Starting /dee2/code/volunteer_pipeline.sh SRR7171444 current disk space = 3088231829504 free memory = 1424598336 SRR7171444 SRAfilesize 37fb2be5d7c27dc728fdaa6860e73433 SRR7171444.sra SRR7171444.sra file validated SRR7171444 is paired end SRR7171444 is conventional basespace SRR7171444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.05375 31.0 18.0 33.0 18.0 33.0 2 31.825 33.0 32.0 33.0 27.0 34.0 3 32.15 33.0 32.0 33.0 31.0 34.0 4 32.60475 33.0 33.0 34.0 32.0 34.0 5 32.88325 33.0 33.0 34.0 32.0 34.0 6 37.02675 38.0 37.0 38.0 36.0 38.0 7 37.4755 38.0 38.0 38.0 37.0 38.0 8 37.5355 38.0 38.0 38.0 37.0 38.0 9 37.571 38.0 38.0 38.0 38.0 38.0 10-14 37.63585 38.0 38.0 38.0 38.0 38.0 15-19 37.648250000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.608549999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.45595 38.0 38.0 38.0 37.6 38.0 30-34 37.4345 38.0 38.0 38.0 38.0 38.0 35-39 37.402 38.0 38.0 38.0 37.4 38.0 40-44 37.425 38.0 38.0 38.0 37.4 38.0 45-49 37.5192 38.0 38.0 38.0 37.8 38.0 50-54 37.42355 38.0 38.0 38.0 37.2 38.0 55-59 37.275099999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.231049999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.3073 38.0 38.0 38.0 37.0 38.0 70-74 37.2722 38.0 38.0 38.0 37.0 38.0 75-79 37.2653 38.0 38.0 38.0 36.8 38.0 80-84 37.2347 38.0 38.0 38.0 36.4 38.0 85-89 37.19785 38.0 38.0 38.0 36.0 38.0 90-94 37.1561 38.0 38.0 38.0 36.0 38.0 95-99 36.988749999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.8913 38.0 38.0 38.0 35.0 38.0 105-109 36.8365 38.0 38.0 38.0 35.0 38.0 110-114 36.614050000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.47315 38.0 37.8 38.0 34.0 38.0 120-124 36.324400000000004 38.0 37.8 38.0 33.8 38.0 125-129 36.29385 38.0 37.8 38.0 33.8 38.0 130-134 36.26635 38.0 37.2 38.0 33.8 38.0 135-139 35.99235 38.0 36.6 38.0 32.6 38.0 140-144 35.7313 38.0 36.0 38.0 31.0 38.0 145-149 35.46155 38.0 35.8 38.0 31.0 38.0 150-151 33.343625 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 1.0 24 6.0 25 8.0 26 8.0 27 6.0 28 12.0 29 24.0 30 27.0 31 38.0 32 58.0 33 91.0 34 130.0 35 217.0 36 598.0 37 2772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.556390977443606 9.924812030075188 8.822055137844611 38.69674185463659 2 21.75 13.425 36.35 28.475 3 21.275 18.15 25.525 35.05 4 22.625 27.1 22.7 27.575 5 21.224999999999998 31.65 24.75 22.375 6 18.125 34.55 26.474999999999998 20.849999999999998 7 14.099999999999998 25.825 41.099999999999994 18.975 8 17.675 26.075 31.8 24.45 9 16.425 24.15 35.775 23.65 10-14 19.580000000000002 29.775000000000002 27.705000000000002 22.939999999999998 15-19 19.725 28.335 28.425 23.515 20-24 19.62 28.435 28.38 23.565 25-29 19.7 28.285 28.465 23.549999999999997 30-34 19.195 28.799999999999997 28.694999999999997 23.31 35-39 19.675 28.315 28.060000000000002 23.95 40-44 20.07 28.435 28.23 23.265 45-49 19.689999999999998 27.900000000000002 28.444999999999997 23.965 50-54 19.775000000000002 28.305000000000003 28.144999999999996 23.775 55-59 19.805 28.51 28.439999999999998 23.244999999999997 60-64 19.895 28.494999999999997 28.13 23.48 65-69 20.115 28.345 27.92 23.62 70-74 20.505000000000003 28.105000000000004 28.185 23.205000000000002 75-79 19.91 28.425 28.115000000000002 23.549999999999997 80-84 20.06 28.565 28.335 23.04 85-89 19.93 28.625 27.765 23.68 90-94 20.46 28.305000000000003 27.689999999999998 23.544999999999998 95-99 20.150000000000002 28.575 27.955000000000002 23.32 