Starting /dee2/code/volunteer_pipeline.sh SRR7171445 current disk space = 3116513378304 free memory = 1578288756 SRR7171445 SRAfilesize 6c83d3d3fbe201245d99d3daea64b2ec SRR7171445.sra SRR7171445.sra file validated SRR7171445 is paired end SRR7171445 is conventional basespace SRR7171445 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74925 33.0 33.0 34.0 32.0 34.0 2 32.04325 33.0 32.0 33.0 28.0 34.0 3 32.85 33.0 33.0 34.0 32.0 34.0 4 33.30625 34.0 33.0 34.0 33.0 34.0 5 33.28225 34.0 33.0 34.0 33.0 34.0 6 36.949 38.0 37.0 38.0 35.0 38.0 7 37.03025 38.0 38.0 38.0 35.0 38.0 8 37.5375 38.0 38.0 38.0 37.0 38.0 9 37.595 38.0 38.0 38.0 38.0 38.0 10-14 37.6677 38.0 38.0 38.0 38.0 38.0 15-19 37.66435 38.0 38.0 38.0 38.0 38.0 20-24 37.660450000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6212 38.0 38.0 38.0 38.0 38.0 30-34 37.607899999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.64265 38.0 38.0 38.0 38.0 38.0 40-44 37.5608 38.0 38.0 38.0 38.0 38.0 45-49 37.55255 38.0 38.0 38.0 38.0 38.0 50-54 37.51485 38.0 38.0 38.0 38.0 38.0 55-59 37.4987 38.0 38.0 38.0 37.6 38.0 60-64 37.4644 38.0 38.0 38.0 37.2 38.0 65-69 37.438649999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.383449999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.28535 38.0 38.0 38.0 37.0 38.0 80-84 37.28375 38.0 38.0 38.0 36.8 38.0 85-89 37.2286 38.0 38.0 38.0 36.4 38.0 90-94 37.14685 38.0 38.0 38.0 36.0 38.0 95-99 37.0262 38.0 38.0 38.0 36.0 38.0 100-104 37.05435 38.0 38.0 38.0 36.0 38.0 105-109 36.929050000000004 38.0 38.0 38.0 35.6 38.0 110-114 36.83624999999999 38.0 38.0 38.0 35.0 38.0 115-119 36.7767 38.0 38.0 38.0 35.0 38.0 120-124 36.610699999999994 38.0 38.0 38.0 34.4 38.0 125-129 36.4372 38.0 37.8 38.0 34.0 38.0 130-134 36.31595 38.0 37.8 38.0 33.6 38.0 135-139 36.132349999999995 38.0 37.2 38.0 33.2 38.0 140-144 35.8713 38.0 36.0 38.0 33.0 38.0 145-149 35.749199999999995 38.0 36.0 38.0 31.6 38.0 150-151 33.250375 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 2.0 23 3.0 24 2.0 25 3.0 26 6.0 27 6.0 28 21.0 29 21.0 30 15.0 31 29.0 32 38.0 33 80.0 34 91.0 35 177.0 36 500.0 37 3001.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.270256142185055 12.963930998431783 9.27861996863565 36.487192890747515 2 21.85 15.024999999999999 32.95 30.175 3 19.175 21.175 24.625 35.025 4 22.900000000000002 29.275000000000002 22.25 25.575 5 22.55 33.225 23.95 20.275000000000002 6 20.200000000000003 33.7 24.725 21.375 7 13.8 26.200000000000003 41.375 18.625 8 17.45 27.125 30.3 25.124999999999996 9 17.7 25.474999999999998 33.85 22.975 10-14 19.785 30.014999999999997 27.200000000000003 23.0 15-19 20.330000000000002 28.825 27.415 23.43 20-24 19.805 28.815 27.735 23.645 25-29 20.24 28.634999999999998 27.525 23.599999999999998 30-34 19.295 29.134999999999998 27.785 23.785 35-39 20.064999999999998 28.715000000000003 27.775 23.445 40-44 19.605 28.57 28.04 23.785 45-49 20.29 28.375 27.29 24.044999999999998 50-54 19.785 29.435 27.125 23.655 55-59 20.244999999999997 28.4 27.605 23.75 60-64 19.775000000000002 28.71 27.58 23.935000000000002 65-69 20.19 27.845 28.155 23.810000000000002 70-74 20.225 28.485 28.189999999999998 23.1 75-79 20.575 28.24 27.584999999999997 23.599999999999998 80-84 20.36 28.13 27.485 24.025 85-89 20.375 28.384999999999998 27.57 23.669999999999998 90-94 20.105 28.08 28.044999999999998 23.77 95-99 20.585 28.435 27.634999999999998 23.345 100-104 20.1020102010201 28.962896289628965 26.92269226922692 24.012401240124014 105-109 20.548219287715085 28.591436574629853 27.09083633453381 23.769507803121247 110-114 21.057370079527836 27.984794678137348 27.664682638923622 23.293152603411194 115-119 20.283042456368456 28.434265139770964 27.184077611641744 24.098614792218832 120-124 20.655 27.775 27.255000000000003 24.315 125-129 20.995 27.62 27.355 24.03 