Starting /dee2/code/volunteer_pipeline.sh SRR7171446 current disk space = 3088768065536 free memory = 1417168988 SRR7171446 SRAfilesize ab844d6806915276a43e068ea6db4422 SRR7171446.sra SRR7171446.sra file validated SRR7171446 is paired end SRR7171446 is conventional basespace SRR7171446 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.472 33.0 33.0 33.0 32.0 34.0 2 31.798 33.0 32.0 33.0 28.0 34.0 3 31.91125 33.0 32.0 33.0 30.0 34.0 4 32.1835 33.0 32.0 33.0 31.0 33.0 5 32.812 33.0 33.0 33.0 32.0 34.0 6 36.66075 38.0 37.0 38.0 34.0 38.0 7 37.3675 38.0 38.0 38.0 36.0 38.0 8 37.46 38.0 38.0 38.0 37.0 38.0 9 37.51375 38.0 38.0 38.0 38.0 38.0 10-14 37.619899999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.63005 38.0 38.0 38.0 38.0 38.0 20-24 37.6167 38.0 38.0 38.0 38.0 38.0 25-29 37.60875 38.0 38.0 38.0 38.0 38.0 30-34 37.603699999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.571600000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.58395 38.0 38.0 38.0 38.0 38.0 45-49 37.55255 38.0 38.0 38.0 38.0 38.0 50-54 37.530449999999995 38.0 38.0 38.0 37.6 38.0 55-59 37.4807 38.0 38.0 38.0 37.2 38.0 60-64 37.447050000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.42645 38.0 38.0 38.0 37.0 38.0 70-74 37.40835 38.0 38.0 38.0 37.0 38.0 75-79 37.3433 38.0 38.0 38.0 37.0 38.0 80-84 37.30525 38.0 38.0 38.0 37.0 38.0 85-89 37.2963 38.0 38.0 38.0 37.0 38.0 90-94 37.18405 38.0 38.0 38.0 36.0 38.0 95-99 37.07984999999999 38.0 38.0 38.0 36.0 38.0 100-104 37.0073 38.0 38.0 38.0 35.8 38.0 105-109 36.96035 38.0 38.0 38.0 35.4 38.0 110-114 36.84885 38.0 38.0 38.0 35.0 38.0 115-119 36.85125 38.0 38.0 38.0 35.0 38.0 120-124 36.64635 38.0 38.0 38.0 34.2 38.0 125-129 36.39195 38.0 38.0 38.0 33.8 38.0 130-134 36.40845 38.0 38.0 38.0 34.0 38.0 135-139 36.166250000000005 38.0 36.8 38.0 33.0 38.0 140-144 35.9367 38.0 36.2 38.0 32.6 38.0 145-149 35.69775 38.0 36.0 38.0 31.0 38.0 150-151 33.054625 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 2.0 25 9.0 26 7.0 27 6.0 28 19.0 29 17.0 30 17.0 31 22.0 32 56.0 33 64.0 34 95.0 35 207.0 36 517.0 37 2958.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.37379525918208 13.128418859077884 9.064860640791874 42.432925240948165 2 19.725 17.75 31.2 31.324999999999996 3 20.674999999999997 20.599999999999998 25.324999999999996 33.4 4 22.45 27.575 22.925 27.05 5 21.3 32.375 23.7 22.625 6 19.825 35.325 24.675 20.175 7 14.274999999999999 26.325 41.375 18.025 8 18.65 27.6 30.049999999999997 23.7 9 17.125 25.5 33.75 23.625 10-14 19.79 29.154999999999998 27.165 23.89 15-19 20.075000000000003 28.395 27.944999999999997 23.585 20-24 20.21 28.549999999999997 27.26 23.98 25-29 20.3 28.455000000000002 27.474999999999998 23.77 30-34 20.195 28.21 27.08 24.515 35-39 19.77 28.64 27.555000000000003 24.035 40-44 20.005 29.049999999999997 27.455000000000002 23.49 45-49 20.395 27.555000000000003 27.689999999999998 24.36 50-54 20.585 28.035 27.35 24.03 55-59 20.485 28.01 27.655 23.849999999999998 60-64 20.635 28.305000000000003 27.445000000000004 23.615 65-69 20.46 28.225 27.08 24.235 70-74 19.99 28.294999999999998 28.175 23.54 75-79 20.4 28.189999999999998 27.705000000000002 23.705000000000002 80-84 20.645 27.894999999999996 27.334999999999997 24.125 85-89 20.115 27.884999999999998 28.17 23.830000000000002 90-94 20.59 28.000000000000004 27.67 23.74 95-99 20.36 28.305000000000003 27.345000000000002 23.990000000000002 100-104 20.354070814162835 28.285657131426284 27.165433086617323 24.194838967793558 105-109 21.000750562922192 27.875906930197647 27.390542907180386 23.732799599699774 110-114 20.35619590774926 