Starting /dee2/code/volunteer_pipeline.sh SRR7171443 current disk space = 3088597979136 free memory = 1450204648 SRR7171443 SRAfilesize 9365c59a3706656ba6282c87f0cafb99 SRR7171443.sra SRR7171443.sra file validated SRR7171443 is paired end SRR7171443 is conventional basespace SRR7171443 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31625 33.0 33.0 34.0 32.0 34.0 2 31.415 33.0 31.0 33.0 27.0 34.0 3 32.481 33.0 33.0 33.0 31.0 34.0 4 33.03475 33.0 33.0 34.0 32.0 34.0 5 33.1495 33.0 33.0 34.0 33.0 34.0 6 36.81675 38.0 37.0 38.0 34.0 38.0 7 37.1555 38.0 38.0 38.0 35.0 38.0 8 37.4995 38.0 38.0 38.0 37.0 38.0 9 37.58525 38.0 38.0 38.0 38.0 38.0 10-14 37.66255 38.0 38.0 38.0 38.0 38.0 15-19 37.65195000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.677049999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.662200000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.63365 38.0 38.0 38.0 38.0 38.0 35-39 37.62765 38.0 38.0 38.0 38.0 38.0 40-44 37.6338 38.0 38.0 38.0 38.0 38.0 45-49 37.59915 38.0 38.0 38.0 38.0 38.0 50-54 37.5418 38.0 38.0 38.0 38.0 38.0 55-59 37.521100000000004 38.0 38.0 38.0 37.8 38.0 60-64 37.483999999999995 38.0 38.0 38.0 37.4 38.0 65-69 37.437400000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.41234999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.3261 38.0 38.0 38.0 37.0 38.0 80-84 37.283500000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.282500000000006 38.0 38.0 38.0 36.6 38.0 90-94 37.14515 38.0 38.0 38.0 36.0 38.0 95-99 37.061 38.0 38.0 38.0 36.0 38.0 100-104 37.043 38.0 38.0 38.0 36.0 38.0 105-109 36.93525 38.0 38.0 38.0 35.4 38.0 110-114 36.82 38.0 38.0 38.0 35.0 38.0 115-119 36.820299999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.65075 38.0 38.0 38.0 34.4 38.0 125-129 36.485749999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.416 38.0 38.0 38.0 34.0 38.0 135-139 36.19995 38.0 37.2 38.0 33.2 38.0 140-144 36.02765 38.0 36.2 38.0 32.6 38.0 145-149 35.80195 38.0 36.0 38.0 31.4 38.0 150-151 33.306875 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 4.0 25 6.0 26 8.0 27 5.0 28 11.0 29 18.0 30 23.0 31 29.0 32 42.0 33 56.0 34 93.0 35 184.0 36 542.0 37 2974.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.518440463645945 12.723919915700737 9.193888303477344 35.56375131717597 2 21.349999999999998 13.675 31.4 33.575 3 19.625 20.424999999999997 24.474999999999998 35.475 4 22.45 27.150000000000002 22.7 27.700000000000003 5 22.45 29.775000000000002 24.325 23.45 6 19.35 33.75 25.45 21.45 7 14.45 26.650000000000002 41.199999999999996 17.7 8 17.075000000000003 26.575 30.85 25.5 9 16.6 26.200000000000003 33.15 24.05 10-14 19.744999999999997 30.595 27.21 22.45 15-19 19.61 29.270000000000003 27.675 23.445 20-24 19.900000000000002 28.76 28.22 23.119999999999997 25-29 20.27 29.585 27.529999999999998 22.615 30-34 19.505 29.125 27.48 23.89 35-39 19.715 29.165000000000003 27.16 23.96 40-44 19.865 29.32 27.315 23.5 45-49 20.165 29.43 27.555000000000003 22.85 50-54 19.78 29.15 27.01 24.060000000000002 55-59 19.950000000000003 29.134999999999998 27.295 23.62 60-64 19.975 28.285 27.834999999999997 23.905 65-69 19.965 28.975 28.050000000000004 23.01 70-74 19.865 28.375 28.225 23.535 75-79 19.68 28.884999999999998 27.85 23.585 80-84 20.044999999999998 28.46 27.785 23.71 85-89 19.705000000000002 28.59 28.225 23.48 90-94 20.485 28.565 27.55 23.400000000000002 95-99 20.369999999999997 28.03 27.355 24.245 100-104 20.40112033610083 28.82364709412824 27.103130939281783 23.67210163048915 105-109 20.246258571500075 28.80024025226488 27.248611041593673 23.704890134641374 110-114 20.93255953572143 28.131879127476484 27.356413848308986 23.579147488493096 