Starting /dee2/code/volunteer_pipeline.sh SRR7171448 current disk space = 3088079806464 free memory = 1464743824 SRR7171448 SRAfilesize 952a9e3f17b8c476629a511d21278560 SRR7171448.sra SRR7171448.sra file validated SRR7171448 is paired end SRR7171448 is conventional basespace SRR7171448 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91825 33.0 33.0 34.0 32.0 34.0 2 33.13475 34.0 33.0 34.0 31.0 34.0 3 32.962 33.0 33.0 34.0 32.0 34.0 4 33.1095 34.0 33.0 34.0 32.0 34.0 5 33.088 34.0 33.0 34.0 32.0 34.0 6 36.8595 38.0 37.0 38.0 35.0 38.0 7 37.19525 38.0 38.0 38.0 36.0 38.0 8 37.42025 38.0 38.0 38.0 37.0 38.0 9 37.48475 38.0 38.0 38.0 37.0 38.0 10-14 37.4914 38.0 38.0 38.0 37.8 38.0 15-19 37.44160000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.487 38.0 38.0 38.0 38.0 38.0 25-29 37.5449 38.0 38.0 38.0 38.0 38.0 30-34 37.544349999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.483000000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.410900000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.334649999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.17275 38.0 38.0 38.0 36.8 38.0 55-59 37.198949999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.27 38.0 38.0 38.0 37.0 38.0 65-69 37.28685 38.0 38.0 38.0 36.6 38.0 70-74 37.2279 38.0 38.0 38.0 36.6 38.0 75-79 37.17245 38.0 38.0 38.0 36.2 38.0 80-84 37.1509 38.0 38.0 38.0 36.2 38.0 85-89 36.97245 38.0 38.0 38.0 35.8 38.0 90-94 36.9132 38.0 38.0 38.0 36.0 38.0 95-99 36.89215 38.0 38.0 38.0 35.6 38.0 100-104 36.77685 38.0 38.0 38.0 35.0 38.0 105-109 36.64205 38.0 38.0 38.0 34.2 38.0 110-114 36.5543 38.0 38.0 38.0 34.0 38.0 115-119 36.40715 38.0 38.0 38.0 34.0 38.0 120-124 36.27649999999999 38.0 37.8 38.0 33.6 38.0 125-129 36.244550000000004 38.0 37.8 38.0 33.4 38.0 130-134 36.11370000000001 38.0 37.0 38.0 33.0 38.0 135-139 35.891200000000005 38.0 36.2 38.0 32.0 38.0 140-144 35.4685 38.0 35.8 38.0 30.4 38.0 145-149 35.2516 38.0 35.6 38.0 29.8 38.0 150-151 32.8065 35.5 30.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 3.0 24 6.0 25 11.0 26 11.0 27 11.0 28 27.0 29 30.0 30 35.0 31 35.0 32 63.0 33 83.0 34 126.0 35 221.0 36 503.0 37 2831.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.770932863967815 11.541362836308776 9.580085491576565 36.107618808146846 2 24.575 13.975000000000001 33.675 27.775 3 21.275 19.2 26.625 32.9 4 24.125 27.55 22.400000000000002 25.924999999999997 5 23.05 31.324999999999996 23.925 21.7 6 20.474999999999998 34.725 25.0 19.8 7 15.0 26.424999999999997 40.45 18.125 8 18.625 25.924999999999997 30.175 25.275 9 18.45 24.85 32.65 24.05 10-14 20.32 28.525 27.72 23.435 15-19 20.47 27.265 28.415000000000003 23.849999999999998 20-24 20.135 28.01 28.115000000000002 23.74 25-29 20.385 28.044999999999998 27.889999999999997 23.68 30-34 20.705000000000002 27.825 27.165 24.305 35-39 20.32508127031758 27.371842960740185 28.69717429357339 23.605901475368842 40-44 20.341017050852543 28.0314015700785 28.176408820441022 23.45117255862793 45-49 20.94 27.755000000000003 27.16 24.145 50-54 20.275000000000002 27.384999999999998 28.410000000000004 23.93 55-59 20.674999999999997 27.77 27.79 23.765 60-64 20.044999999999998 27.67 28.29 23.995 65-69 20.54 27.87 27.66 23.93 70-74 21.11 27.12 27.83 23.94 75-79 20.57 27.36 28.04 24.03 80-84 20.625 28.050000000000004 27.505000000000003 23.82 85-89 20.935000000000002 28.21 27.51 23.345 90-94 21.025 27.97 27.465 