130-134 20.775 29.13 26.44 23.655 135-139 21.005 28.194999999999997 26.650000000000002 24.15 140-144 20.919999999999998 28.175 27.200000000000003 23.705000000000002 145-149 20.935000000000002 27.655 27.46 23.95 150-151 20.25 27.825 27.3875 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 0.5 24 2.0 25 2.5 26 4.5 27 8.0 28 8.5 29 13.0 30 23.5 31 27.0 32 29.5 33 40.5 34 60.5 35 81.5 36 85.5 37 101.0 38 127.5 39 150.0 40 188.5 41 232.0 42 237.0 43 250.5 44 270.5 45 255.5 46 254.5 47 261.5 48 247.0 49 206.0 50 178.0 51 162.0 52 131.5 53 94.0 54 64.5 55 45.5 56 36.5 57 30.0 58 16.0 59 12.0 60 14.0 61 9.5 62 6.0 63 7.0 64 4.5 65 2.0 66 2.0 67 2.0 68 2.0 69 2.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.04 110-114 0.034999999999999996 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.4124999999999996 0.0 0.0 0.0 0.0 116-117 3.9375 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.1625 0.0 0.0 0.0 0.0 124-125 5.75 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.475 0.0 0.0 0.0 0.0 134-135 8.9875 0.0 0.0 0.0 0.0 136-137 9.6625 0.0 0.0 0.0 0.0 138-139 10.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171445 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1835 33.0 33.0 34.0 33.0 34.0 2 33.288 34.0 33.0 34.0 33.0 34.0 3 33.29525 34.0 33.0 34.0 33.0 34.0 4 33.282 34.0 33.0 34.0 33.0 34.0 5 33.332 34.0 33.0 34.0 33.0 34.0 6 37.48075 38.0 38.0 38.0 38.0 38.0 7 37.578 38.0 38.0 38.0 38.0 38.0 8 37.52375 38.0 38.0 38.0 38.0 38.0 9 37.49175 38.0 38.0 38.0 38.0 38.0 10-14 37.533699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5243 38.0 38.0 38.0 38.0 38.0 20-24 37.5239 38.0 38.0 38.0 38.0 38.0 25-29 37.4992 38.0 38.0 38.0 38.0 38.0 30-34 37.49335 38.0 38.0 38.0 38.0 38.0 35-39 37.4619 38.0 38.0 38.0 38.0 38.0 40-44 37.435449999999996 38.0 38.0 38.0 37.8 38.0 45-49 37.36595 38.0 38.0 38.0 37.0 38.0 50-54 37.371449999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.32995 38.0 38.0 38.0 37.0 38.0 60-64 37.30409999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.28885 38.0 38.0 38.0 37.0 38.0 70-74 37.26180000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.195350000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.14575 38.0 38.0 38.0 36.8 38.0 85-89 37.133950000000006 38.0 38.0 38.0 36.4 38.0 90-94 37.00985000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.87355 38.0 38.0 38.0 35.4 38.0 100-104 36.8075 38.0 38.0 38.0 35.2 38.0 105-109 36.7177 38.0 38.0 38.0 34.8 38.0 110-114 36.6727 38.0 38.0 38.0 34.8 38.0 115-119 36.5161 38.0 38.0 38.0 34.2 38.0 120-124 36.27565 38.0 38.0 38.0 33.8 38.0 125-129 36.209250000000004 38.0 37.6 38.0 33.6 38.0 130-134 35.95360000000001 38.0 36.6 38.0 32.2 38.0 135-139 35.69425 38.0 36.0 38.0 31.0 38.0 140-144 35.37565000000001 38.0 35.8 38.0 29.8 38.0 145-149 34.91415000000001 38.0 34.4 38.0 27.8 38.0 150-151 32.014375 35.5 28.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 5.0 20 0.0 21 6.0 22 5.0 23 8.0 24 15.0 25 4.0 26 12.0 27 17.0 28 22.0 29 22.0 30 21.0 31 29.0 32 42.0 33 78.0 34 104.0 35 182.0 36 526.0 37 2900.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 22.125 14.000000000000002 25.674999999999997 2 27.474999999999998 25.95 29.675 16.900000000000002 3 20.325 29.049999999999997 31.025000000000002 19.6 4 23.925 33.6 23.45 19.025 5 25.424999999999997 34.475 22.05 18.05 6 23.0 36.3 22.225 18.475 7 20.525 22.275 36.8 20.4 8 23.1 23.549999999999997 27.975 25.374999999999996 9 22.75 25.650000000000002 28.050000000000004 23.549999999999997 10-14 24.21 28.794999999999998 26.179999999999996 20.815 15-19 23.79 28.075 27.29 20.845 20-24 23.645 28.384999999999998 27.415 20.555 25-29 23.135 28.884999999999998 26.855 21.125 30-34 23.175 28.34 27.224999999999998 21.26 35-39 23.345 28.499999999999996 27.46 20.695 40-44 23.82 28.03 27.02 21.13 45-49 