Starting /dee2/code/volunteer_pipeline.sh SRR7171441 current disk space = 3088629473280 free memory = 1413977368 SRR7171441 SRAfilesize 64074fee7292c79ddbb95ca0d730f512 SRR7171441.sra SRR7171441.sra file validated SRR7171441 is paired end SRR7171441 is conventional basespace SRR7171441 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.18925 33.0 32.0 33.0 25.0 34.0 2 31.117 33.0 31.0 33.0 28.0 33.0 3 31.86825 33.0 32.0 33.0 30.0 33.0 4 32.74075 33.0 33.0 34.0 32.0 34.0 5 32.907 33.0 33.0 34.0 32.0 34.0 6 36.8795 38.0 37.0 38.0 35.0 38.0 7 37.268 38.0 38.0 38.0 36.0 38.0 8 37.44375 38.0 38.0 38.0 37.0 38.0 9 37.6015 38.0 38.0 38.0 38.0 38.0 10-14 37.544050000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.58915 38.0 38.0 38.0 38.0 38.0 20-24 37.56635 38.0 38.0 38.0 38.0 38.0 25-29 37.490449999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.4722 38.0 38.0 38.0 37.8 38.0 35-39 37.4765 38.0 38.0 38.0 37.2 38.0 40-44 37.466049999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.481399999999994 38.0 38.0 38.0 37.8 38.0 50-54 37.437949999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.35335 38.0 38.0 38.0 37.0 38.0 60-64 37.24235 38.0 38.0 38.0 37.0 38.0 65-69 37.2473 38.0 38.0 38.0 37.0 38.0 70-74 37.17125 38.0 38.0 38.0 36.2 38.0 75-79 37.10555 38.0 38.0 38.0 36.0 38.0 80-84 37.1014 38.0 38.0 38.0 36.0 38.0 85-89 37.08 38.0 38.0 38.0 36.0 38.0 90-94 37.14575 38.0 38.0 38.0 36.0 38.0 95-99 36.995799999999996 38.0 38.0 38.0 35.8 38.0 100-104 36.79575 38.0 38.0 38.0 35.2 38.0 105-109 36.81145 38.0 38.0 38.0 34.8 38.0 110-114 36.73605 38.0 38.0 38.0 34.6 38.0 115-119 36.693 38.0 38.0 38.0 34.6 38.0 120-124 36.52605 38.0 38.0 38.0 34.0 38.0 125-129 36.4971 38.0 38.0 38.0 34.0 38.0 130-134 36.30615 38.0 37.8 38.0 33.8 38.0 135-139 36.15575 38.0 37.2 38.0 33.2 38.0 140-144 36.0394 38.0 36.6 38.0 32.6 38.0 145-149 35.7868 38.0 36.0 38.0 31.6 38.0 150-151 34.017875000000004 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 4.0 24 5.0 25 5.0 26 7.0 27 9.0 28 18.0 29 23.0 30 28.0 31 49.0 32 69.0 33 70.0 34 128.0 35 194.0 36 469.0 37 2919.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.60161168471418 12.943842860740368 8.159153865525056 37.2953915890204 2 23.125 14.05 33.25 29.575000000000003 3 20.575 17.775 27.1 34.55 4 23.425 24.474999999999998 23.05 29.049999999999997 5 23.35 30.175 24.275 22.2 6 20.075000000000003 34.225 25.324999999999996 20.375 7 14.625 26.924999999999997 40.0 18.45 8 17.075000000000003 28.000000000000004 31.674999999999997 23.25 9 16.875 25.474999999999998 34.725 22.925 10-14 19.07 29.970000000000002 27.935 23.025000000000002 15-19 19.945 28.22 28.02 23.815 20-24 19.73 28.62 27.865000000000002 23.785 25-29 19.509999999999998 28.595 27.950000000000003 23.945 30-34 19.814999999999998 28.335 28.26 23.59 35-39 20.338050707606143 28.709306395959395 27.549132369855478 23.403510526578984 40-44 20.155 27.92 27.939999999999998 23.985 45-49 19.905 28.38 27.505000000000003 24.21 50-54 19.855 28.365000000000002 27.450000000000003 24.33 55-59 20.235 28.565 27.235 23.965 60-64 20.330000000000002 28.125 27.57 23.974999999999998 65-69 19.8 27.845 28.315 24.04 70-74 19.950000000000003 28.82 27.665 23.565 75-79 19.955000000000002 27.744999999999997 28.345 23.955000000000002 80-84 20.064999999999998 28.645 27.505000000000003 23.785 85-89 19.52 28.415000000000003 27.74 24.325 90-94 20.1 28.299999999999997 27.355 24.245 95-99 20.11 27.87 