Starting /dee2/code/volunteer_pipeline.sh SRR7171442 current disk space = 3087708405760 free memory = 1578315616 SRR7171442 SRAfilesize f4b0e6510d18fae92dd2ecde81c7cd9e SRR7171442.sra SRR7171442.sra file validated SRR7171442 is paired end SRR7171442 is conventional basespace SRR7171442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.0125 30.0 18.0 33.0 18.0 33.0 2 31.63775 33.0 32.0 33.0 27.0 33.0 3 32.01275 33.0 32.0 33.0 30.0 33.0 4 32.5075 33.0 33.0 33.0 32.0 34.0 5 32.71725 33.0 33.0 34.0 32.0 34.0 6 36.85875 38.0 37.0 38.0 35.0 38.0 7 37.27125 38.0 38.0 38.0 36.0 38.0 8 37.51025 38.0 38.0 38.0 37.0 38.0 9 37.5465 38.0 38.0 38.0 38.0 38.0 10-14 37.5389 38.0 38.0 38.0 38.0 38.0 15-19 37.561 38.0 38.0 38.0 38.0 38.0 20-24 37.57435 38.0 38.0 38.0 38.0 38.0 25-29 37.41755 38.0 38.0 38.0 37.2 38.0 30-34 37.363099999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.3711 38.0 38.0 38.0 37.0 38.0 40-44 37.36035 38.0 38.0 38.0 37.0 38.0 45-49 37.491 38.0 38.0 38.0 37.4 38.0 50-54 37.4272 38.0 38.0 38.0 37.0 38.0 55-59 37.262649999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.1871 38.0 38.0 38.0 36.4 38.0 65-69 37.24715 38.0 38.0 38.0 37.0 38.0 70-74 37.317099999999996 38.0 38.0 38.0 36.8 38.0 75-79 37.26405 38.0 38.0 38.0 36.4 38.0 80-84 37.183 38.0 38.0 38.0 36.0 38.0 85-89 37.142100000000006 38.0 38.0 38.0 36.0 38.0 90-94 37.076 38.0 38.0 38.0 36.0 38.0 95-99 36.846349999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.824749999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.7395 38.0 38.0 38.0 34.8 38.0 110-114 36.582049999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.39755 38.0 37.6 38.0 33.8 38.0 120-124 36.312599999999996 38.0 37.8 38.0 33.8 38.0 125-129 36.2459 38.0 37.4 38.0 33.6 38.0 130-134 36.2153 38.0 37.0 38.0 33.0 38.0 135-139 35.8711 38.0 36.2 38.0 32.2 38.0 140-144 35.65405 38.0 36.0 38.0 31.0 38.0 145-149 35.3242 38.0 35.2 38.0 29.8 38.0 150-151 33.3715 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 3.0 25 6.0 26 8.0 27 10.0 28 17.0 29 23.0 30 31.0 31 60.0 32 61.0 33 76.0 34 146.0 35 250.0 36 605.0 37 2702.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.040090202956655 10.924580305687797 10.473565522425456 38.56176396893009 2 22.5 14.475 33.6 29.425 3 19.425 21.475 26.474999999999998 32.625 4 22.85 28.449999999999996 22.75 25.95 5 21.575 32.675 25.0 20.75 6 17.974999999999998 35.3 26.424999999999997 20.3 7 13.750000000000002 26.674999999999997 41.925000000000004 17.65 8 18.55 24.675 30.975 25.8 9 17.025000000000002 24.474999999999998 34.475 24.025 10-14 19.45 29.805 26.895000000000003 23.849999999999998 15-19 19.830000000000002 28.470000000000002 27.705000000000002 23.995 20-24 19.53 28.720000000000002 28.32 23.43 25-29 19.345000000000002 28.835 28.050000000000004 23.77 30-34 19.61 28.485 27.93 23.974999999999998 35-39 19.939999999999998 28.29 27.694999999999997 24.075 40-44 19.975 29.115000000000002 27.485 23.425 45-49 19.88 28.505000000000003 27.529999999999998 24.085 50-54 20.05 28.48 27.900000000000002 23.57 55-59 19.66 28.46 27.6 24.279999999999998 60-64 19.325 28.249999999999996 27.894999999999996 24.529999999999998 65-69 19.52 28.744999999999997 27.834999999999997 23.9 70-74 19.220000000000002 28.939999999999998 27.705000000000002 24.135 75-79 19.915 28.439999999999998 27.185 24.46 80-84 20.035 