Starting /dee2/code/volunteer_pipeline.sh SRR7171440 current disk space = 3088350552064 free memory = 1475172656 SRR7171440 SRAfilesize 799455ea0a0b3a1610ea48940ef25ea2 SRR7171440.sra SRR7171440.sra file validated SRR7171440 is paired end SRR7171440 is conventional basespace SRR7171440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74775 34.0 33.0 34.0 32.0 34.0 2 33.17625 34.0 33.0 34.0 32.0 34.0 3 32.989 34.0 33.0 34.0 32.0 34.0 4 33.1405 34.0 33.0 34.0 32.0 34.0 5 33.20725 34.0 33.0 34.0 33.0 34.0 6 36.76375 38.0 37.0 38.0 35.0 38.0 7 37.35625 38.0 38.0 38.0 37.0 38.0 8 37.44225 38.0 38.0 38.0 37.0 38.0 9 37.492 38.0 38.0 38.0 38.0 38.0 10-14 37.5219 38.0 38.0 38.0 37.8 38.0 15-19 37.4747 38.0 38.0 38.0 37.2 38.0 20-24 37.49249999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.420100000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.38775 38.0 38.0 38.0 37.2 38.0 35-39 37.39605 38.0 38.0 38.0 37.0 38.0 40-44 37.37505 38.0 38.0 38.0 37.0 38.0 45-49 37.42145000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.40859999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.35675 38.0 38.0 38.0 37.0 38.0 60-64 37.310900000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.297549999999994 38.0 38.0 38.0 36.8 38.0 70-74 37.1049 38.0 38.0 38.0 36.0 38.0 75-79 37.114999999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.08815 38.0 38.0 38.0 36.0 38.0 85-89 37.0509 38.0 38.0 38.0 35.8 38.0 90-94 36.985949999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.717200000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.53255 38.0 38.0 38.0 34.0 38.0 105-109 36.55695 38.0 38.0 38.0 34.0 38.0 110-114 36.493449999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.5835 38.0 38.0 38.0 34.2 38.0 120-124 36.49250000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.433800000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.131750000000004 38.0 37.2 38.0 33.4 38.0 135-139 35.919200000000004 38.0 36.4 38.0 32.0 38.0 140-144 35.70715 38.0 36.0 38.0 31.0 38.0 145-149 35.684999999999995 38.0 36.0 38.0 31.4 38.0 150-151 33.458625 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 1.0 24 5.0 25 7.0 26 11.0 27 24.0 28 20.0 29 20.0 30 32.0 31 54.0 32 54.0 33 71.0 34 135.0 35 226.0 36 514.0 37 2824.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.651932306137915 10.457186158120738 10.305632735539277 37.58524880020207 2 21.85 15.5 33.225 29.425 3 21.75 18.15 24.2 35.9 4 24.125 26.275 22.3 27.3 5 24.099999999999998 29.799999999999997 23.925 22.175 6 19.15 34.699999999999996 24.525 21.625 7 14.549999999999999 25.924999999999997 41.4 18.125 8 17.175 25.7 31.674999999999997 25.45 9 17.05 25.4 34.125 23.425 10-14 20.244999999999997 28.82 27.41 23.525 15-19 20.09 28.24 27.295 24.375 20-24 20.169999999999998 28.1 27.544999999999998 24.185000000000002 25-29 19.957993699054857 28.174226133920087 28.094214132119816 23.773566034905237 30-34 20.494346042229562 28.38486940858601 27.399179425597918 23.72160512358651 35-39 20.3311821501826 27.755265395967783 27.60518285056781 24.308369603281804 40-44 20.621341737955877 27.670218620241133 27.905347941367754 23.80309170043524 45-49 20.054024310939923 28.4027812515632 27.472362563153418 24.070831874343455 50-54 20.191009550477524 27.611380569028455 28.07140357017851 24.126206310315514 55-59 20.52 27.63 28.025 23.825 60-64 20.1 27.235 28.15 24.515 65-69 20.06 27.91 27.900000000000002 24.13 70-74 