27.91 24.11 100-104 20.549999999999997 27.83 27.73 23.89 105-109 20.09 27.915 27.560000000000002 24.435000000000002 110-114 20.74 27.205000000000002 27.87 24.185000000000002 115-119 20.535 28.449999999999996 27.24 23.775 120-124 20.86 27.76 27.165 24.215 125-129 20.885 28.585 26.674999999999997 23.855 130-134 20.424999999999997 28.035 27.345000000000002 24.195 135-139 21.19 28.355000000000004 26.555 23.9 140-144 21.02 27.639999999999997 26.735 24.605 145-149 20.86 27.694999999999997 27.04 24.404999999999998 150-151 20.3 27.212500000000002 27.2625 25.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 4.5 26 7.5 27 7.0 28 6.5 29 8.5 30 13.5 31 19.0 32 34.5 33 45.0 34 50.5 35 63.5 36 79.5 37 98.0 38 124.0 39 161.0 40 187.0 41 225.5 42 261.0 43 259.0 44 266.5 45 283.0 46 270.5 47 267.0 48 237.5 49 199.0 50 175.0 51 134.5 52 110.5 53 95.5 54 78.0 55 53.0 56 37.0 57 31.0 58 26.5 59 21.0 60 15.0 61 9.5 62 7.5 63 7.0 64 4.5 65 3.0 66 2.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.4375 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.25 0.0 0.0 0.0 0.0 132-133 8.1125 0.0 0.0 0.0 0.0 134-135 8.85 0.0 0.0 0.0 0.0 136-137 9.4125 0.0 0.0 0.0 0.0 138-139 10.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171441 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9535 33.0 33.0 34.0 32.0 34.0 2 33.01175 34.0 33.0 34.0 32.0 34.0 3 33.01375 34.0 33.0 34.0 32.0 34.0 4 33.0005 34.0 33.0 34.0 32.0 34.0 5 33.031 34.0 33.0 34.0 32.0 34.0 6 37.1795 38.0 38.0 38.0 37.0 38.0 7 37.207 38.0 38.0 38.0 37.0 38.0 8 37.14225 38.0 38.0 38.0 37.0 38.0 9 37.12575 38.0 38.0 38.0 37.0 38.0 10-14 37.1224 38.0 38.0 38.0 37.0 38.0 15-19 37.08855 38.0 38.0 38.0 36.6 38.0 20-24 37.08485 38.0 38.0 38.0 37.0 38.0 25-29 37.10795 38.0 38.0 38.0 37.0 38.0 30-34 37.0933 38.0 38.0 38.0 36.6 38.0 35-39 37.04825 38.0 38.0 38.0 36.4 38.0 40-44 36.43865 37.8 37.4 38.0 33.8 38.0 45-49 36.92815 38.0 38.0 38.0 35.8 38.0 50-54 36.95895 38.0 38.0 38.0 36.0 38.0 55-59 36.90915 38.0 38.0 38.0 36.0 38.0 60-64 36.89695 38.0 38.0 38.0 35.8 38.0 65-69 36.8822 38.0 38.0 38.0 35.8 38.0 70-74 36.8718 38.0 38.0 38.0 35.8 38.0 75-79 36.9208 38.0 38.0 38.0 36.0 38.0 80-84 36.84495 38.0 38.0 38.0 35.2 38.0 85-89 36.69345 38.0 38.0 38.0 35.2 38.0 90-94 36.638450000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.53305 38.0 38.0 38.0 34.6 38.0 100-104 36.388099999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.31270000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.28189999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.1555 38.0 38.0 38.0 33.4 38.0 120-124 35.967949999999995 38.0 37.6 38.0 32.6 38.0 125-129 36.026799999999994 38.0 37.0 38.0 33.0 38.0 130-134 35.739 38.0 36.0 38.0 31.0 38.0 135-139 35.659 38.0 36.0 38.0 31.0 38.0 140-144 35.291 38.0 36.0 38.0 28.4 38.0 145-149 35.05895 38.0 35.2 38.0 27.6 38.0 150-151 32.438375 35.5 29.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 2.0 18 2.0 19 9.0 20 10.0 21 7.0 22 8.0 23 12.0 24 15.0 25 10.0 26 18.0 27 21.0 28 28.0 29 34.0 30 49.0 31 50.0 32 75.0 33 84.0 34 122.0 35 220.0 36 429.0 37 2789.