Starting /dee2/code/volunteer_pipeline.sh SRR7171447 current disk space = 3087967113216 free memory = 1541150760 SRR7171447 SRAfilesize 85cd34ca75712d0ff4399690d013f379 SRR7171447.sra SRR7171447.sra file validated SRR7171447 is paired end SRR7171447 is conventional basespace SRR7171447 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.31775 32.0 30.0 33.0 18.0 34.0 2 31.6425 33.0 31.0 33.0 28.0 34.0 3 31.5125 33.0 32.0 33.0 27.0 34.0 4 31.859 33.0 31.0 33.0 29.0 34.0 5 32.65225 33.0 33.0 34.0 32.0 34.0 6 36.75075 38.0 37.0 38.0 34.0 38.0 7 37.2695 38.0 38.0 38.0 36.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.474 38.0 38.0 38.0 37.0 38.0 10-14 37.5424 38.0 38.0 38.0 38.0 38.0 15-19 37.49745 38.0 38.0 38.0 37.8 38.0 20-24 37.496300000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.387449999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.4075 38.0 38.0 38.0 37.2 38.0 35-39 37.34935 38.0 38.0 38.0 37.0 38.0 40-44 37.30995 38.0 38.0 38.0 37.0 38.0 45-49 37.3035 38.0 38.0 38.0 37.0 38.0 50-54 37.23405 38.0 38.0 38.0 36.8 38.0 55-59 37.212 38.0 38.0 38.0 36.4 38.0 60-64 37.065 38.0 38.0 38.0 36.0 38.0 65-69 36.9942 38.0 38.0 38.0 36.0 38.0 70-74 37.01115 38.0 38.0 38.0 35.8 38.0 75-79 36.978750000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.763999999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.604549999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.62235 38.0 38.0 38.0 34.0 38.0 95-99 36.63255 38.0 38.0 38.0 34.4 38.0 100-104 36.4776 38.0 37.8 38.0 34.0 38.0 105-109 36.252300000000005 38.0 37.8 38.0 33.6 38.0 110-114 36.11435 38.0 37.0 38.0 33.2 38.0 115-119 35.866150000000005 38.0 36.6 38.0 31.6 38.0 120-124 35.647499999999994 38.0 36.2 38.0 31.0 38.0 125-129 35.60755 38.0 36.0 38.0 31.0 38.0 130-134 35.632999999999996 38.0 36.0 38.0 30.4 38.0 135-139 35.20735 38.0 35.4 38.0 28.2 38.0 140-144 34.92205 38.0 35.0 38.0 27.6 38.0 145-149 34.48915 38.0 34.8 38.0 24.2 38.0 150-151 32.38175 36.0 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 1.0 23 3.0 24 11.0 25 8.0 26 11.0 27 19.0 28 26.0 29 25.0 30 36.0 31 67.0 32 77.0 33 123.0 34 180.0 35 331.0 36 711.0 37 2366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.88067744418784 12.933025404157044 8.10880164228894 34.07749550936618 2 21.23716503881793 14.55046331079389 34.08464813423491 30.12772351615327 3 19.400000000000002 23.45 26.75 30.4 4 23.625 29.175 23.05 24.15 5 22.6 32.85 24.375 20.175 6 19.525000000000002 35.475 26.075 18.925 7 13.775 25.1 43.075 18.05 8 18.2 24.15 30.775000000000002 26.875 9 17.775 24.95 32.05 25.224999999999998 10-14 20.705000000000002 29.060000000000002 27.205000000000002 23.03 15-19 20.45 29.235 27.3 23.015 20-24 19.91 28.725 27.71 23.655 25-29 20.125 28.79 27.605 23.48 30-34 20.085 28.89 28.02 23.005 35-39 20.495 28.02 27.905 23.580000000000002 40-44 20.485 28.825 27.215 23.474999999999998 45-49 20.035 28.315 27.689999999999998 23.96 50-54 20.23 28.34 27.860000000000003 23.57 55-59 20.69 28.470000000000002 27.165 23.674999999999997 60-64 20.369999999999997 28.515 27.750000000000004 23.365 65-69 20.153022953443017 28.34425163774566 27.509126368955343 23.99359903985598 70-74 20.101030309092728 28.498549564869464 27.9333800140042 23.46704011203361 75-79 20.580000000000002 28.015 27.689999999999998 23.715 80-84 20.28 28.835 27.425 23.46 85-89 20.775 28.595 27.61 23.02 90-94 20.990000000000002 28.775000000000002 27.055 23.18 95-99 20.775 28.29 27.715 23.22 100-104 21.12 28.54 27.425 22.915 105-109 20.82 28.515 27.62 23.044999999999998 110-114 20.891267380214064 28.533560068020407 27.223166950085027 23.352005601680503 115-119 20.73866479831849 28.37053348013212 27.039335401861674 23.85146631968772 120-124 20.87104355217761 28.511425571278565 27.066353317665882 23.551177558877946 125-129 20.54 28.575 27.105 23.78 130-134 20.685000000000002 28.98 26.905 23.43 135-139 20.775 28.53 27.334999999999997 23.36 140-144 20.4 28.07 27.27 24.26 145-149 21.075 28.395 26.834999999999997 23.695 150-151 20.75 28.050000000000004 26.775 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 1.5 24 2.5 25 2.5 26 4.5 27 7.0 28 7.5 29 10.0 30 13.0 31 22.5 32 34.5 33 40.0 34 55.0 35 65.5 36 80.5 37 107.5 38 137.0 39 166.5 40 195.5 41 216.5 42 228.0 43 271.5 44 290.0 45 261.5 46 246.5 47 248.5 48 233.0 49 208.5 50 184.0 51 141.5 52 113.0 53 98.0 54 77.0 55 56.0 56 42.5 57 37.0 58 24.0 59 10.0 60 7.0 61 10.0 62 11.5 63 7.5 64 3.0 65 2.5 66 3.0 67 3.