100-104 20.085 28.775000000000002 27.91 23.23 105-109 20.395 27.74 27.88 23.985 110-114 20.599999999999998 28.115000000000002 28.125 23.16 115-119 20.669999999999998 27.744999999999997 27.944999999999997 23.64 120-124 20.3 28.249999999999996 27.275 24.175 125-129 20.415 27.639999999999997 28.33 23.615 130-134 20.630000000000003 28.37 27.27 23.73 135-139 20.244999999999997 28.544999999999998 27.310000000000002 23.9 140-144 20.815 28.57 27.284999999999997 23.330000000000002 145-149 20.435 28.17 27.08 24.315 150-151 20.225 27.8625 27.525 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 0.5 25 0.0 26 1.5 27 4.0 28 8.0 29 12.0 30 14.0 31 17.5 32 29.0 33 40.0 34 48.0 35 61.0 36 85.5 37 118.0 38 154.5 39 190.5 40 216.5 41 243.5 42 250.5 43 268.5 44 287.0 45 260.0 46 265.0 47 268.0 48 229.5 49 193.5 50 175.0 51 144.5 52 104.5 53 88.5 54 60.0 55 39.0 56 29.0 57 20.5 58 19.5 59 12.5 60 9.0 61 7.5 62 5.5 63 5.0 64 3.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0125 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.1125 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.4125 0.0 0.0 0.025 0.0 94-95 0.475 0.0 0.0 0.025 0.0 96-97 0.575 0.0 0.0 0.025 0.0 98-99 0.725 0.0 0.0 0.025 0.0 100-101 0.8125 0.0 0.0 0.025 0.0 102-103 0.8625 0.0 0.0 0.025 0.0 104-105 0.9375 0.0 0.0 0.025 0.0 106-107 1.1375 0.0 0.0 0.025 0.0 108-109 1.3375 0.0 0.0 0.025 0.0 110-111 1.6 0.0 0.0 0.025 0.0 112-113 1.9125 0.0 0.0 0.025 0.0 114-115 2.25 0.0 0.0 0.025 0.0 116-117 2.5374999999999996 0.0 0.0 0.025 0.0 118-119 2.9625 0.0 0.0 0.025 0.0 120-121 3.35 0.0 0.0 0.025 0.0 122-123 3.775 0.0 0.0 0.025 0.0 124-125 4.2125 0.0 0.0 0.025 0.0 126-127 4.55 0.0 0.0 0.025 0.0 128-129 4.9125 0.0 0.0 0.025 0.0 130-131 5.3375 0.0 0.0 0.025 0.0 132-133 5.875 0.0 0.0 0.025 0.0 134-135 6.3375 0.0 0.0 0.025 0.0 136-137 6.95 0.0 0.0 0.025 0.0 138-139 7.3375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88875 33.0 33.0 34.0 32.0 34.0 2 32.92275 34.0 33.0 34.0 32.0 34.0 3 33.0405 34.0 33.0 34.0 32.0 34.0 4 32.92975 34.0 33.0 34.0 32.0 34.0 5 32.88675 34.0 33.0 34.0 32.0 34.0 6 37.07725 38.0 38.0 38.0 37.0 38.0 7 37.0665 38.0 38.0 38.0 37.0 38.0 8 37.093 38.0 38.0 38.0 37.0 38.0 9 37.00275 38.0 38.0 38.0 37.0 38.0 10-14 36.996849999999995 38.0 38.0 38.0 36.4 38.0 15-19 36.99249999999999 38.0 38.0 38.0 36.4 38.0 20-24 36.9854 38.0 38.0 38.0 36.4 38.0 25-29 37.0056 38.0 38.0 38.0 36.6 38.0 30-34 37.218900000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.19355 38.0 38.0 38.0 37.0 38.0 40-44 37.194500000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.100199999999994 38.0 38.0 38.0 36.8 38.0 50-54 37.00775 38.0 38.0 38.0 36.2 38.0 55-59 36.94405 38.0 38.0 38.0 36.0 38.0 60-64 36.794349999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.85535 38.0 38.0 38.0 35.8 38.0 70-74 36.9338 38.0 38.0 38.0 36.0 38.0 75-79 36.95635 38.0 38.0 38.0 36.0 38.0 80-84 36.87225 38.0 38.0 38.0 35.6 38.0 85-89 36.812250000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.72935 38.0 38.0 38.0 35.0 38.0 95-99 36.6802 38.0 38.0 38.0 35.0 38.0 100-104 36.5379 38.0 38.0 38.0 34.0 38.0 105-109 36.373400000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.19365 38.0 38.0 38.0 33.4 38.0 115-119 35.956149999999994 38.0 37.2 38.0 32.4 38.0 120-124 35.8389 38.0 37.0 38.0 31.0 38.0 125-129 35.6023 38.0 36.4 38.0 30.4 38.0 130-134 35.69165 38.0 36.2 38.0 31.0 38.0 135-139 35.32755 38.0 35.8 38.0 29.4 38.0 140-144 34.96469999999999 38.0 35.2 38.0 26.8 38.0 145-149 34.64535 38.0 35.0 38.0 24.2 38.0 150-151 32.53125 36.5 29.