23.595 27.565 27.755000000000003 21.085 50-54 23.275000000000002 28.23 27.750000000000004 20.745 55-59 23.73 27.77 27.800000000000004 20.7 60-64 23.52 27.905 27.775 20.8 65-69 24.26 27.58 27.334999999999997 20.825 70-74 23.455000000000002 28.53 27.18 20.835 75-79 23.695 28.345 27.500000000000004 20.46 80-84 23.880000000000003 27.685 27.715 20.72 85-89 23.685000000000002 28.125 27.55 20.64 90-94 23.89 27.87 27.425 20.815 95-99 24.185000000000002 27.685 27.810000000000002 20.32 100-104 24.27 27.935 27.650000000000002 20.145 105-109 23.925 27.894999999999996 27.46 20.72 110-114 24.095 28.105000000000004 27.46 20.34 115-119 24.349999999999998 27.93 27.13 20.59 120-124 25.095 27.83 27.055 20.02 125-129 25.174999999999997 27.425 27.57 19.830000000000002 130-134 25.305 28.105000000000004 26.669999999999998 19.919999999999998 135-139 24.95 28.475 26.479999999999997 20.095 140-144 25.56 27.18 27.235 20.025000000000002 145-149 25.535000000000004 27.785 26.685 19.994999999999997 150-151 26.025 27.224999999999998 27.287499999999998 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 2.0 25 2.5 26 1.5 27 1.0 28 2.5 29 4.0 30 8.0 31 12.5 32 15.0 33 21.5 34 32.0 35 43.0 36 70.5 37 103.0 38 146.5 39 170.0 40 195.0 41 230.0 42 236.0 43 257.5 44 278.0 45 300.5 46 288.0 47 272.0 48 267.5 49 222.5 50 185.0 51 148.5 52 107.5 53 90.0 54 72.5 55 47.0 56 36.0 57 27.5 58 20.0 59 17.5 60 15.5 61 10.0 62 3.5 63 6.0 64 6.5 65 6.0 66 5.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69841668760995 99.175 2 0.20105554159336514 0.4 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025131942699170642 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.699999999999999 0.0 0.0 0.0 0.0 122-123 5.1625 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.2625 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.800000000000001 0.0 0.0 0.0 0.0 132-133 8.4625 0.0 0.0 0.0 0.0 134-135 9.025 0.0 0.0 0.0 0.0 136-137 9.725 0.0 0.0 0.0 0.0 138-139 10.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTTCG 10 0.006830828 145.0 7 >>END_MODULE Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670484 spots for SRR7171445.sra Written 670484 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra Read 670483 spots for SRR7171445.sra Written 670483 spots for SRR7171445.sra SRR ids: ['SRR7171445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o4oqy3t8 SRR7171445.sra spots: 13409661 blocks: [[1, 670483], [670484, 1340966], [1340967, 2011449], [2011450, 2681932], [2681933, 3352415], [3352416, 4022898], [4022899, 4693381], [4693382, 5363864], [5363865, 6034347], [6034348, 6704830], [6704831, 7375313], [7375314, 8045796], [8045797, 8716279], [8716280, 9386762], [9386763, 10057245], [10057246, 10727728], [10727729, 11398211], [11398212, 12068694], [12068695, 12739177], [12739178, 13409661]] SRR7171445 file size 4522393 SRR7171445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171445 SRR7171445_1.fastq SRR7171445_2.fastq Input file: SRR7171445_1.fastq Paired file: SRR7171445_2.fastq trimmed: SRR7171445-trimmed-pair1.fastq, SRR7171445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:39:33 2025 >> started Fri Feb 14 09:39:48 2025 >> done (14.897s) 13409661 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 608 ( 0.00%) empty read pairs filtered out after trimming by size control 13409014 (100.00%) read pairs available; of these: 2267899 (16.91%) trimmed read pairs available after processing 11141115 (83.