115-119 20.855213803450862 28.68217054263566 27.251812953238307 23.210802700675167 120-124 21.21 28.315 26.490000000000002 23.985 125-129 21.245 27.905 27.105 23.745 130-134 21.07 28.689999999999998 26.99 23.25 135-139 21.02 28.435 26.924999999999997 23.62 140-144 20.575 28.21 26.884999999999998 24.33 145-149 21.265 27.474999999999998 27.150000000000002 24.11 150-151 22.112499999999997 28.1125 26.224999999999998 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 2.5 23 3.5 24 2.0 25 2.5 26 5.5 27 6.5 28 6.0 29 10.5 30 15.5 31 21.5 32 33.0 33 45.0 34 58.5 35 81.5 36 109.5 37 127.5 38 136.5 39 160.5 40 191.5 41 224.0 42 264.5 43 273.5 44 259.0 45 255.0 46 262.5 47 239.5 48 213.0 49 191.5 50 157.5 51 154.0 52 132.5 53 96.0 54 66.5 55 46.5 56 37.5 57 24.0 58 22.5 59 17.5 60 10.0 61 7.0 62 2.5 63 4.5 64 5.5 65 2.5 66 1.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.105 110-114 0.06 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.4000000000000004 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.4125 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.25 0.0 0.0 0.0 0.0 132-133 7.85 0.0 0.0 0.0 0.0 134-135 8.375 0.0 0.0 0.0 0.0 136-137 8.9875 0.0 0.0 0.0 0.0 138-139 9.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCAC 10 0.0068396386 144.9375 4 >>END_MODULE SRR7171443 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1505 33.0 33.0 34.0 33.0 34.0 2 33.1835 34.0 33.0 34.0 33.0 34.0 3 33.209 34.0 33.0 34.0 33.0 34.0 4 33.219 34.0 33.0 34.0 33.0 34.0 5 33.21225 34.0 33.0 34.0 33.0 34.0 6 37.3845 38.0 38.0 38.0 38.0 38.0 7 37.3815 38.0 38.0 38.0 38.0 38.0 8 37.301 38.0 38.0 38.0 38.0 38.0 9 37.3315 38.0 38.0 38.0 37.0 38.0 10-14 37.37585 38.0 38.0 38.0 38.0 38.0 15-19 37.351150000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.3838 38.0 38.0 38.0 37.8 38.0 25-29 37.3734 38.0 38.0 38.0 37.8 38.0 30-34 37.3765 38.0 38.0 38.0 37.8 38.0 35-39 37.29755 38.0 38.0 38.0 37.6 38.0 40-44 37.3147 38.0 38.0 38.0 37.0 38.0 45-49 37.262950000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.236200000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.1923 38.0 38.0 38.0 37.0 38.0 60-64 37.17225 38.0 38.0 38.0 37.0 38.0 65-69 37.12705 38.0 38.0 38.0 37.0 38.0 70-74 37.12095000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.0877 38.0 38.0 38.0 36.6 38.0 80-84 37.039100000000005 38.0 38.0 38.0 36.2 38.0 85-89 36.990300000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.80735 38.0 38.0 38.0 35.4 38.0 95-99 36.783 38.0 38.0 38.0 35.4 38.0 100-104 36.677049999999994 38.0 38.0 38.0 34.8 38.0 105-109 36.63135 38.0 38.0 38.0 34.8 38.0 110-114 36.5329 38.0 38.0 38.0 34.4 38.0 115-119 36.353049999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.2033 38.0 37.8 38.0 33.4 38.0 125-129 36.0754 38.0 37.4 38.0 33.0 38.0 130-134 35.9373 38.0 36.6 38.0 32.4 38.0 135-139 35.5736 38.0 36.0 38.0 31.0 38.0 140-144 35.338800000000006 38.0 35.8 38.0 30.0 38.0 145-149 34.767399999999995 38.0 33.8 38.0 26.8 38.0 150-151 31.985375 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 4.0 17 12.0 18 5.0 19 10.0 20 5.0 21 5.0 22 6.0 23 9.0 24 7.0 25 6.0 26 11.0 27 15.0 28 14.0 29 24.0 30 25.0 31 34.0 32 55.0 33 69.0 34 101.0 35 198.0 36 529.0 37 2856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 21.4 12.85 24.925 2 26.3 27.55 27.975 18.175 3 21.349999999999998 29.65 29.175 19.825 4 24.575 33.625 23.175 18.625 5 24.875 36.55 21.175 17.4 6 22.275 36.475 22.675 18.575 7 21.025 22.825 36.175000000000004 19.975 8 22.35 25.324999999999996 27.125 25.2 9 22.175 25.374999999999996 29.975 22.475 10-14 23.919999999999998 29.32 25.569999999999997 21.19 15-19 23.64 27.88 27.27 21.21 20-24 23.674999999999997 