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35 20.849999999999998 12.45 27.35 2 26.019514635976982 26.945208906680012 30.222667000250187 16.81260945709282 3 20.765574180635475 30.522892169126848 28.77157868401301 19.93995496622467 4 23.767825869402053 33.400050037528146 23.91793845384038 18.914185639229423 5 24.893670252689517 36.32724543407556 22.291718789091817 16.487365524143108 6 21.462559479088405 37.9664412722264 23.415977961432507 17.15502128725269 7 20.29058116232465 22.44488977955912 37.02404809619239 20.240480961923847 8 21.657486229344016 25.61342013019529 27.99198798197296 24.73710565848773 9 22.26953907815631 25.90180360721443 29.784569138276552 22.044088176352705 10-14 24.090407938257993 29.598075573819788 25.70411947479202 20.6073970131302 15-19 23.60958011824832 27.743260847780338 27.512776831345825 21.134382202625513 20-24 23.688824325001253 27.445774683163854 28.182136953363724 20.683264038471172 25-29 23.875293999899917 28.864534854626434 26.982935495170896 20.277235650302757 30-34 23.916958479239618 28.23411705852926 27.24862431215608 20.60030015007504 35-39 24.137241172351708 28.15344603381014 27.083124937481244 20.626187856356907 40-44 23.9555711212288 27.327763045979886 27.662980937609444 21.053684895181867 45-49 23.82358830596716 27.60812975570685 28.04865839006808 20.519623548257908 50-54 23.94471984377347 27.795303189624953 27.314606178959487 20.94537078764208 55-59 23.537953134388143 28.554976967754857 27.924093731223714 19.982976166633286 60-64 23.743240536751454 28.11936711395954 27.218105347486482 20.919287001802523 65-69 23.423423423423422 27.842842842842842 27.72772772772773 21.006006006006007 70-74 24.20605151287822 27.54688672168042 27.62690672668167 20.62015503875969 75-79 23.736186809340467 27.416370818540926 28.371418570928547 20.47602380119006 80-84 23.56 27.944999999999997 27.97 20.525 85-89 23.757127138141442 28.30849254776433 27.673301990597178 20.26107832349705 90-94 24.308231173380037 27.89592194145609 27.5806855141356 20.21516137102827 95-99 24.164872038864125 27.966144137827413 27.510392147042623 20.35859167626584 100-104 24.17753259779338 28.59077231695085 26.925777331995988 20.30591775325978 105-109 24.435977138273337 27.624586383234735 27.764965406597813 20.174471071894114 110-114 24.202927611790656 27.767194706236214 27.95267696009625 20.07720072187688 115-119 24.928582168095023 27.890542775522476 27.274094121184785 19.906780935197716 120-124 24.64704115349955 27.595874637028135 27.590868128567138 20.166216080905176 125-129 24.50592885375494 28.733676889978486 27.27272727272727 19.487666983539302 130-134 24.99499699819892 27.666599959975986 27.40144086451871 19.936962177306384 135-139 25.835835835835834 27.94794794794795 26.836836836836834 19.37937937937938 140-144 25.75066419369392 28.021454709509246 26.487543235249888 19.740337861546944 145-149 26.207311569128933 28.263376962038013 26.75893886966551 18.770372599167544 150-151 26.074965525886924 27.930299611382726 26.664159458443027 19.330575404287327 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 4.5 28 5.0 29 5.5 30 8.5 31 12.5 32 16.0 33 28.0 34 41.5 35 57.0 36 71.0 37 98.5 38 133.0 39 153.5 40 185.0 41 237.5 42 271.0 43 276.0 44 279.0 45 296.0 46 286.0 47 262.0 48 252.0 49 207.5 50 165.0 51 147.5 52 121.0 53 84.5 54 62.5 55 54.0 56 45.5 57 35.0 58 25.5 59 17.5 60 10.0 61 6.0 62 6.0 63 5.0 64 3.5 65 2.