20.265 27.61 28.205000000000002 23.919999999999998 75-79 20.145 27.685 27.810000000000002 24.36 80-84 19.689999999999998 28.110000000000003 27.625 24.575 85-89 20.855 27.375 28.015 23.755000000000003 90-94 20.805 27.965 27.229999999999997 24.0 95-99 20.44 27.29 27.689999999999998 24.58 100-104 20.215 27.884999999999998 27.765 24.135 105-109 20.615 27.705000000000002 27.779999999999998 23.9 110-114 20.39 27.93 27.76 23.919999999999998 115-119 20.825 27.395000000000003 27.495000000000005 24.285 120-124 21.055 27.615000000000002 27.115000000000002 24.215 125-129 20.735 28.044999999999998 27.21 24.01 130-134 20.905 28.325 27.025 23.745 135-139 21.475 27.41 26.939999999999998 24.175 140-144 21.375 27.785 26.279999999999998 24.560000000000002 145-149 21.085 28.110000000000003 26.06 24.745 150-151 21.725 27.650000000000002 25.4875 25.137500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.0 26 6.0 27 7.5 28 5.5 29 10.0 30 13.5 31 19.5 32 29.0 33 33.0 34 43.0 35 50.5 36 63.5 37 82.5 38 113.5 39 141.0 40 168.0 41 204.5 42 226.5 43 250.5 44 267.5 45 290.0 46 296.5 47 285.5 48 258.0 49 213.5 50 188.5 51 160.0 52 131.0 53 109.0 54 87.5 55 67.5 56 47.0 57 30.5 58 20.5 59 16.0 60 12.0 61 12.5 62 11.5 63 6.5 64 4.0 65 2.5 66 3.0 67 3.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.06999999999999999 35-39 0.055 40-44 0.055 45-49 0.045 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.7 0.0 0.0 0.0 0.0 132-133 7.2625 0.0 0.0 0.0 0.0 134-135 7.987500000000001 0.0 0.0 0.0 0.0 136-137 8.675 0.0 0.0 0.0 0.0 138-139 9.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTGC 10 0.006832588 144.9875 5 >>END_MODULE SRR7171440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63 33.0 33.0 34.0 32.0 34.0 2 32.67225 33.0 33.0 34.0 32.0 34.0 3 32.786 34.0 33.0 34.0 32.0 34.0 4 32.5365 34.0 33.0 34.0 31.0 34.0 5 32.628 34.0 33.0 34.0 32.0 34.0 6 36.66425 38.0 38.0 38.0 35.0 38.0 7 36.59525 38.0 38.0 38.0 34.0 38.0 8 36.56875 38.0 38.0 38.0 34.0 38.0 9 36.75975 38.0 38.0 38.0 35.0 38.0 10-14 36.76305000000001 38.0 38.0 38.0 35.2 38.0 15-19 37.0157 38.0 38.0 38.0 36.4 38.0 20-24 37.089749999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.153549999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.16525 38.0 38.0 38.0 37.0 38.0 35-39 37.0467 38.0 38.0 38.0 36.2 38.0 40-44 37.03425 38.0 38.0 38.0 36.4 38.0 45-49 37.0276 38.0 38.0 38.0 36.2 38.0 50-54 36.9059 38.0 38.0 38.0 36.0 38.0 55-59 36.98905 38.0 38.0 38.0 36.0 38.0 60-64 36.9454 38.0 38.0 38.0 36.0 38.0 65-69 37.030499999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.99855000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.01285 38.0 38.0 38.0 36.0 38.0 80-84 37.041199999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.9451 38.0 38.0 38.0 36.0 38.0 90-94 36.8027 38.0 38.0 38.0 35.6 38.0 95-99 36.688 38.0 38.0 38.0 35.0 38.0 100-104 36.64325 38.0 38.0 38.0 35.0 38.0 105-109 36.4834 38.0 38.0 38.0 34.0 38.0 110-114 36.48595 38.0 38.0 38.0 34.0 38.0 115-119 36.1716 38.0 38.0 38.0 33.2 38.0 120-124 36.211149999999996 38.0 38.0 38.0 33.6 38.0 125-129 36.08585000000001 38.0 37.8 38.0 33.0 38.0 130-134 35.8659 38.0 37.0 38.0 31.8 38.0 135-139 35.681349999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.32190000000001 38.0 36.0 38.0 30.0 38.0 145-149 35.0213 38.0 35.4 38.0 27.4 38.0 150-151 32.5585 35.