28.01 27.529999999999998 20.785 25-29 23.605 28.17 27.105 21.12 30-34 23.794999999999998 28.28 27.11 20.815 35-39 23.525 28.294999999999998 27.35 20.830000000000002 40-44 23.73 28.435 27.015 20.82 45-49 23.294999999999998 28.044999999999998 27.735 20.925 50-54 23.755000000000003 28.255000000000003 27.544999999999998 20.445 55-59 23.93 27.52 27.82 20.73 60-64 23.135 27.975 27.935 20.955 65-69 23.69 27.99 27.3 21.02 70-74 23.53 27.63 28.005000000000003 20.835 75-79 23.935000000000002 27.125 28.134999999999998 20.805 80-84 23.41 28.175 27.779999999999998 20.635 85-89 24.310000000000002 27.215 27.815 20.66 90-94 23.415 28.48 27.845 20.26 95-99 23.51 28.110000000000003 27.975 20.405 100-104 24.015 27.389999999999997 27.685 20.91 105-109 23.785 27.925 27.925 20.365 110-114 23.794999999999998 28.185 27.43 20.59 115-119 24.59 28.375 26.805 20.23 120-124 23.93 27.189999999999998 28.544999999999998 20.335 125-129 24.42 27.325 27.98 20.275000000000002 130-134 25.019999999999996 28.15 27.235 19.595000000000002 135-139 24.82 27.735 27.560000000000002 19.885 140-144 25.64 27.105 27.57 19.685 145-149 26.08 27.21 27.3 19.41 150-151 25.7 27.425 27.5125 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 0.5 26 3.0 27 4.0 28 4.5 29 7.5 30 9.0 31 13.5 32 16.0 33 20.0 34 34.0 35 50.5 36 76.0 37 109.0 38 132.0 39 158.5 40 186.5 41 218.5 42 258.0 43 268.5 44 283.5 45 305.0 46 283.0 47 255.0 48 240.0 49 214.0 50 182.0 51 149.0 52 119.5 53 103.5 54 76.5 55 51.5 56 36.0 57 27.0 58 24.0 59 18.5 60 14.5 61 10.0 62 7.5 63 4.0 64 6.0 65 5.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.4749999999999996 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.262499999999999 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.6375 0.0 0.0 0.0 0.0 130-131 7.2375 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.412500000000001 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra Read 659509 spots for SRR7171443.sra Written 659509 spots for SRR7171443.sra Read 659493 spots for SRR7171443.sra Written 659493 spots for SRR7171443.sra SRR ids: ['SRR7171443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__eu8sm8m SRR7171443.sra spots: 13189876 blocks: [[1, 659493], [659494, 1318986], [1318987, 1978479], [1978480, 2637972], [2637973, 3297465], [3297466, 3956958], [3956959, 4616451], [4616452, 5275944], [5275945, 5935437], [5935438, 6594930], [6594931, 7254423], [7254424, 7913916], [7913917, 8573409], [8573410, 9232902], [9232903, 9892395], [9892396, 10551888], [10551889, 11211381], [11211382, 11870874], [11870875, 12530367], [12530368, 13189876]] SRR7171443 file size 4447915 SRR7171443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171443 SRR7171443_1.fastq SRR7171443_2.fastq Input file: SRR7171443_1.fastq Paired file: SRR7171443_2.fastq trimmed: SRR7171443-trimmed-pair1.fastq, SRR7171443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:06:32 2025 >> started Thu Feb 13 18:06:46 2025 >> done (14.378s) 13189876 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 1436 ( 0.01%) empty read pairs filtered out after trimming by size control 13188413 (99.99%) read pairs available; of these: 2035606 (15.43%) trimmed read pairs available after processing 11152807 (84.