0 34.0 38.0 120-124 36.47405 38.0 38.0 38.0 34.0 38.0 125-129 36.4473 38.0 38.0 38.0 34.0 38.0 130-134 36.290099999999995 38.0 37.6 38.0 33.6 38.0 135-139 36.1666 38.0 37.4 38.0 33.2 38.0 140-144 35.977500000000006 38.0 36.4 38.0 33.0 38.0 145-149 35.7384 38.0 36.0 38.0 31.4 38.0 150-151 33.84075 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 5.0 23 3.0 24 7.0 25 6.0 26 11.0 27 12.0 28 16.0 29 30.0 30 38.0 31 44.0 32 59.0 33 96.0 34 112.0 35 196.0 36 527.0 37 2837.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.73422177520744 12.044254463163188 9.353784259492079 37.86773950213729 2 20.1 14.875 33.900000000000006 31.125000000000004 3 19.775000000000002 18.9 24.625 36.7 4 23.200000000000003 27.425 22.6 26.775 5 22.825 32.225 24.525 20.424999999999997 6 18.8 36.425000000000004 25.374999999999996 19.400000000000002 7 13.975000000000001 26.025 42.075 17.925 8 17.775 24.9 32.0 25.324999999999996 9 17.625 23.35 33.925 25.1 10-14 20.03 29.375 27.72 22.875 15-19 19.744999999999997 28.799999999999997 27.544999999999998 23.91 20-24 19.735 28.244999999999997 28.15 23.87 25-29 19.685 28.89 27.894999999999996 23.53 30-34 19.81 29.01 27.51 23.669999999999998 35-39 20.46 28.155 27.355 24.03 40-44 20.185 28.62 27.560000000000002 23.635 45-49 19.695 28.744999999999997 27.685 23.875 50-54 19.78 28.74 27.275 24.205 55-59 20.52 28.435 27.279999999999998 23.765 60-64 19.705000000000002 28.53 27.800000000000004 23.965 65-69 20.06 27.96 27.694999999999997 24.285 70-74 20.45 28.43 26.979999999999997 24.14 75-79 19.755 28.23 28.22 23.794999999999998 80-84 20.135 28.24 27.939999999999998 23.685000000000002 85-89 20.244999999999997 28.299999999999997 27.685 23.77 90-94 20.34 27.965 27.76 23.935000000000002 95-99 20.05 28.585 27.79 23.575 100-104 20.76 28.285 27.584999999999997 23.369999999999997 105-109 20.59 28.065 27.62 23.724999999999998 110-114 20.085 28.34 27.889999999999997 23.685000000000002 115-119 20.265 28.76 27.48 23.494999999999997 120-124 20.62 28.449999999999996 27.169999999999998 23.76 125-129 20.87 28.15 27.055 23.925 130-134 20.57 28.244999999999997 27.295 23.89 135-139 20.365 28.29 26.700000000000003 24.645 140-144 21.125 27.63 27.115000000000002 24.13 145-149 20.86 28.050000000000004 26.91 24.18 150-151 20.75 28.575 27.175 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 3.5 26 5.5 27 6.5 28 11.5 29 15.0 30 16.5 31 19.0 32 25.5 33 35.5 34 46.0 35 57.5 36 86.5 37 118.5 38 145.5 39 167.0 40 184.0 41 218.0 42 239.5 43 257.5 44 281.0 45 273.5 46 266.0 47 259.0 48 221.0 49 197.5 50 185.0 51 148.5 52 116.0 53 97.5 54 72.5 55 53.0 56 38.0 57 29.5 58 25.0 59 20.0 60 16.5 61 11.0 62 9.5 63 6.0 64 3.5 65 2.0 66 1.0 67 1.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.2375 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171439 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94 33.0 33.0 34.0 32.0 34.0 2 33.02625 34.0 33.0 34.0 32.0 34.0 3 33.0545 34.0 33.0 34.0 32.0 34.0 4 33.01425 34.0 33.0 34.0 32.0 34.0 5 32.932 34.0 33.0 34.0 32.0 34.0 6 37.0995 38.0 38.0 38.0 37.0 38.0 7 37.08625 38.0 38.0 38.0 37.0 38.0 8 37.103 38.0 38.0 38.0 37.0 38.0 9 37.133 38.0 38.0 38.0 37.0 38.0 10-14 37.10195 38.0 38.0 38.0 37.0 38.0 15-19 37.0682 38.0 38.0 38.0 36.8 38.0 20-24 37.04545 38.0 38.0 38.0 36.6 38.0 25-29 37.0828 38.0 38.0 38.0 36.8 38.0 30-34 37.040150000000004 38.0 38.0 38.0 36.4 38.0 35-39 37.01525 38.0 38.0 38.0 36.0 38.0 40-44 36.38595 37.8 37.4 38.0 33.2 38.0 45-49 36.90155 38.0 38.0 38.0 36.0 38.0 50-54 36.9308 38.0 38.0 38.0 36.0 38.0 55-59 36.87755 38.0 38.0 38.0 36.0 38.0 60-64 