27.96 28.275 23.73 85-89 19.915 28.92 27.3 23.865 90-94 20.26 28.925 27.155 23.66 95-99 20.49 27.779999999999998 27.875 23.855 100-104 19.595000000000002 29.330000000000002 27.650000000000002 23.425 105-109 20.8 28.360000000000003 27.250000000000004 23.59 110-114 20.474999999999998 28.24 27.33 23.955000000000002 115-119 20.465 28.410000000000004 27.245 23.880000000000003 120-124 20.615 28.16 27.544999999999998 23.68 125-129 20.635 27.42 27.965 23.98 130-134 20.445 27.855 27.98 23.72 135-139 20.75 28.13 27.275 23.845 140-144 20.555 28.015 27.015 24.415 145-149 21.0 28.375 26.779999999999998 23.845 150-151 20.837500000000002 27.9125 27.287499999999998 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.0 26 2.0 27 4.0 28 6.0 29 10.0 30 18.0 31 22.0 32 25.5 33 36.5 34 52.5 35 69.0 36 88.0 37 114.0 38 146.5 39 176.0 40 203.0 41 224.5 42 243.5 43 267.0 44 274.0 45 264.0 46 262.0 47 264.0 48 251.5 49 226.0 50 174.5 51 134.5 52 104.5 53 78.5 54 63.5 55 48.0 56 42.0 57 29.5 58 17.0 59 14.0 60 12.5 61 7.5 62 6.0 63 4.5 64 4.0 65 3.0 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.275 0.025 0.0 0.0 0.0 92-93 0.3 0.025 0.0 0.0 0.0 94-95 0.3375 0.025 0.0 0.0 0.0 96-97 0.3875 0.025 0.0 0.0 0.0 98-99 0.4625 0.025 0.0 0.0 0.0 100-101 0.5625 0.025 0.0 0.0 0.0 102-103 0.6625 0.025 0.0 0.0 0.0 104-105 0.775 0.025 0.0 0.0 0.0 106-107 0.925 0.025 0.0 0.0 0.0 108-109 1.0375 0.025 0.0 0.0 0.0 110-111 1.2375 0.025 0.0 0.0 0.0 112-113 1.475 0.025 0.0 0.0 0.0 114-115 1.85 0.025 0.0 0.0 0.0 116-117 2.075 0.025 0.0 0.0 0.0 118-119 2.325 0.025 0.0 0.0 0.0 120-121 2.6125 0.025 0.0 0.0 0.0 122-123 2.95 0.025 0.0 0.0 0.0 124-125 3.325 0.025 0.0 0.0 0.0 126-127 3.675 0.025 0.0 0.0 0.0 128-129 4.0 0.025 0.0 0.0 0.0 130-131 4.325 0.025 0.0 0.0 0.0 132-133 4.65 0.025 0.0 0.0 0.0 134-135 5.1875 0.025 0.0 0.0 0.0 136-137 5.6125 0.025 0.0 0.0 0.0 138-139 6.2875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAT 10 0.006830828 145.0 2 ACAAGTA 10 0.006830828 145.0 8 GTAGCTT 10 0.006830828 145.0 8 >>END_MODULE SRR7171442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81375 33.0 33.0 34.0 32.0 34.0 2 32.9745 34.0 33.0 34.0 32.0 34.0 3 32.954 34.0 33.0 34.0 32.0 34.0 4 32.8085 34.0 33.0 34.0 32.0 34.0 5 32.783 34.0 33.0 34.0 32.0 34.0 6 37.012 38.0 38.0 38.0 36.0 38.0 7 36.87825 38.0 38.0 38.0 36.0 38.0 8 36.9165 38.0 38.0 38.0 36.0 38.0 9 36.95975 38.0 38.0 38.0 36.0 38.0 10-14 36.9188 38.0 38.0 38.0 36.0 38.0 15-19 36.87495 38.0 38.0 38.0 35.8 38.0 20-24 36.87949999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.95265 38.0 38.0 38.0 36.0 38.0 30-34 37.0596 38.0 38.0 38.0 36.8 38.0 35-39 37.091249999999995 38.0 38.0 38.0 36.4 38.0 40-44 37.0698 38.0 38.0 38.0 36.4 38.0 45-49 36.95855 38.0 38.0 38.0 36.0 38.0 50-54 36.906 38.0 38.0 38.0 36.0 38.0 55-59 36.84565 38.0 38.0 38.0 35.8 38.0 60-64 36.67675 38.0 38.0 38.0 34.8 38.0 65-69 36.712199999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.76955 38.0 38.0 38.0 35.2 38.0 75-79 36.756150000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.73459999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.65475 38.0 38.0 38.0 34.8 38.0 90-94 36.5665 38.0 38.0 38.0 34.2 38.0 95-99 36.569250000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.3819 38.0 38.0 38.0 34.0 38.0 105-109 36.1832 38.0 38.0 38.0 33.2 38.0 110-114 35.86705 38.0 37.2 38.0 31.6 38.0 115-119 35.71775 38.0 37.0 38.0 31.0 38.0 120-124 35.5311 38.0 36.6 38.0 29.4 38.0 125-129 35.3928 38.0 36.0 38.0 28.2 38.0 130-134 35.34285 38.0 36.0 38.0 28.6 38.0 135-139 35.06535 38.0 35.6 38.0 27.4 38.0 140-144 34.658699999999996 38.0 35.0 38.0 24.0 38.0 145-149 34.3528 38.0 34.8 38.0 23.2 38.0 150-151 32.14075 36.0 28.