28.610735904747607 26.969833408374605 24.06323477912852 115-119 20.714142828565713 28.435687137427486 27.495499099819966 23.35467093418684 120-124 21.255 27.939999999999998 27.185 23.62 125-129 20.294999999999998 28.139999999999997 27.439999999999998 24.125 130-134 21.34 28.105000000000004 26.674999999999997 23.880000000000003 135-139 21.78 27.61 26.69 23.919999999999998 140-144 21.46 27.855 26.57 24.115000000000002 145-149 21.16 27.894999999999996 26.834999999999997 24.11 150-151 21.1375 27.8875 27.3 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.0 26 3.0 27 6.5 28 7.5 29 7.0 30 13.5 31 20.0 32 23.0 33 26.5 34 41.5 35 59.0 36 76.5 37 103.5 38 128.0 39 148.5 40 172.5 41 206.5 42 247.5 43 266.0 44 283.5 45 299.0 46 290.5 47 279.5 48 240.0 49 216.5 50 190.0 51 142.5 52 109.5 53 88.5 54 81.5 55 57.0 56 36.5 57 31.5 58 24.5 59 15.5 60 11.0 61 7.0 62 5.5 63 5.5 64 5.0 65 4.5 66 3.0 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.075 110-114 0.055 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.475 0.0 0.0 0.0 0.0 130-131 6.112500000000001 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171446 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.088 33.0 33.0 34.0 33.0 34.0 2 33.22725 34.0 33.0 34.0 33.0 34.0 3 33.231 34.0 33.0 34.0 33.0 34.0 4 33.232 34.0 33.0 34.0 33.0 34.0 5 33.21425 34.0 33.0 34.0 33.0 34.0 6 37.485 38.0 38.0 38.0 37.0 38.0 7 37.44475 38.0 38.0 38.0 37.0 38.0 8 37.453 38.0 38.0 38.0 37.0 38.0 9 37.387 38.0 38.0 38.0 37.0 38.0 10-14 37.431349999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.42205 38.0 38.0 38.0 37.2 38.0 20-24 37.41105 38.0 38.0 38.0 37.0 38.0 25-29 37.40085 38.0 38.0 38.0 37.0 38.0 30-34 37.38225 38.0 38.0 38.0 37.0 38.0 35-39 37.364700000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.315200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.29325 38.0 38.0 38.0 37.0 38.0 50-54 37.24165000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2226 38.0 38.0 38.0 36.8 38.0 60-64 37.16785 38.0 38.0 38.0 36.0 38.0 65-69 37.186400000000006 38.0 38.0 38.0 36.2 38.0 70-74 37.1007 38.0 38.0 38.0 36.0 38.0 75-79 37.05445 38.0 38.0 38.0 36.0 38.0 80-84 36.9767 38.0 38.0 38.0 36.0 38.0 85-89 36.903949999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.7882 38.0 38.0 38.0 35.2 38.0 95-99 36.711 38.0 38.0 38.0 34.8 38.0 100-104 36.633399999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.47885 38.0 38.0 38.0 34.0 38.0 110-114 36.46469999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.30069999999999 38.0 37.4 38.0 33.8 38.0 120-124 36.12865 38.0 37.2 38.0 33.2 38.0 125-129 35.950649999999996 38.0 36.6 38.0 32.2 38.0 130-134 35.6684 38.0 36.0 38.0 31.0 38.0 135-139 35.3586 38.0 36.0 38.0 29.8 38.0 140-144 35.02575 38.0 34.6 38.0 27.4 38.0 145-149 34.394850000000005 38.0 33.0 38.0 24.8 38.0 150-151 31.559 35.5 27.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 2.0 19 4.0 20 1.0 21 1.0 22 2.0 23 6.0 24 9.0 25 6.0 26 16.0 27 26.0 28 22.0 29 26.0 30 30.0 31 44.0 32 57.0 33 74.0 34 138.0 35 240.0 36 712.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 20.025000000000002 13.625000000000002 29.475 2 25.124999999999996 26.825 30.225 17.825 3 20.7 30.3 29.849999999999998 19.15 4 23.825 34.9 22.925 18.35 5 24.224999999999998 36.199999999999996 21.975 17.599999999999998 6 21.725 37.824999999999996 22.875 17.575 7 20.45 22.175 36.675000000000004 20.7 8 23.1 26.325 26.35 24.224999999999998 9 21.55 26.075 29.725 22.650000000000002 10-14 24.11 28.555000000000003 26.105 21.23 15-19 23.895 28.24 27.189999999999998 20.674999999999997 20-24 23.810000000000002 28.384999999999998 