Starting /dee2/code/volunteer_pipeline.sh SRR7171449 current disk space = 3088049795072 free memory = 1425666016 SRR7171449 SRAfilesize d5f4ce3e73c298011b8ead7b82280aa9 SRR7171449.sra SRR7171449.sra file validated SRR7171449 is paired end SRR7171449 is conventional basespace SRR7171449 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24425 33.0 33.0 34.0 31.0 34.0 2 30.993 33.0 31.0 33.0 27.0 33.0 3 32.47575 33.0 33.0 33.0 31.0 34.0 4 33.051 33.0 33.0 34.0 32.0 34.0 5 32.83325 33.0 33.0 34.0 32.0 34.0 6 36.89275 38.0 37.0 38.0 35.0 38.0 7 37.2955 38.0 38.0 38.0 36.0 38.0 8 37.51825 38.0 38.0 38.0 37.0 38.0 9 37.597 38.0 38.0 38.0 38.0 38.0 10-14 37.666999999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.68175 38.0 38.0 38.0 38.0 38.0 20-24 37.674549999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.633500000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.61125 38.0 38.0 38.0 38.0 38.0 35-39 37.61545 38.0 38.0 38.0 38.0 38.0 40-44 37.5915 38.0 38.0 38.0 38.0 38.0 45-49 37.5711 38.0 38.0 38.0 38.0 38.0 50-54 37.513 38.0 38.0 38.0 38.0 38.0 55-59 37.4803 38.0 38.0 38.0 37.2 38.0 60-64 37.490050000000004 38.0 38.0 38.0 37.6 38.0 65-69 37.427350000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.36855 38.0 38.0 38.0 37.0 38.0 75-79 37.3519 38.0 38.0 38.0 37.0 38.0 80-84 37.273900000000005 38.0 38.0 38.0 36.8 38.0 85-89 37.25705000000001 38.0 38.0 38.0 36.6 38.0 90-94 37.172900000000006 38.0 38.0 38.0 36.0 38.0 95-99 37.1023 38.0 38.0 38.0 36.0 38.0 100-104 37.032500000000006 38.0 38.0 38.0 36.0 38.0 105-109 36.9816 38.0 38.0 38.0 35.6 38.0 110-114 36.809799999999996 38.0 38.0 38.0 35.0 38.0 115-119 36.88555000000001 38.0 38.0 38.0 35.0 38.0 120-124 36.64205 38.0 38.0 38.0 34.4 38.0 125-129 36.4057 38.0 37.8 38.0 34.0 38.0 130-134 36.3676 38.0 37.6 38.0 34.0 38.0 135-139 36.1465 38.0 36.8 38.0 33.2 38.0 140-144 35.962849999999996 38.0 36.0 38.0 33.0 38.0 145-149 35.7511 38.0 36.0 38.0 31.4 38.0 150-151 33.290625000000006 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 3.0 25 2.0 26 4.0 27 13.0 28 18.0 29 13.0 30 14.0 31 32.0 32 43.0 33 63.0 34 103.0 35 203.0 36 517.0 37 2966.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.44809461235217 12.509855453350854 9.487516425755585 38.5545335085414 2 21.075 16.3 32.65 29.975 3 20.575 20.175 24.45 34.8 4 22.425 28.225 23.1 26.25 5 23.674999999999997 31.825 23.849999999999998 20.65 6 20.825 33.925 24.85 20.4 7 15.2 26.950000000000003 40.925 16.925 8 18.475 24.975 31.775 24.775 9 17.95 23.225 34.075 24.75 10-14 20.13 29.26 27.224999999999998 23.385 15-19 19.765 28.095 28.139999999999997 24.0 20-24 20.200000000000003 28.555000000000003 27.92 23.325000000000003 25-29 20.025000000000002 28.735 27.500000000000004 23.74 30-34 20.34 28.575 27.6 23.485 35-39 20.345 28.235 27.455000000000002 23.965 40-44 20.155 28.845 27.29 23.71 45-49 20.044999999999998 28.799999999999997 27.41 23.745 50-54 19.515 28.345 28.115000000000002 24.025 55-59 20.52 28.23 27.43 23.82 60-64 19.79 28.24 28.095 23.875 65-69 20.055 28.57 27.485 23.89 70-74 20.11 28.189999999999998 27.87 23.830000000000002 75-79 20.080000000000002 28.744999999999997 27.63 23.544999999999998 80-84 20.24 28.62 27.32 23.82 85-89 20.25 28.115000000000002 27.705000000000002 23.93 90-94 20.505000000000003 28.18 27.474999999999998 23.84 95-99 20.474999999999998 28.51 27.68 23.335 100-104 20.262026202620262 28.102810281028102 27.567756775677566 24.067406740674066 105-109 21.13028257064266 28.16704176044011 