36.8617 38.0 38.0 38.0 35.8 38.0 65-69 36.86155 38.0 38.0 38.0 36.0 38.0 70-74 36.853300000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.9011 38.0 38.0 38.0 36.0 38.0 80-84 36.82 38.0 38.0 38.0 35.2 38.0 85-89 36.72525 38.0 38.0 38.0 35.0 38.0 90-94 36.6252 38.0 38.0 38.0 34.6 38.0 95-99 36.535250000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.45035 38.0 38.0 38.0 34.0 38.0 105-109 36.34394999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.29765 38.0 38.0 38.0 33.8 38.0 115-119 36.118100000000005 38.0 37.8 38.0 33.0 38.0 120-124 35.909150000000004 38.0 37.2 38.0 32.2 38.0 125-129 35.8948 38.0 37.0 38.0 31.6 38.0 130-134 35.6921 38.0 36.2 38.0 31.0 38.0 135-139 35.516000000000005 38.0 36.0 38.0 31.0 38.0 140-144 35.26335 38.0 36.0 38.0 28.8 38.0 145-149 35.1053 38.0 35.0 38.0 28.0 38.0 150-151 32.563125 35.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 3.0 20 4.0 21 4.0 22 6.0 23 14.0 24 10.0 25 20.0 26 27.0 27 24.0 28 39.0 29 37.0 30 45.0 31 61.0 32 63.0 33 81.0 34 125.0 35 215.0 36 472.0 37 2738.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 18.55 15.65 27.474999999999998 2 26.151151151151154 25.3003003003003 29.57957957957958 18.96896896896897 3 20.080120180270406 28.16725087631447 32.29844767150726 19.45418127190786 4 24.73710565848773 31.77265898848272 24.586880320480724 18.903355032548824 5 24.04904904904905 36.511511511511515 22.4974974974975 16.941941941941945 6 21.807711567351028 36.75513269904857 23.209814722083124 18.227341011517275 7 19.529293940911366 22.8592889334001 37.656484727090636 19.954932398597897 8 21.75763645468202 25.237856785177765 28.192288432648972 24.812218327491237 9 22.358537806710068 25.41311967951928 30.095142714071105 22.13319979969955 10-14 22.944416624937407 28.96845267901853 26.790185277916873 21.29694541812719 15-19 23.15973960941412 28.067100650976464 27.68652979469204 21.086629944917377 20-24 22.62393590385578 28.893340010015024 27.95192789183776 20.530796194291437 25-29 23.128536377747736 28.786740774122478 27.489860297431274 20.59486255069851 30-34 23.690398759193478 27.91814679541702 27.522889878420976 20.86856456696853 35-39 22.914582916583317 28.550710142028407 27.590518103620727 20.944188837767552 40-44 23.03688504078875 28.50708172764126 27.70632100495471 20.749712226615287 45-49 23.569175304191077 28.07070251865205 27.695157979069652 20.664964198087226 50-54 22.8342513770656 28.077115673510267 28.292438657986978 20.796194291437157 55-59 23.074611917876815 28.04206309464196 28.147220831246873 20.736104156234354 60-64 23.515272909364047 27.566349524286434 28.547821732598898 20.370555833750625 65-69 23.79593471512967 27.956343246220083 27.65595273856013 20.591769300090117 70-74 23.5997199439888 28.190638127625522 27.715543108621727 20.494098819763952 75-79 23.25 27.565 28.189999999999998 20.995 80-84 23.805 28.060000000000002 27.605 20.53 85-89 23.5370611183355 28.008402520756228 27.658297489246774 20.796238871661497 90-94 23.853394752653713 27.658722211095533 28.514920889244944 19.972962147005806 95-99 23.960941412118178 28.467701552328496 27.631447170756136 19.939909864797194 100-104 23.88059701492537 28.34318341180006 27.6419913853551 20.13422818791946 105-109 23.894425802574247 27.610557419742577 28.512044874042168 19.98297190364101 110-114 24.663228003405276 28.248785617707444 26.99183734788923 20.09614903099805 115-119 24.061091637456183 28.212318477716575 27.366049073610416 20.360540811216826 120-124 24.536805207811717 27.70155232849274 27.691537305958942 20.070105157736602 125-129 24.91868901676257 27.695771828871653 27.435576682511886 19.94996247185389 130-134 24.90868151113335 27.935951963972975 27.20040030022517 19.954966224668503 135-139 25.7035553329995 28.13219829744617 26.81522283425138 19.349023535302955 140-144 25.03505608974359 27.63922275641026 27.44891826923077 19.876802884615387 145-149 25.827615565683377 27.97616066509741 27.06966494716282 19.126558822056396 150-151 25.938908362543817 28.004506760140206 26.4521782674011 19.604406609914875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 1.