23.54 95-99 21.21 27.805000000000003 27.04 23.945 100-104 21.245 27.255000000000003 27.98 23.52 105-109 21.38 28.07 27.384999999999998 23.165 110-114 21.15 27.97 27.265 23.615 115-119 21.490000000000002 27.67 27.435 23.405 120-124 21.665 27.765 27.255000000000003 23.315 125-129 21.575 28.065 26.974999999999998 23.385 130-134 21.165 28.095 27.13 23.61 135-139 21.435000000000002 27.834999999999997 26.66 24.07 140-144 20.995 28.015 26.51 24.48 145-149 21.69 27.944999999999997 27.025 23.34 150-151 21.175 27.3 26.887499999999996 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 1.0 26 2.0 27 3.5 28 5.0 29 8.5 30 11.5 31 13.0 32 21.5 33 28.5 34 34.5 35 57.5 36 75.5 37 85.5 38 113.5 39 156.5 40 182.0 41 200.5 42 231.5 43 255.5 44 278.5 45 296.0 46 281.5 47 279.5 48 265.5 49 212.0 50 182.5 51 152.0 52 127.0 53 109.0 54 80.5 55 58.5 56 48.0 57 39.5 58 22.0 59 16.0 60 14.0 61 9.0 62 10.0 63 7.5 64 2.0 65 3.0 66 4.5 67 3.5 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.5875000000000004 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.825 0.0 0.0 0.0 0.0 122-123 5.3375 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.375 0.0 0.0 0.0 0.0 128-129 6.987500000000001 0.0 0.0 0.0 0.0 130-131 7.675000000000001 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.7375 0.0 0.0 0.0 0.0 136-137 9.337499999999999 0.0 0.0 0.0 0.0 138-139 10.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATGT 10 0.006830828 145.0 3 CATGTTC 10 0.006830828 145.0 5 >>END_MODULE SRR7171448 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9185 33.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 32.99575 34.0 33.0 34.0 32.0 34.0 4 32.92125 34.0 33.0 34.0 32.0 34.0 5 32.9185 34.0 33.0 34.0 32.0 34.0 6 36.9835 38.0 38.0 38.0 37.0 38.0 7 37.0595 38.0 38.0 38.0 37.0 38.0 8 36.97375 38.0 38.0 38.0 37.0 38.0 9 36.968 38.0 38.0 38.0 37.0 38.0 10-14 36.94055000000001 38.0 38.0 38.0 36.6 38.0 15-19 36.9482 38.0 38.0 38.0 36.6 38.0 20-24 36.976549999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.03675 38.0 38.0 38.0 37.0 38.0 30-34 36.97085 38.0 38.0 38.0 36.8 38.0 35-39 36.996449999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.9202 38.0 38.0 38.0 36.2 38.0 45-49 36.839600000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.78359999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.79835 38.0 38.0 38.0 36.0 38.0 60-64 36.79565 38.0 38.0 38.0 36.0 38.0 65-69 36.74615 38.0 38.0 38.0 36.0 38.0 70-74 36.732 38.0 38.0 38.0 35.6 38.0 75-79 36.79285 38.0 38.0 38.0 36.0 38.0 80-84 36.728449999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.55215 38.0 38.0 38.0 34.6 38.0 90-94 36.45785 38.0 38.0 38.0 34.4 38.0 95-99 36.43455 38.0 38.0 38.0 34.2 38.0 100-104 36.33515 38.0 38.0 38.0 34.0 38.0 105-109 36.2764 38.0 38.0 38.0 34.0 38.0 110-114 36.1387 38.0 38.0 38.0 33.0 38.0 115-119 35.9911 38.0 38.0 38.0 33.2 38.0 120-124 35.84845 38.0 37.4 38.0 31.8 38.0 125-129 35.652249999999995 38.0 37.0 38.0 31.0 38.0 130-134 35.57215 38.0 36.2 38.0 31.0 38.0 135-139 35.12935 38.0 36.0 38.0 27.4 38.0 140-144 34.7746 38.0 34.6 38.0 24.8 38.0 145-149 34.3486 38.0 33.2 38.0 23.0 38.0 150-151 31.947375 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 6.0 17 14.0 18 16.0 19 9.0 20 6.0 21 6.0 22 12.0 23 6.0 24 12.0 25 19.0 26 27.0 27 23.0 28 30.0 29 31.0 30 39.0 31 61.0 32 55.0 33 83.0 34 117.0 35 211.0 36 469.0 37 2740.