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 2.0 18 2.0 19 2.0 20 4.0 21 2.0 22 7.0 23 9.0 24 9.0 25 15.0 26 22.0 27 23.0 28 37.0 29 35.0 30 45.0 31 57.0 32 54.0 33 72.0 34 121.0 35 205.0 36 474.0 37 2792.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.09511889862328 19.874843554443054 15.519399249061328 28.510638297872344 2 25.43815723585378 26.765147721582373 29.46920380570856 18.327491236855284 3 21.526908635794744 29.536921151439298 29.361702127659573 19.574468085106382 4 24.25531914893617 32.76595744680851 23.62953692115144 19.349186483103882 5 23.541197094916104 35.58727773603806 22.71475081392437 18.156774355121463 6 21.017034068136272 37.27454909819639 23.672344689378757 18.03607214428858 7 20.110192837465565 20.736288504883547 39.04332582018532 20.110192837465565 8 22.514400200350615 23.94189832206361 28.174305033809166 25.36939644377661 9 21.68795391935888 24.593037816178313 29.251189581768095 24.467818682694716 10-14 23.725077647530306 29.110309588217614 25.633704037671578 21.530908726580503 15-19 23.642284569138276 28.196392785571145 26.88376753507014 21.27755511022044 20-24 23.5659536095386 28.345273282901655 27.22809478483042 20.860678322729324 25-29 23.69146005509642 28.454795892812424 26.471324818432258 21.382419233658904 30-34 23.75325455637893 27.8840376527138 27.077909072701782 21.28479871820549 35-39 23.82024721012861 28.929590151628886 27.00295250963319 20.247210128609318 40-44 23.545026545126717 28.062706601222075 27.41159971952319 20.980667134128016 45-49 23.986977210117704 27.417981467568243 27.62334084648134 20.97170047583271 50-54 24.174723237990282 27.82146971898011 27.260431798827835 20.743375244201772 55-59 24.041881669255048 27.834276839837685 27.14793848003607 20.9759030108712 60-64 23.95932475078896 27.440765416019637 27.46581175174072 21.134098081450684 65-69 24.063313965137247 27.79002203967141 27.183931075936684 20.96273291925466 70-74 24.168836370919287 27.828960544762666 26.75746044462247 21.244742639695573 75-79 24.397077954568196 27.47923546482538 27.894526168317824 20.229160412288604 80-84 24.788633748561708 27.685226874781126 27.28000400220121 20.24613537445595 85-89 23.84099329127866 27.8612195854611 27.330529688595174 20.967257434665065 90-94 24.146048282079533 28.082740659120503 27.376540118200943 20.39467094059902 95-99 24.562897650418318 28.215019287610843 26.516707579780572 20.705375482190274 100-104 24.654170008019246 27.952085004009625 26.879510825982354 20.514234161988774 105-109 25.020048115477145 27.87690457097033 27.220328789093823 19.8827185244587 110-114 24.4887730553328 28.23275862068966 27.059943865276665 20.21852445870088 115-119 24.820846905537458 28.128288649461286 27.005762966675018 20.04510147832623 120-124 24.370084656614736 27.98176626759505 27.34558934027952 20.302559735510695 125-129 25.354299163703743 27.928288847713954 26.37588261805799 20.341529370524313 130-134 25.736177884615387 27.919671474358974 26.46233974358974 19.881810897435898 135-139 26.33608815426997 28.024042073628852 25.730027548209367 19.90984222389181 140-144 26.088699574041595 27.77749937359058 26.514657980456025 19.6191430719118 145-149 26.241916888064566 28.257055491503337 25.765702541480778 19.735325078951327 150-151 27.167919799498748 27.681704260651628 26.090225563909776 19.06015037593985 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 4.5 30 7.0 31 9.0 32 15.0 33 21.0 34 24.0 35 41.5 36 77.0 37 95.0 38 100.5 39 129.5 40 173.5 41 226.5 42 271.5 43 288.5 44 289.0 45 290.0 46 287.0 47 276.0 48 250.5 49 233.0 50 209.0 51 165.5 52 129.0 53 98.5 54 70.5 55 47.0 56 41.0 57 34.5 58 21.5 59 14.5 60 11.5 61 8.0 62 5.5 63 5.5 64 4.0 65 2.5 66 3.0 67 2.0 68 1.5 69 1.