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 4.0 19 2.0 20 6.0 21 4.0 22 10.0 23 14.0 24 24.0 25 17.0 26 27.0 27 29.0 28 38.0 29 37.0 30 41.0 31 74.0 32 98.0 33 104.0 34 151.0 35 220.0 36 518.0 37 2575.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.325 18.725 16.2 29.75 2 25.60700876095119 26.408010012515643 31.48936170212766 16.49561952440551 3 22.389181066867017 27.773603806661658 29.802153769095916 20.035061357375408 4 24.06711745554721 33.959429000751314 22.489356373653894 19.484097170047583 5 24.06711745554721 36.113198096669166 22.890057600801402 16.929626846982217 6 20.705176294073517 37.58439609902476 22.980745186296573 18.72968242060515 7 20.41531148361271 21.09081811358519 38.62897172879659 19.864898674005506 8 21.966474856142106 25.91943957968476 26.945208906680012 25.168876657493122 9 21.541155866900176 25.544158118588946 29.697272954716038 23.217413059794847 10-14 23.267450587940957 29.25193895421566 25.934450838128598 21.546159619714786 15-19 22.987240430322743 28.36627470602952 27.455591693770327 21.19089316987741 20-24 23.177383037277956 28.546409807355516 27.675756817613212 20.600450337753315 25-29 23.520288187321757 27.91314354330315 27.447841096712867 21.11872717266223 30-34 23.209641928385675 28.025605121024206 27.730546109221844 21.034206841368274 35-39 22.975 28.005000000000003 28.194999999999997 20.825 40-44 23.605901475368842 28.207051762940733 28.107026756689173 20.080020005001252 45-49 23.49527192675239 28.053234602491617 27.768049232000802 20.683444238755193 50-54 23.272454340755566 27.430572929697274 28.476357267950963 20.820615461596198 55-59 23.66274706029522 27.645734300725543 28.17613209907431 20.515386539904927 60-64 23.29246935201401 27.76582436827621 27.910933199899922 21.030773079809858 65-69 23.787840880660497 26.880160120090068 28.216162121591193 21.115836877658246 70-74 23.60854128119218 27.839175876381457 28.104215632344854 20.44806721008151 75-79 23.405 27.455000000000002 28.82 20.32 80-84 23.46 28.360000000000003 27.515 20.665 85-89 23.931196559827992 27.9813990699535 27.60638031901595 20.48102405120256 90-94 23.649459783913564 27.5110044017607 27.976190476190478 20.863345338135254 95-99 23.682762071553665 27.960970728046036 28.17613209907431 20.180135101325995 100-104 23.423423423423422 28.263263263263262 27.74774774774775 20.565565565565567 105-109 24.080284298513437 28.129536012813457 27.774162871014564 20.016016817658542 110-114 23.806425783204883 28.405565008507654 28.02021819637674 19.76779101191072 115-119 23.842882161621215 27.690768076057044 27.980985739304476 20.485364023017265 120-124 24.673505128846635 27.98598949211909 27.415561671253442 19.924943707780834 125-129 23.87335567448607 27.699694893212623 27.90976841894663 20.517181013354673 130-134 24.63862351823138 28.12484369529335 27.504626619316763 19.731906167158506 135-139 25.117582307615333 28.30481336935855 26.993895727008905 19.583708596017214 140-144 24.892403162846563 27.704934440996897 