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 21.175 14.524999999999999 26.35 2 24.624624624624623 26.5015015015015 31.156156156156158 17.71771771771772 3 20.445445445445447 28.52852852852853 31.206206206206204 19.81981981981982 4 24.54340755566675 33.29997498123593 22.76707530647986 19.389542156617463 5 23.617713284963724 35.57668251188391 23.092319239429575 17.713284963722792 6 22.002503128911137 35.96996245306634 24.030037546933666 17.99749687108886 7 19.924906132665832 22.102628285356694 37.84730913642053 20.125156445556946 8 23.57947434292866 24.85607008760951 26.83354192740926 24.730913642052567 9 22.02753441802253 25.15644555694618 29.737171464330416 23.078848560700877 10-14 23.94732889400691 28.253141741350824 25.789816251940117 22.009713112702148 15-19 23.237532545563788 28.585019026637294 26.707390346485077 21.47005808131384 20-24 23.2090112640801 28.846057571964955 26.773466833541924 21.171464330413016 25-29 23.26826826826827 28.40840840840841 27.482482482482485 20.84084084084084 30-34 23.267797288508678 28.870878983440896 26.66966831757467 21.19165541047576 35-39 23.42288258542198 28.695782680474263 26.729701335734653 21.151633398369103 40-44 23.114269983482657 27.644026227538916 27.954352069673156 21.28735171930527 45-49 24.243941518125375 28.049268976567195 27.002803925495694 20.703985579811736 50-54 23.27991987981973 28.23234852278418 27.366049073610416 21.12168252378568 55-59 23.695543314972458 28.16725087631447 26.985478217325987 21.151727591387083 60-64 22.608913370055085 28.04206309464196 27.871807711567353 21.477215823735605 65-69 23.225192750575747 27.876239110844097 27.50075097626915 21.397817162311004 70-74 23.56385108086469 28.29263410728583 27.106685348278624 21.036829463570857 75-79 23.479695939187835 27.985597119423883 26.915383076615324 21.619323864772955 80-84 23.435 27.544999999999998 27.88 21.14 85-89 24.061843290303212 27.56929850895627 26.943860702491744 21.424997498248775 90-94 23.87222750713463 27.867621288739798 27.447053522255043 20.813097681870527 95-99 23.924475384384234 27.615565683377575 27.510392147042623 20.94956678519557 100-104 23.961517262113542 28.09540512101017 27.063185849576588 20.879891767299693 105-109 24.07537335872507 27.503257492232137 27.46316528014433 20.95820386889847 110-114 24.472510399438683 28.862827644965673 26.261715030321252 20.402946925274396 115-119 24.47016383586352 28.819079112179967 26.644621474021747 20.066135577934766 120-124 24.531797696544817 27.606409614421633 27.185778668002 20.67601402103155 125-129 24.99624530663329 28.055068836045056 26.528160200250312 20.42052565707134 130-134 25.36416879411323 28.01721980277319 26.29523952545427 20.32337187765931 135-139 25.626001602564102 28.51061698717949 26.196915064102566 19.666466346153847 140-144 25.55121266786931 28.31729805572259 26.00220485067148 20.12928442573662 145-149 26.012632845398038 28.448967315019047 25.98756767595749 19.550832163625426 150-151 26.52293807971923 27.914264226623214 26.17197292554525 19.390824768112306 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 1.5 25 0.0 26 0.5 27 0.5 28 1.5 29 4.0 30 7.0 31 11.5 32 16.0 33 20.0 34 29.0 35 43.5 36 67.5 37 98.0 38 127.5 39 155.5 40 195.0 41 234.5 42 263.5 43 289.0 44 284.0 45 275.5 46 271.0 47 270.5 48 258.0 49 214.5 50 176.5 51 150.5 52 129.0 53 101.0 54 73.5 55 54.5 56 40.5 57 33.0 58 28.5 59 18.0 60 11.5 61 11.5 62 6.5 63 3.5 64 4.5 65 3.