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 4.0 18 4.0 19 3.0 20 6.0 21 4.0 22 8.0 23 11.0 24 10.0 25 12.0 26 14.0 27 24.0 28 25.0 29 38.0 30 56.0 31 69.0 32 64.0 33 92.0 34 147.0 35 229.0 36 497.0 37 2677.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.125 20.8 14.975 29.099999999999998 2 25.181658732147334 26.384364820846905 31.27035830618892 17.163618140816837 3 21.172638436482085 29.29090453520421 29.391130042595844 20.145326985717865 4 23.859649122807017 33.68421052631579 24.160401002506266 18.295739348370926 5 24.235588972431078 35.037593984962406 23.458646616541355 17.26817042606516 6 20.62062062062062 37.787787787787785 23.273273273273272 18.31831831831832 7 19.874843554443054 21.576971214017522 39.94993742177722 18.598247809762203 8 21.076345431789736 26.107634543178975 28.510638297872344 24.30538172715895 9 22.40300375469337 25.056320400500624 30.76345431789737 21.777221526908637 10-14 23.95953322982922 28.627234937647117 26.13311964741824 21.280112185105423 15-19 23.699364077912975 28.1057533423464 27.45480947373692 20.740073106003706 20-24 23.28540654275838 28.20499974951155 28.069735985171086 20.43985772255899 25-29 23.7284741690028 27.89347216659992 27.71325590708851 20.66479775730877 30-34 23.06961392278456 28.200640128025604 27.81056211242248 20.919183836767353 35-39 23.34 28.050000000000004 27.46 21.15 40-44 23.216608304152075 28.3591795897949 27.743871935967984 20.680340170085042 45-49 22.966746794871796 28.51061698717949 27.48397435897436 21.038661858974358 50-54 23.06382126039475 28.664462478709545 27.722673078849812 20.549043182045885 55-59 23.068062302799618 28.492011819502178 28.041268092352382 20.39865778534582 60-64 22.8515625 28.114983974358974 28.22015224358974 20.813301282051285 65-69 23.48553119054771 28.657254430759988 27.726043857014123 20.131170521678182 70-74 22.99844976746512 28.679301895284294 27.76916537480622 20.553082962444368 75-79 23.175 28.51 27.91 20.405 80-84 23.555 27.950000000000003 28.32 20.175 85-89 23.791189559477974 28.32141607080354 27.03635181759088 20.85104255212761 90-94 23.910323775208926 28.22899464544863 27.583445929039684 20.277235650302757 95-99 23.73441490160733 28.581443092484104 27.434780431625853 20.24936157428271 100-104 23.57951698566991 28.595049604168754 27.412566389417776 20.412867020743562 105-109 23.838869682849843 28.12766170649832 28.05250764066336 19.980960969988477 110-114 23.743674532792227 28.28799038027957 28.02745628538504 19.940878801543164 115-119 24.046891438304694 28.23505836380943 27.724061920745452 19.993988277140424 120-124 24.071106659989987 28.42263395092639 27.581372058087126 19.924887330996494 125-129 23.901950975487743 28.43421710855428 28.01400700350175 19.64982491245623 130-134 24.53349342138176 28.440642353294308 27.365050777927863 19.660813447396066 135-139 24.800961394021332 28.686595563567174 26.39827750237845 20.114165540033046 140-144 25.031314194097902 28.31805200661356 27.496367553484642 19.154266245803896 145-149 25.17913514055219 28.200631357418448 26.857744149922336 19.76248935210703 150-151 25.482335254322226 27.19869706840391 27.72488098220997 19.594086695063893 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 3.0 27 4.5 28 6.5 29 8.0 30 10.0 31 13.5 32 19.0 33 28.0 34 39.0 35 53.0 36 79.0 37 106.5 38 131.0 39 178.5 40 224.0 41 248.5 42 277.0 43 305.0 44 306.5 45 297.5 46 273.0 47 243.0 48 233.5 49 200.5 50 150.5 51 119.5 52 104.5 53 86.0 54 68.0 55 52.5 56 35.0 57 24.0 58 15.0 59 12.0 60 11.0 61 6.5 62 3.5 63 4.0 64 3.5 65 1.0 66 0.