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.17500000000000002 7 0.2 8 0.15 9 0.2 10-14 0.22999999999999998 15-19 0.21 20-24 0.185 25-29 0.08499999999999999 30-34 0.05 35-39 0.03 40-44 0.065 45-49 0.12 50-54 0.145 55-59 0.13999999999999999 60-64 0.13999999999999999 65-69 0.1 70-74 0.025 75-79 0.005 80-84 0.0 85-89 0.03 90-94 0.075 95-99 0.165 100-104 0.3 105-109 0.27 110-114 0.26 115-119 0.23500000000000001 120-124 0.13 125-129 0.065 130-134 0.06 135-139 0.1 140-144 0.255 145-149 0.295 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.42778057372924005 0.8500000000000001 3 0.0754906894816306 0.22499999999999998 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.07500000000000001 0.025 0.0 0.0 0.0 80-81 0.1625 0.025 0.0 0.0 0.0 82-83 0.2 0.025 0.0 0.0 0.0 84-85 0.21250000000000002 0.025 0.0 0.0 0.0 86-87 0.225 0.025 0.0 0.0 0.0 88-89 0.2375 0.025 0.0 0.0 0.0 90-91 0.3375 0.025 0.0 0.0 0.0 92-93 0.4875 0.025 0.0 0.0 0.0 94-95 0.625 0.025 0.0 0.0 0.0 96-97 0.7124999999999999 0.025 0.0 0.0 0.0 98-99 0.8374999999999999 0.025 0.0 0.0 0.0 100-101 0.975 0.025 0.0 0.0 0.0 102-103 1.1625 0.025 0.0 0.0 0.0 104-105 1.375 0.025 0.0 0.0 0.0 106-107 1.65 0.025 0.0 0.0 0.0 108-109 1.9 0.025 0.0 0.0 0.0 110-111 2.2249999999999996 0.025 0.0 0.0 0.0 112-113 2.55 0.025 0.0 0.0 0.0 114-115 3.075 0.025 0.0 0.0 0.0 116-117 3.425 0.025 0.0 0.0 0.0 118-119 3.9875 0.025 0.0 0.0 0.0 120-121 4.375 0.025 0.0 0.0 0.0 122-123 4.75 0.025 0.0 0.0 0.0 124-125 5.324999999999999 0.025 0.0 0.0 0.0 126-127 6.0 0.025 0.0 0.0 0.0 128-129 6.525 0.025 0.0 0.0 0.0 130-131 7.15 0.025 0.0 0.0 0.0 132-133 7.9875 0.025 0.0 0.0 0.0 134-135 8.7375 0.025 0.0 0.0 0.0 136-137 9.2625 0.025 0.0 0.0 0.0 138-139 9.925 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641184 spots for SRR7171441.sra Written 641184 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra Read 641178 spots for SRR7171441.sra Written 641178 spots for SRR7171441.sra SRR ids: ['SRR7171441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0bx7bqjx SRR7171441.sra spots: 12823566 blocks: [[1, 641178], [641179, 1282356], [1282357, 1923534], [1923535, 2564712], [2564713, 3205890], [3205891, 3847068], [3847069, 4488246], [4488247, 5129424], [5129425, 5770602], [5770603, 6411780], [6411781, 7052958], [7052959, 7694136], [7694137, 8335314], [8335315, 8976492], [8976493, 9617670], [9617671, 10258848], [10258849, 10900026], [10900027, 11541204], [11541205, 12182382], [12182383, 12823566]] SRR7171441 file size 4323785 SRR7171441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171441 SRR7171441_1.fastq SRR7171441_2.fastq Input file: SRR7171441_1.fastq Paired file: SRR7171441_2.fastq trimmed: SRR7171441-trimmed-pair1.fastq, SRR7171441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:41:05 2025 >> started Thu Feb 13 17:41:27 2025 >> done (22.376s) 12823566 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 895 ( 0.01%) empty read pairs filtered out after trimming by size control 12822654 (99.99%) read pairs available; of these: 2067000 (16.12%) trimmed read pairs available after processing 10755654 (83.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 0 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 7 0.00% 42 3 0.00% 43 4 0.00% 44 9 0.00% 45 3 0.00% 46 9 0.00% 47 9 0.00% 48 11 0.00% 49 15 0.00% 50 16 0.00% 51 21 0.00% 52 20 0.00% 53 20 0.00% 54 21 0.00% 55 26 0.00% 56 30 0.00% 57 37 0.00% 58 50 0.00% 59 60 0.00% 60 80 0.00% 61 69 0.00% 62 86 0.00% 63 114 0.00% 64 131 0.00% 65 170 0.00% 66 184 0.00% 67 210 0.00% 68 263 0.00% 69 316 0.00% 70 346 0.00% 71 401 0.00% 72 509 0.00% 73 617 0.00% 74 727 0.01% 75 792 0.01% 76 887 0.01% 77 1031 0.01% 78 1193 0.01% 79 1327 0.01% 80 1661 0.01% 81 1861 0.01% 82 2173 0.02% 83 2449 0.02% 84 2725 0.02% 85 3233 0.03% 86 3596 0.03% 87 3904 0.03% 88 4376 0.03% 89 4736 