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.03 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.09 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138-139 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171447 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72625 33.0 33.0 34.0 32.0 34.0 2 32.7665 34.0 33.0 34.0 32.0 34.0 3 32.79725 34.0 33.0 34.0 32.0 34.0 4 32.81375 34.0 33.0 34.0 32.0 34.0 5 32.88275 34.0 33.0 34.0 32.0 34.0 6 37.0245 38.0 38.0 38.0 36.0 38.0 7 36.892 38.0 38.0 38.0 36.0 38.0 8 36.977 38.0 38.0 38.0 36.0 38.0 9 36.9745 38.0 38.0 38.0 36.0 38.0 10-14 36.85585 38.0 38.0 38.0 36.0 38.0 15-19 36.822050000000004 38.0 38.0 38.0 35.6 38.0 20-24 36.8288 38.0 38.0 38.0 35.8 38.0 25-29 36.84065 38.0 38.0 38.0 35.8 38.0 30-34 36.81985000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.8467 38.0 38.0 38.0 35.8 38.0 40-44 36.8636 38.0 38.0 38.0 36.0 38.0 45-49 36.88125 38.0 38.0 38.0 35.8 38.0 50-54 36.7984 38.0 38.0 38.0 35.4 38.0 55-59 36.679500000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.5019 38.0 38.0 38.0 34.2 38.0 65-69 36.514500000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.4811 38.0 38.0 38.0 34.0 38.0 75-79 36.5459 38.0 38.0 38.0 34.2 38.0 80-84 36.5111 38.0 38.0 38.0 34.0 38.0 85-89 36.25965 38.0 38.0 38.0 33.6 38.0 90-94 36.088499999999996 38.0 37.8 38.0 33.0 38.0 95-99 36.0668 38.0 37.6 38.0 32.4 38.0 100-104 35.86245 38.0 37.0 38.0 31.6 38.0 105-109 35.73225 38.0 37.0 38.0 30.6 38.0 110-114 35.5118 38.0 36.6 38.0 29.0 38.0 115-119 35.44425 38.0 36.2 38.0 29.6 38.0 120-124 35.13135 38.0 36.0 38.0 27.8 38.0 125-129 35.14035 38.0 35.8 38.0 27.6 38.0 130-134 34.8241 38.0 35.2 38.0 25.6 38.0 135-139 34.2002 38.0 34.2 38.0 22.2 38.0 140-144 33.7944 38.0 33.8 38.0 21.4 38.0 145-149 33.7001 38.0 33.6 38.0 21.0 38.0 150-151 31.029375 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 11.0 17 13.0 18 16.0 19 8.0 20 6.0 21 7.0 22 8.0 23 10.0 24 14.0 25 22.0 26 33.0 27 20.0 28 36.0 29 46.0 30 56.0 31 65.0 32 98.0 33 130.0 34 189.0 35 288.0 36 646.0 37 2277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.22389181066867 22.063611319809667 12.421738041572752 23.29075882794891 2 26.35 25.575 30.0 18.075 3 20.474999999999998 28.775000000000002 31.75 19.0 4 23.63090772693173 32.50812703175794 23.58089522380595 20.280070017504375 5 23.55588897224306 36.40910227556889 22.20555138784696 17.829457364341085 6 21.349999999999998 36.65 24.075 17.925 7 20.525 20.825 38.224999999999994 20.424999999999997 8 21.349999999999998 25.974999999999998 27.400000000000002 25.275 9 22.775000000000002 24.75 28.725 23.75 10-14 23.124624924984996 28.855771154230847 26.255251050210042 21.764352870574115 15-19 22.7995599119824 27.660532106421282 28.230646129225846 21.309261852370472 20-24 23.165 27.88 27.74 21.215 25-29 23.26 28.42 27.560000000000002 20.76 30-34 23.31 28.299999999999997 27.55 20.84 35-39 22.99 27.74 28.235 21.035 40-44 23.235 27.965 27.88 20.919999999999998 45-49 22.66 27.689999999999998 28.335 21.315 50-54 23.32233223322332 27.88278827882788 28.052805280528055 20.742074207420742 55-59 23.583254138948632 27.76471765117791 28.059820937328066 20.59220727254539 60-64 23.50587646911728 27.481870467616904 28.312078019504877 20.70017504376094 65-69 23.13231323132313 28.212821282128214 28.24282428242824 20.412041204120413 70-74 23.785 27.175 