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.22499999999999998 4 0.25 5 0.25 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.165 15-19 0.145 20-24 0.19499999999999998 25-29 0.12 30-34 0.02 35-39 0.0 40-44 0.05 45-49 0.16 50-54 0.19 55-59 0.165 60-64 0.16 65-69 0.13 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.08499999999999999 95-99 0.145 100-104 0.21 105-109 0.20500000000000002 110-114 0.20500000000000002 115-119 0.19499999999999998 120-124 0.15 125-129 0.05 130-134 0.055 135-139 0.145 140-144 0.20500000000000002 145-149 0.215 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.22499999999999998 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5249999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.275 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.800000000000001 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.8875 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCATT 10 0.006830828 145.0 2 >>END_MODULE Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007212 spots for SRR7171444.sra Written 1007212 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra Read 1007203 spots for SRR7171444.sra Written 1007203 spots for SRR7171444.sra SRR ids: ['SRR7171444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fnyc6m1e SRR7171444.sra spots: 20144069 blocks: [[1, 1007203], [1007204, 2014406], [2014407, 3021609], [3021610, 4028812], [4028813, 5036015], [5036016, 6043218], [6043219, 7050421], [7050422, 8057624], [8057625, 9064827], [9064828, 10072030], [10072031, 11079233], [11079234, 12086436], [12086437, 13093639], [13093640, 14100842], [14100843, 15108045], [15108046, 16115248], [16115249, 17122451], [17122452, 18129654], [18129655, 19136857], [19136858, 20144069]] SRR7171444 file size 6804463 SRR7171444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171444 SRR7171444_1.fastq SRR7171444_2.fastq Input file: SRR7171444_1.fastq Paired file: SRR7171444_2.fastq trimmed: SRR7171444-trimmed-pair1.fastq, SRR7171444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:22:34 2025 >> started Thu Feb 13 18:22:56 2025 >> done (22.094s) 20144069 read pairs processed; of these: 613 ( 0.00%) short read pairs filtered out after trimming by size control 1510 ( 0.01%) empty read pairs filtered out after trimming by size control 20141946 (99.99%) read pairs available; of these: 2410382 (11.97%) trimmed read pairs available after processing 17731564 (88.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 0 0.00% 33 5 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 4 0.00% 39 3 0.00% 40 9 0.00% 41 7 0.00% 42 6 0.00% 43 9 0.00% 44 3 0.00% 45 8 0.00% 46 16 0.00% 47 10 0.00% 48 12 0.00% 49 19 0.00% 50 19 0.00% 51 24 0.00% 52 27 0.00% 53 34 0.00% 54 32 0.00% 55 43 0.00% 56 39 0.00% 57 65 0.00% 58 71 0.00% 59 89 0.00% 60 88 0.00% 61 129 0.00% 62 131 0.00% 63 143 0.00% 64 181 0.00% 65 214 0.00% 66 214 0.00% 67 292 0.00% 68 323 0.00% 69 393 0.00% 70 430 0.00% 71 497 0.00% 72 578 0.00% 73 675 0.00% 74 797 0.00% 75 948 0.00% 76 1014 0.01% 77 1211 0.01% 78 1328 0.01% 79 1554 0.01% 80 1759 0.01% 81 1970 0.01% 82 2342 0.01% 83 2632 0.01% 84 3064 0.02% 85 3436 0.02% 86 3803 0.02% 87 4161 0.02% 88 4749 0.02% 89 5143 0.03% 90 5564 0.03% 91 6162 0.03% 