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 1.0 26 1.5 27 2.0 28 4.0 29 5.5 30 9.5 31 13.5 32 17.0 33 29.0 34 41.0 35 68.0 36 89.0 37 108.0 38 142.0 39 173.5 40 218.0 41 247.5 42 261.0 43 285.0 44 298.5 45 295.5 46 265.0 47 236.5 48 223.5 49 189.5 50 157.0 51 143.5 52 116.0 53 85.0 54 67.0 55 50.0 56 39.5 57 30.5 58 22.0 59 12.5 60 7.5 61 7.0 62 7.0 63 5.5 64 2.5 65 1.5 66 2.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.15 4 0.15 5 0.1 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.15 25-29 0.145 30-34 0.065 35-39 0.02 40-44 0.095 45-49 0.145 50-54 0.15 55-59 0.15 60-64 0.15 65-69 0.13 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.03 90-94 0.13999999999999999 95-99 0.15 100-104 0.16999999999999998 105-109 0.165 110-114 0.155 115-119 0.15 120-124 0.15 125-129 0.075 130-134 0.075 135-139 0.15 140-144 0.16 145-149 0.165 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3375000000000004 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.2375 0.0 0.0 0.0 0.0 134-135 6.800000000000001 0.0 0.0 0.0 0.0 136-137 7.3375 0.0 0.0 0.0 0.0 138-139 7.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 803015 spots for SRR7171439.sra Written 803015 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra Read 802997 spots for SRR7171439.sra Written 802997 spots for SRR7171439.sra SRR ids: ['SRR7171439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gm4t3_vr SRR7171439.sra spots: 16059958 blocks: [[1, 802997], [802998, 1605994], [1605995, 2408991], [2408992, 3211988], [3211989, 4014985], [4014986, 4817982], [4817983, 5620979], [5620980, 6423976], [6423977, 7226973], [7226974, 8029970], [8029971, 8832967], [8832968, 9635964], [9635965, 10438961], [10438962, 11241958], [11241959, 12044955], [12044956, 12847952], [12847953, 13650949], [13650950, 14453946], [14453947, 15256943], [15256944, 16059958]] SRR7171439 file size 5420492 SRR7171439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171439 SRR7171439_1.fastq SRR7171439_2.fastq Input file: SRR7171439_1.fastq Paired file: SRR7171439_2.fastq trimmed: SRR7171439-trimmed-pair1.fastq, SRR7171439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:54:57 2025 >> started Thu Feb 13 17:55:14 2025 >> done (17.271s) 16059958 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1076 ( 0.01%) empty read pairs filtered out after trimming by size control 16058861 (99.99%) read pairs available; of these: 1974542 (12.30%) trimmed read pairs available after processing 14084319 (87.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 3 0.00% 36 5 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 6 0.00% 41 3 0.00% 42 5 0.00% 43 4 0.00% 44 6 0.00% 45 11 0.00% 46 13 0.00% 47 13 0.00% 48 13 0.00% 49 18 0.00% 50 19 0.00% 51 19 0.00% 52 26 0.00% 53 21 0.00% 54 31 0.00% 55 53 0.00% 56 61 0.00% 57 65 0.00% 58 81 0.00% 59 85 0.00% 60 103 0.00% 61 115 0.00% 62 128 0.00% 63 139 0.00% 64 204 0.00% 65 221 0.00% 66 262 0.00% 67 273 0.00% 68 395 0.00% 69 445 0.00% 70 467 0.00% 71 607 0.00% 72 653 0.00% 73 808 0.01% 74 904 0.01% 75 1034 0.01% 