27.255000000000003 20.549999999999997 25-29 23.515 28.410000000000004 27.229999999999997 20.845 30-34 22.89 28.915000000000003 27.18 21.015 35-39 23.51 28.28 27.41 20.8 40-44 23.205000000000002 28.615000000000002 27.189999999999998 20.990000000000002 45-49 24.11 27.935 27.36 20.595 50-54 23.56 28.225 27.250000000000004 20.965 55-59 23.755000000000003 28.09 27.72 20.435 60-64 23.69 28.125 27.224999999999998 20.96 65-69 23.755000000000003 27.575 27.884999999999998 20.785 70-74 23.49 27.839999999999996 27.700000000000003 20.97 75-79 23.355 27.639999999999997 28.005000000000003 21.0 80-84 24.47 27.694999999999997 27.43 20.405 85-89 24.005000000000003 28.299999999999997 27.395000000000003 20.3 90-94 24.175 27.860000000000003 27.665 20.3 95-99 23.3 27.700000000000003 27.99 21.01 100-104 24.23 27.51 27.755000000000003 20.505000000000003 105-109 24.195 27.22 27.465 21.12 110-114 24.474999999999998 27.505000000000003 27.12 20.9 115-119 24.145 28.09 27.229999999999997 20.535 120-124 24.6 27.855 27.405 20.14 125-129 24.58 27.765 27.305 20.349999999999998 130-134 25.085 27.839999999999996 26.790000000000003 20.285 135-139 25.4 28.13 26.845000000000002 19.625 140-144 25.805 27.96 27.075 19.16 145-149 25.905 28.000000000000004 27.245 18.85 150-151 26.575 27.275 26.8625 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.5 26 2.5 27 4.5 28 3.5 29 5.0 30 8.5 31 12.0 32 21.5 33 28.0 34 34.0 35 55.5 36 68.0 37 93.5 38 129.0 39 166.0 40 212.5 41 239.5 42 252.5 43 278.0 44 300.0 45 285.5 46 266.0 47 248.0 48 224.5 49 206.0 50 189.0 51 154.5 52 120.0 53 102.0 54 81.0 55 53.5 56 41.0 57 33.0 58 18.5 59 14.0 60 9.5 61 6.5 62 9.5 63 9.0 64 4.5 65 1.5 66 0.5 67 2.5 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.1625 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTGT 10 0.006830828 145.0 3 >>END_MODULE Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651045 spots for SRR7171446.sra Written 651045 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra Read 651031 spots for SRR7171446.sra Written 651031 spots for SRR7171446.sra SRR ids: ['SRR7171446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4cbvvkmt SRR7171446.sra spots: 13020634 blocks: [[1, 651031], [651032, 1302062], [1302063, 1953093], [1953094, 2604124], [2604125, 3255155], [3255156, 3906186], [3906187, 4557217], [4557218, 5208248], [5208249, 5859279], [5859280, 6510310], [6510311, 7161341], [7161342, 7812372], [7812373, 8463403], [8463404, 9114434], [9114435, 9765465], [9765466, 10416496], [10416497, 11067527], [11067528, 11718558], [11718559, 12369589], [12369590, 13020634]] SRR7171446 file size 4390565 SRR7171446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171446 SRR7171446_1.fastq SRR7171446_2.fastq Input file: SRR7171446_1.fastq Paired file: SRR7171446_2.fastq trimmed: SRR7171446-trimmed-pair1.fastq, SRR7171446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:00:19 2025 >> started Thu Feb 13 18:00:41 2025 >> done (22.288s) 13020634 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 772 ( 0.01%) empty read pairs filtered out after trimming by size control 13019842 (99.99%) read pairs available; of these: 1821732 (13.99%) trimmed read pairs available after processing 11198110 (86.