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 2 0.00% 36 2 0.00% 37 5 0.00% 38 1 0.00% 39 6 0.00% 40 0 0.00% 41 4 0.00% 42 4 0.00% 43 6 0.00% 44 5 0.00% 45 5 0.00% 46 5 0.00% 47 8 0.00% 48 15 0.00% 49 13 0.00% 50 17 0.00% 51 11 0.00% 52 16 0.00% 53 28 0.00% 54 32 0.00% 55 25 0.00% 56 29 0.00% 57 55 0.00% 58 52 0.00% 59 58 0.00% 60 79 0.00% 61 80 0.00% 62 92 0.00% 63 138 0.00% 64 173 0.00% 65 163 0.00% 66 205 0.00% 67 237 0.00% 68 304 0.00% 69 366 0.00% 70 422 0.00% 71 501 0.00% 72 565 0.00% 73 684 0.01% 74 798 0.01% 75 872 0.01% 76 1041 0.01% 77 1207 0.01% 78 1410 0.01% 79 1549 0.01% 80 1729 0.01% 81 2013 0.02% 82 2424 0.02% 83 2614 0.02% 84 3090 0.02% 85 3389 0.03% 86 3877 0.03% 87 4223 0.03% 88 4665 0.04% 89 5162 0.04% 90 5648 0.04% 91 6225 0.05% 92 6892 0.05% 93 7777 0.06% 94 8470 0.06% 95 9018 0.07% 96 9844 0.07% 97 10429 0.08% 98 11133 0.08% 99 11745 0.09% 100 12787 0.10% 101 13817 0.10% 102 14692 0.11% 103 15617 0.12% 104 16713 0.13% 105 17533 0.13% 106 18954 0.14% 107 19783 0.15% 108 20266 0.15% 109 20906 0.16% 110 21995 0.17% 111 22821 0.17% 112 23870 0.18% 113 25455 0.19% 114 26583 0.20% 115 28284 0.21% 116 29023 0.22% 117 30023 0.23% 118 30453 0.23% 119 31280 0.24% 120 31820 0.24% 121 33184 0.25% 122 34715 0.26% 123 35743 0.27% 124 37393 0.28% 125 38073 0.29% 126 39865 0.30% 127 39775 0.30% 128 40900 0.31% 129 41595 0.32% 130 42451 0.32% 131 43372 0.33% 132 44597 0.34% 133 45634 0.35% 134 46812 0.35% 135 48537 0.37% 136 48632 0.37% 137 50092 0.38% 138 50814 0.39% 139 51086 0.39% 140 51714 0.39% 141 52539 0.40% 142 53725 0.41% 143 54333 0.41% 144 55536 0.42% 145 56852 0.43% 146 57038 0.43% 147 58561 0.44% 148 58805 0.45% 149 58738 0.45% 150 60151 0.46% 151 11152807 84.57% 13188413 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.47 fanout-score-rank=11 prefix-density=0.39 prefix-fanout=3.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=60.63 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.4 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.73 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=86.92 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.5 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171443 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:07:38 Started mapping on | Feb 13 18:07:38 Finished on | Feb 13 18:09:47 Mapping speed, Million of reads per hour | 368.05 Number of input reads | 13188413 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11969277 Uniquely mapped reads % | 90.76% Average mapped length | 293.46 Number of splices: Total | 11171937 Number of splices: Annotated (sjdb) | 10933179 Number of splices: GT/AG | 10987158 Number of splices: GC/AG | 144283 Number of splices: AT/AC | 9337 Number of splices: Non-canonical | 31159 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322753 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 105366 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.87% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896383 896383 896383 N_multimapping 322753 322753 322753 N_noFeature 298787 11850909 342206 N_ambiguous 132601 655 57284 UnstrandedReadsAssigned:11537889 PositiveStrandReadsAssigned:117713 NegativeStrandReadsAssigned:11569787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171443-trimmed-pair1.fastq SRR7171443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,188,413 reads, 11,656,418 reads pseudoaligned [quant] estimated average fragment length: 215.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7171443.ke.tsv 34699 SRR7171443.se.tsv 87100 total ==> SRR7171443.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.11 665 26.1163 Potri.005G024800.1.v4.1 1035 820.108 271 23.3997 Potri.004G059700.1.v4.1 961 746.108 69 6.54877 Potri.007G009000.2.v4.1 1416 1201.11 0 0 Potri.003G141000.2.v4.1 2943 2728.11 323 8.38404 Potri.016G087400.1.v4.1 270 88.4153 1253.2 1003.71 Potri.015G069301.1.v4.1 564 350.837 0 0 Potri.010G195200.1.v4.1 1773 1558.11 226 10.2713 Potri.012G127500.1.v4.1 977 762.108 8395 780.04 ==> SRR7171443.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 383 SRR7171443 completed mapping pipeline successfully