76 1203 0.01% 77 1353 0.01% 78 1470 0.01% 79 1741 0.01% 80 2007 0.01% 81 2228 0.01% 82 2575 0.02% 83 2921 0.02% 84 3323 0.02% 85 3521 0.02% 86 3938 0.02% 87 4418 0.03% 88 4701 0.03% 89 5116 0.03% 90 5594 0.03% 91 6291 0.04% 92 6806 0.04% 93 7515 0.05% 94 8239 0.05% 95 8728 0.05% 96 9580 0.06% 97 10085 0.06% 98 10849 0.07% 99 11320 0.07% 100 12126 0.08% 101 13054 0.08% 102 13874 0.09% 103 14525 0.09% 104 15432 0.10% 105 16448 0.10% 106 17337 0.11% 107 17906 0.11% 108 19147 0.12% 109 19452 0.12% 110 20208 0.13% 111 21050 0.13% 112 22291 0.14% 113 23603 0.15% 114 24332 0.15% 115 25459 0.16% 116 26695 0.17% 117 28376 0.18% 118 29948 0.19% 119 29543 0.18% 120 29574 0.18% 121 30628 0.19% 122 31603 0.20% 123 33158 0.21% 124 34407 0.21% 125 35346 0.22% 126 36719 0.23% 127 37317 0.23% 128 38291 0.24% 129 39376 0.25% 130 40043 0.25% 131 40746 0.25% 132 42056 0.26% 133 43473 0.27% 134 44639 0.28% 135 46488 0.29% 136 47698 0.30% 137 48040 0.30% 138 48945 0.30% 139 50030 0.31% 140 50879 0.32% 141 53530 0.33% 142 54893 0.34% 143 54350 0.34% 144 58997 0.37% 145 58396 0.36% 146 57384 0.36% 147 59580 0.37% 148 60020 0.37% 149 59962 0.37% 150 64299 0.40% 151 14084319 87.70% 16058861 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=112.43 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=20.4 sequence=CCTTCTTCTCAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.24 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=3.9 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=78.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.0 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7171439 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:55:57 Started mapping on | Feb 13 17:55:58 Finished on | Feb 13 17:58:10 Mapping speed, Million of reads per hour | 437.97 Number of input reads | 16058861 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14819858 Uniquely mapped reads % | 92.28% Average mapped length | 295.07 Number of splices: Total | 14257252 Number of splices: Annotated (sjdb) | 13978070 Number of splices: GT/AG | 14024617 Number of splices: GC/AG | 180012 Number of splices: AT/AC | 10668 Number of splices: Non-canonical | 41955 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449528 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 100448 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 789475 789475 789475 N_multimapping 449528 449528 449528 N_noFeature 430553 14678064 491461 N_ambiguous 166460 912 85036 UnstrandedReadsAssigned:14222845 PositiveStrandReadsAssigned:140882 NegativeStrandReadsAssigned:14243361 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171439-trimmed-pair1.fastq SRR7171439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,058,861 reads, 14,365,085 reads pseudoaligned [quant] estimated average fragment length: 227.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR7171439.ke.tsv 34699 SRR7171439.se.tsv 87100 total ==> SRR7171439.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.05 1344 52.2481 Potri.005G024800.1.v4.1 1035 808.045 433 37.3104 Potri.004G059700.1.v4.1 961 734.052 82 7.77795 Potri.007G009000.2.v4.1 1416 1189.05 0 0 Potri.003G141000.2.v4.1 2943 2716.05 537.816 13.7871 Potri.016G087400.1.v4.1 270 83.5383 854 711.787 Potri.015G069301.1.v4.1 564 339.798 0 0 Potri.010G195200.1.v4.1 1773 1546.05 393 17.699 Potri.012G127500.1.v4.1 977 750.045 6431 596.993 ==> SRR7171439.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 447 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 251 SRR7171439 completed mapping pipeline successfully