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.125 4 0.125 5 0.17500000000000002 6 0.2 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.19 15-19 0.2 20-24 0.19499999999999998 25-29 0.17500000000000002 30-34 0.13999999999999999 35-39 0.08499999999999999 40-44 0.16999999999999998 45-49 0.17500000000000002 50-54 0.185 55-59 0.19499999999999998 60-64 0.185 65-69 0.18 70-74 0.13999999999999999 75-79 0.06999999999999999 80-84 0.055 85-89 0.13 90-94 0.16999999999999998 95-99 0.19499999999999998 100-104 0.24 105-109 0.24 110-114 0.24 115-119 0.22499999999999998 120-124 0.185 125-129 0.155 130-134 0.16 135-139 0.17500000000000002 140-144 0.22499999999999998 145-149 0.255 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.6625 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 8.0375 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATGAT 10 0.006830828 145.0 8 ACAGGTT 10 0.006830828 145.0 3 >>END_MODULE Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1048012 spots for SRR7171440.sra Written 1048012 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra Read 1047995 spots for SRR7171440.sra Written 1047995 spots for SRR7171440.sra SRR ids: ['SRR7171440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hyk0h132 SRR7171440.sra spots: 20959917 blocks: [[1, 1047995], [1047996, 2095990], [2095991, 3143985], [3143986, 4191980], [4191981, 5239975], [5239976, 6287970], [6287971, 7335965], [7335966, 8383960], [8383961, 9431955], [9431956, 10479950], [10479951, 11527945], [11527946, 12575940], [12575941, 13623935], [13623936, 14671930], [14671931, 15719925], [15719926, 16767920], [16767921, 17815915], [17815916, 18863910], [18863911, 19911905], [19911906, 20959917]] SRR7171440 file size 7080927 SRR7171440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171440 SRR7171440_1.fastq SRR7171440_2.fastq Input file: SRR7171440_1.fastq Paired file: SRR7171440_2.fastq trimmed: SRR7171440-trimmed-pair1.fastq, SRR7171440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:17:03 2025 >> started Thu Feb 13 18:17:26 2025 >> done (23.039s) 20959917 read pairs processed; of these: 864 ( 0.00%) short read pairs filtered out after trimming by size control 1831 ( 0.01%) empty read pairs filtered out after trimming by size control 20957222 (99.99%) read pairs available; of these: 3124140 (14.91%) trimmed read pairs available after processing 17833082 (85.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 4 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 3 0.00% 38 0 0.00% 39 1 0.00% 40 4 0.00% 41 5 0.00% 42 8 0.00% 43 12 0.00% 44 7 0.00% 45 7 0.00% 46 13 0.00% 47 11 0.00% 48 14 0.00% 49 12 0.00% 50 19 0.00% 51 19 0.00% 52 30 0.00% 53 34 0.00% 54 37 0.00% 55 45 0.00% 56 48 0.00% 57 59 0.00% 58 75 0.00% 59 98 0.00% 60 108 0.00% 61 135 0.00% 62 146 0.00% 63 180 0.00% 64 167 0.00% 65 213 0.00% 66 269 0.00% 67 313 0.00% 68 373 0.00% 69 437 0.00% 70 541 0.00% 71 628 0.00% 72 775 0.00% 73 898 0.00% 74 1026 0.00% 75 1212 0.01% 76 1386 0.01% 77 1463 0.01% 78 1742 0.01% 79 2018 0.01% 80 2239 0.01% 81 2670 0.01% 82 3070 0.01% 83 3660 0.02% 84 4133 0.02% 85 4493 0.02% 86 5105 0.02% 87 5761 0.03% 88 6155 0.03% 89 6964 0.03% 90 7800 0.04% 91 8612 0.04% 92 9504 0.05% 93 10633 0.05% 