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.075 5 0.075 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.135 15-19 0.13999999999999999 20-24 0.125 25-29 0.1 30-34 0.055 35-39 0.055 40-44 0.105 45-49 0.13999999999999999 50-54 0.15 55-59 0.15 60-64 0.15 65-69 0.13 70-74 0.08 75-79 0.02 80-84 0.0 85-89 0.06999999999999999 90-94 0.135 95-99 0.165 100-104 0.215 105-109 0.22999999999999998 110-114 0.23500000000000001 115-119 0.20500000000000002 120-124 0.15 125-129 0.125 130-134 0.11499999999999999 135-139 0.16 140-144 0.22 145-149 0.26 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.5875000000000004 0.0 0.0 0.0 0.0 112-113 2.8499999999999996 0.0 0.0 0.0 0.0 114-115 3.2125000000000004 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.3375 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.3875 0.0 0.0 0.0 0.0 128-129 7.012499999999999 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.225 0.0 0.0 0.0 0.0 134-135 8.775 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138-139 10.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTATTC 10 0.0067796563 145.34177 1 AGGTTCA 10 0.0067796563 145.34177 8 >>END_MODULE Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697831 spots for SRR7171448.sra Written 697831 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra Read 697829 spots for SRR7171448.sra Written 697829 spots for SRR7171448.sra SRR ids: ['SRR7171448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_64u51gjs SRR7171448.sra spots: 13956582 blocks: [[1, 697829], [697830, 1395658], [1395659, 2093487], [2093488, 2791316], [2791317, 3489145], [3489146, 4186974], [4186975, 4884803], [4884804, 5582632], [5582633, 6280461], [6280462, 6978290], [6978291, 7676119], [7676120, 8373948], [8373949, 9071777], [9071778, 9769606], [9769607, 10467435], [10467436, 11165264], [11165265, 11863093], [11863094, 12560922], [12560923, 13258751], [13258752, 13956582]] SRR7171448 file size 4707727 SRR7171448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171448 SRR7171448_1.fastq SRR7171448_2.fastq Input file: SRR7171448_1.fastq Paired file: SRR7171448_2.fastq trimmed: SRR7171448-trimmed-pair1.fastq, SRR7171448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:26:40 2025 >> started Thu Feb 13 18:26:56 2025 >> done (15.788s) 13956582 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 1255 ( 0.01%) empty read pairs filtered out after trimming by size control 13955233 (99.99%) read pairs available; of these: 2463576 (17.65%) trimmed read pairs available after processing 11491657 (82.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 3 0.00% 32 2 0.00% 33 3 0.00% 34 6 0.00% 35 1 0.00% 36 1 0.00% 37 1 0.00% 38 3 0.00% 39 7 0.00% 40 7 0.00% 41 5 0.00% 42 11 0.00% 43 11 0.00% 44 10 0.00% 45 11 0.00% 46 15 0.00% 47 10 0.00% 48 21 0.00% 49 37 0.00% 50 25 0.00% 51 38 0.00% 52 43 0.00% 53 51 0.00% 54 68 0.00% 55 53 0.00% 56 75 0.00% 57 90 0.00% 58 98 0.00% 59 145 0.00% 60 153 0.00% 61 176 0.00% 62 174 0.00% 63 254 0.00% 64 254 0.00% 65 303 0.00% 66 322 0.00% 67 392 0.00% 68 533 0.00% 69 531 0.00% 70 644 0.00% 71 746 0.01% 72 901 0.01% 73 1053 0.01% 74 1244 0.01% 75 1399 0.01% 76 1585 0.01% 77 1658 0.01% 78 1920 0.01% 79 2251 0.02% 80 2567 0.02% 81 2948 0.02% 82 3410 0.02% 83 3906 0.03% 84 4339 0.03% 85 4785 0.03% 86 5273 0.04% 87 5696 0.04% 88 6338 0.05% 89 6838 0.05% 90 7590 0.05% 91 8412 0.06% 92 9283 0.07% 93 10491 0.08% 94 11649 0.08% 95 12348 