27.605 21.435000000000002 75-79 23.115 28.425 28.105000000000004 20.355 80-84 23.86 27.415 27.74 20.985 85-89 23.66 27.700000000000003 28.235 20.405 90-94 23.77618880944047 28.091404570228512 28.07140357017851 20.061003050152507 95-99 24.047214164249276 28.02840852255677 27.768330499149744 20.156046814044213 100-104 24.07703851925963 28.049024512256125 27.99399699849925 19.879939969984992 105-109 23.706853426713355 27.48874437218609 28.344172086043024 20.460230115057527 110-114 23.971985992996498 27.593796898449224 28.134067033516757 20.300150075037518 115-119 24.43221610805403 27.83391695847924 27.48874437218609 20.245122561280642 120-124 23.907172151645494 28.26347904371311 27.573271981594477 20.256076823046914 125-129 24.610000000000003 27.845 27.229999999999997 20.315 130-134 24.69 27.589999999999996 28.199999999999996 19.52 135-139 24.68617154288572 27.93198299574894 27.60190047511878 19.779944986246562 140-144 24.532266133066532 27.958979489744873 27.04352176088044 20.465232616308153 145-149 25.13256628314157 27.43871935967984 27.39869934967484 20.030015007503753 150-151 25.050025012506254 27.813906953476735 27.063531765882942 20.072536268134066 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.5 26 2.0 27 2.5 28 2.5 29 5.5 30 8.5 31 12.5 32 19.5 33 27.0 34 41.0 35 59.5 36 86.0 37 109.0 38 138.5 39 175.5 40 206.0 41 237.0 42 260.5 43 277.5 44 285.5 45 293.0 46 287.0 47 260.5 48 218.5 49 194.5 50 169.5 51 142.5 52 123.5 53 89.0 54 65.5 55 48.0 56 34.5 57 29.5 58 21.0 59 10.5 60 9.0 61 9.5 62 5.5 63 4.5 64 5.0 65 3.5 66 2.5 67 1.5 68 1.5 69 0.5 70 2.0 71 2.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.034999999999999996 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.03 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.03 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.05 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.200652119388011 0.4 3 0.025081514923501375 0.075 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.7625 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTTG 10 0.006830828 145.0 8 >>END_MODULE Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911881 spots for SRR7171447.sra Written 911881 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra Read 911876 spots for SRR7171447.sra Written 911876 spots for SRR7171447.sra SRR ids: ['SRR7171447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hojoaj2h SRR7171447.sra spots: 18237525 blocks: [[1, 911876], [911877, 1823752], [1823753, 2735628], [2735629, 3647504], [3647505, 4559380], [4559381, 5471256], [5471257, 6383132], [6383133, 7295008], [7295009, 8206884], [8206885, 9118760], [9118761, 10030636], [10030637, 10942512], [10942513, 11854388], [11854389, 12766264], [12766265, 13678140], [13678141, 14590016], [14590017, 15501892], [15501893, 16413768], [16413769, 17325644], [17325645, 18237525]] SRR7171447 file size 6158398 SRR7171447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171447 SRR7171447_1.fastq SRR7171447_2.fastq Input file: SRR7171447_1.fastq Paired file: SRR7171447_2.fastq trimmed: SRR7171447-trimmed-pair1.fastq, SRR7171447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:32:28 2025 >> started Thu Feb 13 18:32:47 2025 >> done (19.131s) 18237525 read pairs processed; of these: 204 ( 0.00%) short read pairs filtered out after trimming by size control 1113 ( 0.01%) empty read pairs filtered out after trimming by size control 18236208 (99.99%) read pairs available; of these: 2125559 (11.66%) trimmed read pairs available after processing 16110649 (88.