0.04% 90 5259 0.04% 91 5824 0.05% 92 6596 0.05% 93 7260 0.06% 94 8058 0.06% 95 8620 0.07% 96 9538 0.07% 97 10120 0.08% 98 10691 0.08% 99 11372 0.09% 100 12464 0.10% 101 13123 0.10% 102 14177 0.11% 103 15294 0.12% 104 16406 0.13% 105 17435 0.14% 106 18336 0.14% 107 19404 0.15% 108 20137 0.16% 109 21084 0.16% 110 21760 0.17% 111 22924 0.18% 112 24072 0.19% 113 25110 0.20% 114 26653 0.21% 115 28009 0.22% 116 29185 0.23% 117 30919 0.24% 118 32529 0.25% 119 32406 0.25% 120 32442 0.25% 121 33630 0.26% 122 34535 0.27% 123 35997 0.28% 124 37377 0.29% 125 38567 0.30% 126 39931 0.31% 127 40923 0.32% 128 41797 0.33% 129 42848 0.33% 130 43365 0.34% 131 43750 0.34% 132 45135 0.35% 133 46320 0.36% 134 47473 0.37% 135 49454 0.39% 136 50201 0.39% 137 50991 0.40% 138 50912 0.40% 139 52112 0.41% 140 53685 0.42% 141 55054 0.43% 142 56427 0.44% 143 55752 0.43% 144 59810 0.47% 145 59867 0.47% 146 58599 0.46% 147 60182 0.47% 148 60651 0.47% 149 60465 0.47% 150 63419 0.49% 151 10755654 83.88% 12822654 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=24 prefix-density=1.18 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=15.33 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=5.9 sequence=CACCATCATTGTAAAGGAACAACTGAG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=27 prefix-density=0.94 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=47.76 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.1 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171441 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:42:32 Started mapping on | Feb 13 17:42:32 Finished on | Feb 13 17:44:49 Mapping speed, Million of reads per hour | 336.95 Number of input reads | 12822654 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11913830 Uniquely mapped reads % | 92.91% Average mapped length | 293.50 Number of splices: Total | 11309186 Number of splices: Annotated (sjdb) | 11084288 Number of splices: GT/AG | 11128873 Number of splices: GC/AG | 138995 Number of splices: AT/AC | 9430 Number of splices: Non-canonical | 31888 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290206 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 58115 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 618618 618618 618618 N_multimapping 290206 290206 290206 N_noFeature 321702 11813513 357134 N_ambiguous 123882 516 58840 UnstrandedReadsAssigned:11468246 PositiveStrandReadsAssigned:99801 NegativeStrandReadsAssigned:11497856 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171441-trimmed-pair1.fastq SRR7171441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,822,654 reads, 11,502,558 reads pseudoaligned [quant] estimated average fragment length: 217.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7171441.ke.tsv 34699 SRR7171441.se.tsv 87100 total ==> SRR7171441.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.77 1786 76.1526 Potri.005G024800.1.v4.1 1035 818.771 1466 137.554 Potri.004G059700.1.v4.1 961 744.781 34 3.50714 Potri.007G009000.2.v4.1 1416 1199.77 0 0 Potri.003G141000.2.v4.1 2943 2726.77 731 20.5955 Potri.016G087400.1.v4.1 270 88.453 1002 870.278 Potri.015G069301.1.v4.1 564 349.573 0 0 Potri.010G195200.1.v4.1 1773 1556.77 346.928 17.1205 Potri.012G127500.1.v4.1 977 760.777 8708 879.356 ==> SRR7171441.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 387 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 215 SRR7171441 completed mapping pipeline successfully