0.09% 96 12960 0.09% 97 13948 0.10% 98 14169 0.10% 99 15469 0.11% 100 16701 0.12% 101 17802 0.13% 102 19019 0.14% 103 20889 0.15% 104 21735 0.16% 105 23564 0.17% 106 24352 0.17% 107 24910 0.18% 108 25982 0.19% 109 26521 0.19% 110 27369 0.20% 111 28900 0.21% 112 30334 0.22% 113 31610 0.23% 114 33843 0.24% 115 34949 0.25% 116 36271 0.26% 117 38484 0.28% 118 39156 0.28% 119 39823 0.29% 120 39674 0.28% 121 40348 0.29% 122 41261 0.30% 123 43078 0.31% 124 45030 0.32% 125 45947 0.33% 126 47739 0.34% 127 48102 0.34% 128 48806 0.35% 129 49142 0.35% 130 49966 0.36% 131 50287 0.36% 132 51847 0.37% 133 53686 0.38% 134 55692 0.40% 135 56865 0.41% 136 57016 0.41% 137 58291 0.42% 138 58396 0.42% 139 59347 0.43% 140 59966 0.43% 141 61158 0.44% 142 62120 0.45% 143 65331 0.47% 144 66829 0.48% 145 67695 0.49% 146 66276 0.47% 147 67672 0.48% 148 68049 0.49% 149 66820 0.48% 150 69143 0.50% 151 11491657 82.35% 13955233 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=8.21 fanout-score-rank=9 prefix-density=0.42 prefix-fanout=3.8 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=20.49 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=5.0 sequence=ATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGCATGTATATCAACTCCTTGGATATGCTTGGAAGCATGTTTGGGAACATGGAAGGACTGGCTCCTCCACACTTTGTAGAACTTCTCTGCGGAGGACTTGAGTTCTAATGTTGTCTCAATCTTTCCATGTAGTGCCATTGTTTTCTATATCAACACAAATCTATGCACT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=35.88 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAG SRR7171448 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:27:44 Started mapping on | Feb 13 18:27:45 Finished on | Feb 13 18:29:18 Mapping speed, Million of reads per hour | 540.20 Number of input reads | 13955233 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12984461 Uniquely mapped reads % | 93.04% Average mapped length | 292.31 Number of splices: Total | 12459600 Number of splices: Annotated (sjdb) | 12228097 Number of splices: GT/AG | 12259675 Number of splices: GC/AG | 157929 Number of splices: AT/AC | 8957 Number of splices: Non-canonical | 33039 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356876 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 63141 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 613896 613896 613896 N_multimapping 356876 356876 356876 N_noFeature 271154 12879122 317658 N_ambiguous 120497 626 61257 UnstrandedReadsAssigned:12592810 PositiveStrandReadsAssigned:104713 NegativeStrandReadsAssigned:12605546 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171448-trimmed-pair1.fastq SRR7171448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,955,233 reads, 12,666,788 reads pseudoaligned [quant] estimated average fragment length: 213.623 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR7171448.ke.tsv 34699 SRR7171448.se.tsv 87100 total ==> SRR7171448.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.38 926 42.8259 Potri.005G024800.1.v4.1 1035 822.377 134 13.605 Potri.004G059700.1.v4.1 961 748.377 18 2.00824 Potri.007G009000.2.v4.1 1416 1203.38 0 0 Potri.003G141000.2.v4.1 2943 2730.38 233 7.1252 Potri.016G087400.1.v4.1 270 91.6848 634 577.372 Potri.015G069301.1.v4.1 564 353.264 0 0 Potri.010G195200.1.v4.1 1773 1560.38 243.832 13.0474 Potri.012G127500.1.v4.1 977 764.377 6769 739.402 ==> SRR7171448.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 236 SRR7171448 completed mapping pipeline successfully