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 4 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 1 0.00% 37 2 0.00% 38 3 0.00% 39 3 0.00% 40 5 0.00% 41 5 0.00% 42 3 0.00% 43 5 0.00% 44 3 0.00% 45 5 0.00% 46 9 0.00% 47 8 0.00% 48 13 0.00% 49 10 0.00% 50 14 0.00% 51 20 0.00% 52 26 0.00% 53 30 0.00% 54 33 0.00% 55 27 0.00% 56 34 0.00% 57 37 0.00% 58 52 0.00% 59 53 0.00% 60 66 0.00% 61 98 0.00% 62 83 0.00% 63 90 0.00% 64 120 0.00% 65 161 0.00% 66 169 0.00% 67 189 0.00% 68 239 0.00% 69 280 0.00% 70 310 0.00% 71 378 0.00% 72 478 0.00% 73 552 0.00% 74 623 0.00% 75 729 0.01% 76 865 0.01% 77 897 0.01% 78 1079 0.01% 79 1179 0.01% 80 1393 0.01% 81 1616 0.01% 82 1887 0.01% 83 2170 0.02% 84 2431 0.02% 85 2694 0.02% 86 3042 0.02% 87 3355 0.03% 88 3723 0.03% 89 4140 0.03% 90 4591 0.04% 91 5026 0.04% 92 5677 0.04% 93 6356 0.05% 94 6999 0.05% 95 7689 0.06% 96 8171 0.06% 97 8706 0.07% 98 9390 0.07% 99 10130 0.08% 100 10785 0.08% 101 11424 0.09% 102 12699 0.10% 103 13301 0.10% 104 14744 0.11% 105 15390 0.12% 106 16361 0.13% 107 16966 0.13% 108 17753 0.14% 109 18677 0.14% 110 19107 0.15% 111 20110 0.15% 112 21070 0.16% 113 22184 0.17% 114 23791 0.18% 115 24751 0.19% 116 25849 0.20% 117 26826 0.21% 118 26836 0.21% 119 27527 0.21% 120 28166 0.22% 121 29586 0.23% 122 30565 0.23% 123 32109 0.25% 124 33402 0.26% 125 33933 0.26% 126 35144 0.27% 127 36258 0.28% 128 36664 0.28% 129 37507 0.29% 130 38342 0.29% 131 39093 0.30% 132 39748 0.31% 133 41224 0.32% 134 42531 0.33% 135 43453 0.33% 136 45037 0.35% 137 45341 0.35% 138 45762 0.35% 139 46390 0.36% 140 47029 0.36% 141 47572 0.37% 142 48537 0.37% 143 49458 0.38% 144 51034 0.39% 145 52530 0.40% 146 52889 0.41% 147 54220 0.42% 148 54454 0.42% 149 54383 0.42% 150 55029 0.42% 151 11198110 86.01% 13019842 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.52 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=380.62 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=33.6 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=265.36 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=23.6 sequence=AGAAGAAGAGAGG SRR7171446 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:01:36 Started mapping on | Feb 13 18:01:37 Finished on | Feb 13 18:03:29 Mapping speed, Million of reads per hour | 418.49 Number of input reads | 13019842 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12197927 Uniquely mapped reads % | 93.69% Average mapped length | 294.63 Number of splices: Total | 12509837 Number of splices: Annotated (sjdb) | 12320271 Number of splices: GT/AG | 12316007 Number of splices: GC/AG | 154061 Number of splices: AT/AC | 8959 Number of splices: Non-canonical | 30810 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331406 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 148904 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490509 490509 490509 N_multimapping 331406 331406 331406 N_noFeature 223490 12102332 263010 N_ambiguous 113277 898 56492 UnstrandedReadsAssigned:11861160 PositiveStrandReadsAssigned:94697 NegativeStrandReadsAssigned:11878425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171446-trimmed-pair1.fastq SRR7171446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,019,842 reads, 11,920,634 reads pseudoaligned [quant] estimated average fragment length: 222.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7171446.ke.tsv 34699 SRR7171446.se.tsv 87100 total ==> SRR7171446.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.41 568 26.2597 Potri.005G024800.1.v4.1 1035 813.409 131 13.3755 Potri.004G059700.1.v4.1 961 739.425 12 1.34783 Potri.007G009000.2.v4.1 1416 1194.41 0 0 Potri.003G141000.2.v4.1 2943 2721.41 299 9.12481 Potri.016G087400.1.v4.1 270 86.6887 934.589 895.375 Potri.015G069301.1.v4.1 564 345.098 0 0 Potri.010G195200.1.v4.1 1773 1551.41 55 2.94431 Potri.012G127500.1.v4.1 977 755.42 1354 148.86 ==> SRR7171446.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 99 SRR7171446 completed mapping pipeline successfully