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 3 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 3 0.00% 39 4 0.00% 40 6 0.00% 41 4 0.00% 42 5 0.00% 43 9 0.00% 44 7 0.00% 45 10 0.00% 46 11 0.00% 47 10 0.00% 48 16 0.00% 49 24 0.00% 50 23 0.00% 51 27 0.00% 52 25 0.00% 53 25 0.00% 54 31 0.00% 55 42 0.00% 56 44 0.00% 57 55 0.00% 58 87 0.00% 59 76 0.00% 60 90 0.00% 61 140 0.00% 62 125 0.00% 63 154 0.00% 64 202 0.00% 65 218 0.00% 66 266 0.00% 67 276 0.00% 68 319 0.00% 69 405 0.00% 70 479 0.00% 71 575 0.00% 72 696 0.01% 73 828 0.01% 74 892 0.01% 75 1062 0.01% 76 1161 0.01% 77 1273 0.01% 78 1414 0.01% 79 1691 0.01% 80 1926 0.01% 81 2305 0.02% 82 2698 0.02% 83 3061 0.02% 84 3501 0.03% 85 3883 0.03% 86 4181 0.03% 87 4625 0.03% 88 5060 0.04% 89 5599 0.04% 90 6220 0.05% 91 7089 0.05% 92 7899 0.06% 93 8827 0.07% 94 9528 0.07% 95 10587 0.08% 96 11017 0.08% 97 11543 0.09% 98 12057 0.09% 99 13130 0.10% 100 14062 0.10% 101 15330 0.11% 102 17052 0.13% 103 18114 0.14% 104 19249 0.14% 105 20354 0.15% 106 21453 0.16% 107 22051 0.16% 108 22758 0.17% 109 23643 0.18% 110 24275 0.18% 111 26152 0.20% 112 27652 0.21% 113 28894 0.22% 114 30959 0.23% 115 32110 0.24% 116 32920 0.25% 117 34070 0.25% 118 34356 0.26% 119 35119 0.26% 120 35345 0.26% 121 37345 0.28% 122 38863 0.29% 123 41083 0.31% 124 42587 0.32% 125 43820 0.33% 126 44765 0.33% 127 45107 0.34% 128 46174 0.34% 129 46249 0.34% 130 46863 0.35% 131 47724 0.36% 132 49688 0.37% 133 50959 0.38% 134 52562 0.39% 135 54638 0.41% 136 55023 0.41% 137 55570 0.41% 138 56573 0.42% 139 55971 0.42% 140 56651 0.42% 141 56648 0.42% 142 58098 0.43% 143 59262 0.44% 144 60588 0.45% 145 62879 0.47% 146 62695 0.47% 147 63899 0.48% 148 64289 0.48% 149 63301 0.47% 150 64532 0.48% 151 11141115 83.09% 13409014 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.76 fanout-score-rank=18 prefix-density=0.97 prefix-fanout=1.8 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=214.74 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=15.0 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=59.92 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=4.4 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171445 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:40:33 Started mapping on | Feb 14 09:40:51 Finished on | Feb 14 09:42:51 Mapping speed, Million of reads per hour | 402.27 Number of input reads | 13409014 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12216486 Uniquely mapped reads % | 91.11% Average mapped length | 292.92 Number of splices: Total | 11574886 Number of splices: Annotated (sjdb) | 11359662 Number of splices: GT/AG | 11388324 Number of splices: GC/AG | 145967 Number of splices: AT/AC | 9345 Number of splices: Non-canonical | 31250 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334500 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 127560 % of reads mapped to too many loci | 0.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.29% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858028 858028 858028 N_multimapping 334500 334500 334500 N_noFeature 319104 12093512 364780 N_ambiguous 135233 906 57379 UnstrandedReadsAssigned:11762149 PositiveStrandReadsAssigned:122068 NegativeStrandReadsAssigned:11794327 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171445-trimmed-pair1.fastq SRR7171445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,409,014 reads, 11,833,623 reads pseudoaligned [quant] estimated average fragment length: 215.189 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7171445.ke.tsv 34699 SRR7171445.se.tsv 87100 total ==> SRR7171445.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.81 954 37.2757 Potri.005G024800.1.v4.1 1035 820.811 225 19.32 Potri.004G059700.1.v4.1 961 746.816 56 5.28497 Potri.007G009000.2.v4.1 1416 1201.81 4 0.23458 Potri.003G141000.2.v4.1 2943 2728.81 427 11.0287 Potri.016G087400.1.v4.1 270 90.664 956.198 743.329 Potri.015G069301.1.v4.1 564 352.277 0 0 Potri.010G195200.1.v4.1 1773 1558.81 218.911 9.89786 Potri.012G127500.1.v4.1 977 762.811 3561 329.021 ==> SRR7171445.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 215 SRR7171445 completed mapping pipeline successfully