92 6778 0.03% 93 7742 0.04% 94 8560 0.04% 95 9389 0.05% 96 10008 0.05% 97 10681 0.05% 98 11511 0.06% 99 12319 0.06% 100 13292 0.07% 101 14201 0.07% 102 14923 0.07% 103 16561 0.08% 104 17647 0.09% 105 18887 0.09% 106 20003 0.10% 107 20730 0.10% 108 21816 0.11% 109 22383 0.11% 110 23456 0.12% 111 24890 0.12% 112 26323 0.13% 113 27304 0.14% 114 28966 0.14% 115 30883 0.15% 116 33008 0.16% 117 38201 0.19% 118 37489 0.19% 119 38210 0.19% 120 36038 0.18% 121 36968 0.18% 122 38734 0.19% 123 40404 0.20% 124 42210 0.21% 125 43481 0.22% 126 45219 0.22% 127 46282 0.23% 128 47047 0.23% 129 48207 0.24% 130 49030 0.24% 131 50103 0.25% 132 51740 0.26% 133 53855 0.27% 134 55079 0.27% 135 56696 0.28% 136 58599 0.29% 137 59412 0.29% 138 61160 0.30% 139 62346 0.31% 140 63170 0.31% 141 71531 0.36% 142 68209 0.34% 143 74822 0.37% 144 73965 0.37% 145 73543 0.37% 146 71787 0.36% 147 75209 0.37% 148 75473 0.37% 149 76383 0.38% 150 80997 0.40% 151 17731564 88.03% 20141946 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.15 prefix-fanout=1.9 sequence=GCAATGATTGTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=420.81 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=30.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=34 prefix-density=0.15 prefix-fanout=2.5 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=390.65 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=30.5 sequence=AAGAAGAAGAAA SRR7171444 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:23:40 Started mapping on | Feb 13 18:23:40 Finished on | Feb 13 18:25:38 Mapping speed, Million of reads per hour | 614.50 Number of input reads | 20141946 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19006988 Uniquely mapped reads % | 94.37% Average mapped length | 295.64 Number of splices: Total | 18666279 Number of splices: Annotated (sjdb) | 18276105 Number of splices: GT/AG | 18362943 Number of splices: GC/AG | 243252 Number of splices: AT/AC | 14057 Number of splices: Non-canonical | 46027 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505779 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 104844 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 629179 629179 629179 N_multimapping 505779 505779 505779 N_noFeature 519206 18835794 588949 N_ambiguous 196875 1041 94927 UnstrandedReadsAssigned:18290907 PositiveStrandReadsAssigned:170153 NegativeStrandReadsAssigned:18323112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171444-trimmed-pair1.fastq SRR7171444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,141,946 reads, 18,379,362 reads pseudoaligned [quant] estimated average fragment length: 229.732 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR7171444.ke.tsv 34699 SRR7171444.se.tsv 87100 total ==> SRR7171444.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.27 845 26.1482 Potri.005G024800.1.v4.1 1035 806.268 176 12.0863 Potri.004G059700.1.v4.1 961 732.268 69 5.21722 Potri.007G009000.2.v4.1 1416 1187.27 0 0 Potri.003G141000.2.v4.1 2943 2714.27 562.237 11.469 Potri.016G087400.1.v4.1 270 83.0513 1212 808.009 Potri.015G069301.1.v4.1 564 338.21 0 0 Potri.010G195200.1.v4.1 1773 1544.27 244 8.74837 Potri.012G127500.1.v4.1 977 748.268 9262 685.343 ==> SRR7171444.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 316 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 502 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 215 SRR7171444 completed mapping pipeline successfully