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 3 0.00% 30 3 0.00% 31 1 0.00% 32 3 0.00% 33 2 0.00% 34 0 0.00% 35 5 0.00% 36 6 0.00% 37 6 0.00% 38 5 0.00% 39 6 0.00% 40 10 0.00% 41 7 0.00% 42 8 0.00% 43 15 0.00% 44 6 0.00% 45 7 0.00% 46 10 0.00% 47 16 0.00% 48 13 0.00% 49 27 0.00% 50 24 0.00% 51 36 0.00% 52 41 0.00% 53 41 0.00% 54 45 0.00% 55 55 0.00% 56 50 0.00% 57 72 0.00% 58 91 0.00% 59 97 0.00% 60 110 0.00% 61 128 0.00% 62 158 0.00% 63 177 0.00% 64 212 0.00% 65 235 0.00% 66 281 0.00% 67 320 0.00% 68 345 0.00% 69 411 0.00% 70 524 0.00% 71 558 0.00% 72 714 0.00% 73 811 0.00% 74 929 0.01% 75 1030 0.01% 76 1173 0.01% 77 1348 0.01% 78 1532 0.01% 79 1726 0.01% 80 2044 0.01% 81 2270 0.01% 82 2617 0.01% 83 2935 0.02% 84 3320 0.02% 85 3696 0.02% 86 3895 0.02% 87 4257 0.02% 88 4562 0.03% 89 5045 0.03% 90 5697 0.03% 91 6317 0.03% 92 7011 0.04% 93 7610 0.04% 94 8557 0.05% 95 9043 0.05% 96 9514 0.05% 97 10036 0.06% 98 10739 0.06% 99 11384 0.06% 100 12260 0.07% 101 13050 0.07% 102 14459 0.08% 103 15167 0.08% 104 15990 0.09% 105 16840 0.09% 106 17794 0.10% 107 18098 0.10% 108 19156 0.11% 109 19872 0.11% 110 20655 0.11% 111 21974 0.12% 112 23304 0.13% 113 24872 0.14% 114 26404 0.14% 115 27601 0.15% 116 28547 0.16% 117 30121 0.17% 118 33602 0.18% 119 31351 0.17% 120 31119 0.17% 121 32210 0.18% 122 33456 0.18% 123 35374 0.19% 124 37312 0.20% 125 38257 0.21% 126 39469 0.22% 127 40011 0.22% 128 40563 0.22% 129 41490 0.23% 130 42552 0.23% 131 43714 0.24% 132 45866 0.25% 133 47127 0.26% 134 49323 0.27% 135 50816 0.28% 136 51988 0.29% 137 52243 0.29% 138 53029 0.29% 139 53953 0.30% 140 54373 0.30% 141 56500 0.31% 142 63055 0.35% 143 61404 0.34% 144 63469 0.35% 145 65779 0.36% 146 63873 0.35% 147 68275 0.37% 148 65619 0.36% 149 66209 0.36% 150 72007 0.39% 151 16110649 88.34% 18236208 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=19 prefix-density=0.41 prefix-fanout=2.8 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=69.19 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.5 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=30 prefix-density=0.49 prefix-fanout=2.3 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=205.46 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=10.6 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7171447 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:33:30 Started mapping on | Feb 13 18:33:31 Finished on | Feb 13 18:35:43 Mapping speed, Million of reads per hour | 497.35 Number of input reads | 18236208 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16682422 Uniquely mapped reads % | 91.48% Average mapped length | 295.36 Number of splices: Total | 16235213 Number of splices: Annotated (sjdb) | 15947212 Number of splices: GT/AG | 15975143 Number of splices: GC/AG | 203648 Number of splices: AT/AC | 11526 Number of splices: Non-canonical | 44896 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432252 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 167927 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1121534 1121534 1121534 N_multimapping 432252 432252 432252 N_noFeature 435829 16533987 501487 N_ambiguous 161740 1518 77819 UnstrandedReadsAssigned:16084853 PositiveStrandReadsAssigned:146917 NegativeStrandReadsAssigned:16103116 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171447-trimmed-pair1.fastq SRR7171447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,236,208 reads, 16,267,827 reads pseudoaligned [quant] estimated average fragment length: 229.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7171447.ke.tsv 34699 SRR7171447.se.tsv 87100 total ==> SRR7171447.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.24 1248 40.2049 Potri.005G024800.1.v4.1 1035 806.239 257 18.3739 Potri.004G059700.1.v4.1 961 732.239 14 1.10207 Potri.007G009000.2.v4.1 1416 1187.24 0 0 Potri.003G141000.2.v4.1 2943 2714.24 871.402 18.5056 Potri.016G087400.1.v4.1 270 82.7575 992 690.935 Potri.015G069301.1.v4.1 564 338.274 0 0 Potri.010G195200.1.v4.1 1773 1544.24 312 11.6459 Potri.012G127500.1.v4.1 977 748.239 3906 300.902 ==> SRR7171447.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 437 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 144 SRR7171447 completed mapping pipeline successfully