94 11554 0.06% 95 12906 0.06% 96 13886 0.07% 97 14978 0.07% 98 15825 0.08% 99 16906 0.08% 100 17923 0.09% 101 19582 0.09% 102 21023 0.10% 103 23002 0.11% 104 24385 0.12% 105 25494 0.12% 106 27554 0.13% 107 28647 0.14% 108 29770 0.14% 109 31358 0.15% 110 32124 0.15% 111 34264 0.16% 112 35882 0.17% 113 37707 0.18% 114 39636 0.19% 115 42563 0.20% 116 44936 0.21% 117 48933 0.23% 118 49577 0.24% 119 48583 0.23% 120 48675 0.23% 121 50216 0.24% 122 51832 0.25% 123 54131 0.26% 124 56065 0.27% 125 57859 0.28% 126 59999 0.29% 127 62046 0.30% 128 62783 0.30% 129 64013 0.31% 130 64775 0.31% 131 66143 0.32% 132 67566 0.32% 133 70063 0.33% 134 72708 0.35% 135 74581 0.36% 136 76211 0.36% 137 77138 0.37% 138 78260 0.37% 139 79062 0.38% 140 80166 0.38% 141 85884 0.41% 142 88582 0.42% 143 85236 0.41% 144 88875 0.42% 145 94699 0.45% 146 88546 0.42% 147 93190 0.44% 148 92318 0.44% 149 92610 0.44% 150 95488 0.46% 151 17833082 85.09% 20957222 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=26 prefix-density=0.41 prefix-fanout=3.0 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=34.02 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=ATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=26 prefix-density=0.45 prefix-fanout=3.0 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.14 sequence-density-rank=21 fanout-score=29.46 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=10.5 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171440 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:18:07 Started mapping on | Feb 13 18:18:08 Finished on | Feb 13 18:20:48 Mapping speed, Million of reads per hour | 471.54 Number of input reads | 20957222 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19524172 Uniquely mapped reads % | 93.16% Average mapped length | 294.17 Number of splices: Total | 19910463 Number of splices: Annotated (sjdb) | 19586100 Number of splices: GT/AG | 19605546 Number of splices: GC/AG | 240671 Number of splices: AT/AC | 14776 Number of splices: Non-canonical | 49470 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 612389 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 97977 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 820662 820662 820662 N_multimapping 612389 612389 612389 N_noFeature 374546 19349285 437683 N_ambiguous 202126 1144 89749 UnstrandedReadsAssigned:18947500 PositiveStrandReadsAssigned:173743 NegativeStrandReadsAssigned:18996740 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171440-trimmed-pair1.fastq SRR7171440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,957,222 reads, 19,091,099 reads pseudoaligned [quant] estimated average fragment length: 221.727 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7171440.ke.tsv 34699 SRR7171440.se.tsv 87100 total ==> SRR7171440.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.27 1697 44.1572 Potri.005G024800.1.v4.1 1035 814.273 477 27.3957 Potri.004G059700.1.v4.1 961 740.284 182 11.4976 Potri.007G009000.2.v4.1 1416 1195.27 0 0 Potri.003G141000.2.v4.1 2943 2722.27 537 9.2252 Potri.016G087400.1.v4.1 270 87.8145 1690 900.023 Potri.015G069301.1.v4.1 564 345.942 0 0 Potri.010G195200.1.v4.1 1773 1552.27 276 8.31523 Potri.012G127500.1.v4.1 977 756.273 6641 410.666 ==> SRR7171440.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 519 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 589 SRR7171440 completed mapping pipeline successfully