27.5497948153338 19.852867580822743 145-149 24.84108313729416 28.009409880374392 27.07843235397167 20.071074628359778 150-151 26.085868068594316 26.5114532482163 27.137313806483913 20.26536487670547 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.5 27 2.5 28 3.5 29 7.0 30 11.0 31 17.5 32 23.0 33 33.5 34 47.0 35 58.0 36 74.0 37 98.0 38 123.0 39 151.5 40 198.0 41 236.0 42 263.0 43 295.0 44 298.0 45 303.5 46 297.0 47 262.5 48 228.0 49 197.0 50 173.5 51 143.0 52 110.0 53 83.0 54 65.5 55 44.5 56 35.0 57 31.5 58 20.5 59 13.0 60 10.0 61 6.5 62 6.5 63 6.0 64 5.0 65 3.0 66 1.5 67 1.0 68 1.5 69 1.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.025 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.065 30-34 0.02 35-39 0.0 40-44 0.025 45-49 0.065 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.04 95-99 0.075 100-104 0.1 105-109 0.105 110-114 0.09 115-119 0.075 120-124 0.075 125-129 0.034999999999999996 130-134 0.034999999999999996 135-139 0.06999999999999999 140-144 0.09 145-149 0.105 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.5875000000000004 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.6125 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991413 spots for SRR7171442.sra Written 991413 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra Read 991404 spots for SRR7171442.sra Written 991404 spots for SRR7171442.sra SRR ids: ['SRR7171442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1dt678b SRR7171442.sra spots: 19828089 blocks: [[1, 991404], [991405, 1982808], [1982809, 2974212], [2974213, 3965616], [3965617, 4957020], [4957021, 5948424], [5948425, 6939828], [6939829, 7931232], [7931233, 8922636], [8922637, 9914040], [9914041, 10905444], [10905445, 11896848], [11896849, 12888252], [12888253, 13879656], [13879657, 14871060], [14871061, 15862464], [15862465, 16853868], [16853869, 17845272], [17845273, 18836676], [18836677, 19828089]] SRR7171442 file size 6697388 SRR7171442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171442 SRR7171442_1.fastq SRR7171442_2.fastq Input file: SRR7171442_1.fastq Paired file: SRR7171442_2.fastq trimmed: SRR7171442-trimmed-pair1.fastq, SRR7171442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:49:36 2025 >> started Thu Feb 13 18:49:58 2025 >> done (21.714s) 19828089 read pairs processed; of these: 627 ( 0.00%) short read pairs filtered out after trimming by size control 1221 ( 0.01%) empty read pairs filtered out after trimming by size control 19826241 (99.99%) read pairs available; of these: 1980097 ( 9.99%) trimmed read pairs available after processing 17846144 (90.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 1 0.00% 31 4 0.00% 32 0 0.00% 33 3 0.00% 34 3 0.00% 35 2 0.00% 36 2 0.00% 37 4 0.00% 38 4 0.00% 39 6 0.00% 40 6 0.00% 41 7 0.00% 42 10 0.00% 43 4 0.00% 44 7 0.00% 45 11 0.00% 46 12 0.00% 47 10 0.00% 48 14 0.00% 49 12 0.00% 50 18 0.00% 51 24 0.00% 52 22 0.00% 53 34 0.00% 54 35 0.00% 55 39 0.00% 56 49 0.00% 57 47 0.00% 58 50 0.00% 59 65 0.00% 60 72 0.00% 61 78 0.00% 62 109 0.00% 63 143 0.00% 64 202 0.00% 65 151 0.00% 66 195 0.00% 67 218 0.00% 68 246 0.00% 69 326 0.00% 70 397 0.00% 71 382 0.00% 72 512 0.00% 73 566 0.00% 74 694 0.00% 75 758 0.00% 76 791 0.00% 77 864 0.00% 78 1002 0.01% 79 1171 0.01% 80 1403 0.01% 81 1466 0.01% 82 1750 0.01% 83 2047 0.01% 84 2237 0.01% 85 2613 0.01% 86 2900 0.01% 87 3041 0.02% 88 3472 0.02% 89 3828 0.02% 90 4072 0.02% 91 4485 0.02% 92 5076 0.03% 93 5845 0.03% 94 6331 0.03% 95 6904 0.03% 96 7577 0.04% 97 7917 0.04% 98 8482 0.04% 99 9223 0.05% 100 9667 0.05% 101 10714 0.05% 102 11384 0.06% 103 12461 0.06% 104 13234 0.07% 105 14279 0.07% 106 15343 0.08% 107 15716 0.08% 108 16416 0.08% 109 17312 0.09% 110 17788 0.09% 111 18777 0.09% 112 20244 0.10% 113 20970 0.11% 114 22967 0.12% 115 24466 0.12% 116 25986 0.13% 117 31217 0.16% 118 30536 0.15% 119 30240 0.15% 120 28353 0.14% 121 29229 0.15% 122 30606 0.15% 123 31696 0.16% 124 33407 0.17% 125 35095 0.18% 126 36390 0.18% 127 37151 0.19% 128 38166 0.19% 129 38872 0.20% 130 40359 0.20% 131 40995 0.21% 132 42263 0.21% 133 44312 0.22% 134 45664 0.23% 135 47000 0.24% 136 49019 0.25% 137 50243 0.25% 138 51077 0.26% 139 51942 0.26% 140 53377 0.27% 141 61297 0.31% 142 57505 0.29% 143 65452 0.33% 144 64504 0.33% 145 63833 0.32% 146 62430 0.31% 147 65681 0.33% 148 65341 0.33% 149 67360 0.34% 150 71691 0.36% 151 17846144 90.01% 19826241 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=3.0 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=390.68 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=32.8 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.7 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=286.99 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.2 sequence=GAAGAAGAAGAAA SRR7171442 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:50:42 Started mapping on | Feb 13 18:50:42 Finished on | Feb 13 18:52:58 Mapping speed, Million of reads per hour | 524.81 Number of input reads | 19826241 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18689364 Uniquely mapped reads % | 94.27% Average mapped length | 296.61 Number of splices: Total | 19297740 Number of splices: Annotated (sjdb) | 19003764 Number of splices: GT/AG | 18994421 Number of splices: GC/AG | 241320 Number of splices: AT/AC | 12796 Number of splices: Non-canonical | 49203 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500943 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 147970 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 635934 635934 635934 N_multimapping 500943 500943 500943 N_noFeature 425336 18536493 493124 N_ambiguous 175190 1457 89068 UnstrandedReadsAssigned:18088838 PositiveStrandReadsAssigned:151414 NegativeStrandReadsAssigned:18107172 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171442-trimmed-pair1.fastq SRR7171442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,826,241 reads, 18,153,401 reads pseudoaligned [quant] estimated average fragment length: 234.453 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7171442.ke.tsv 34699 SRR7171442.se.tsv 87100 total ==> SRR7171442.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.55 790 24.1164 Potri.005G024800.1.v4.1 1035 801.547 182 12.3696 Potri.004G059700.1.v4.1 961 727.553 33 2.47095 Potri.007G009000.2.v4.1 1416 1182.55 0 0 Potri.003G141000.2.v4.1 2943 2709.55 552 11.0983 Potri.016G087400.1.v4.1 270 79.964 1346 916.991 Potri.015G069301.1.v4.1 564 334.136 0 0 Potri.010G195200.1.v4.1 1773 1539.55 111.599 3.94895 Potri.012G127500.1.v4.1 977 743.547 2722 199.431 ==> SRR7171442.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 117 SRR7171442 completed mapping pipeline successfully