27.336834208552137 23.365841460365093 110-114 20.363054458168726 28.02420363054458 28.039205880882136 23.57353603040456 115-119 21.02210221022102 28.06280628062806 27.08770877087709 23.827382738273826 120-124 20.424999999999997 28.915000000000003 26.995 23.665 125-129 20.685000000000002 27.834999999999997 27.560000000000002 23.919999999999998 130-134 20.62 27.96 27.6 23.82 135-139 21.025 27.265 27.73 23.98 140-144 21.265 27.339999999999996 27.084999999999997 24.310000000000002 145-149 21.035 27.97 26.974999999999998 24.02 150-151 20.825 28.325 26.9625 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 1.0 25 2.0 26 5.5 27 8.0 28 6.0 29 9.5 30 14.5 31 17.0 32 22.0 33 33.5 34 46.5 35 67.5 36 85.0 37 112.0 38 140.5 39 144.0 40 179.0 41 216.5 42 232.0 43 259.5 44 282.5 45 292.0 46 298.0 47 287.0 48 240.0 49 201.5 50 178.0 51 139.0 52 108.0 53 95.0 54 70.5 55 45.0 56 40.0 57 28.5 58 20.5 59 19.0 60 11.5 61 7.0 62 5.5 63 6.0 64 5.0 65 5.5 66 4.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.025 110-114 0.015 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.3875 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.199999999999999 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171449 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171449_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09025 33.0 33.0 34.0 33.0 34.0 2 33.231 34.0 33.0 34.0 33.0 34.0 3 33.2445 34.0 33.0 34.0 33.0 34.0 4 33.25 34.0 33.0 34.0 33.0 34.0 5 33.28175 34.0 33.0 34.0 33.0 34.0 6 37.45775 38.0 38.0 38.0 38.0 38.0 7 37.514 38.0 38.0 38.0 38.0 38.0 8 37.3955 38.0 38.0 38.0 38.0 38.0 9 37.37425 38.0 38.0 38.0 38.0 38.0 10-14 37.425650000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.43145 38.0 38.0 38.0 38.0 38.0 20-24 37.41225000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.41455 38.0 38.0 38.0 38.0 38.0 30-34 37.42295 38.0 38.0 38.0 38.0 38.0 35-39 37.37645 38.0 38.0 38.0 38.0 38.0 40-44 37.361450000000005 38.0 38.0 38.0 37.4 38.0 45-49 37.299549999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.296 38.0 38.0 38.0 37.0 38.0 55-59 37.258050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.18715 38.0 38.0 38.0 37.0 38.0 65-69 37.251850000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.191449999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.15285 38.0 38.0 38.0 36.6 38.0 80-84 37.0509 38.0 38.0 38.0 36.0 38.0 85-89 37.0212 38.0 38.0 38.0 36.0 38.0 90-94 36.887299999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.86435 38.0 38.0 38.0 35.4 38.0 100-104 36.698949999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.58555 38.0 38.0 38.0 34.2 38.0 110-114 36.529849999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.40325 38.0 38.0 38.0 34.0 38.0 120-124 36.236149999999995 38.0 37.8 38.0 33.4 38.0 125-129 36.056000000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.93085 38.0 36.6 38.0 32.4 38.0 135-139 35.6988 38.0 36.0 38.0 31.0 38.0 140-144 35.28445000000001 38.0 35.4 38.0 29.2 38.0 145-149 34.8445 38.0 34.2 38.0 27.6 38.0 150-151 31.974 35.5 28.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 2.0 18 6.0 19 5.0 20 5.0 21 2.0 22 7.0 23 8.0 24 9.0 25 10.0 26 12.0 27 15.0 28 14.0 29 24.0 30 26.0 31 37.0 32 47.0 33 82.0 34 109.0 35 215.0 36 488.0 37 2873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 19.625 15.35 26.924999999999997 2 27.375 25.724999999999998 29.15 17.75 3 20.775 30.375000000000004 29.549999999999997 19.3 4 23.525 33.4 22.875 20.200000000000003 5 23.225 36.075 22.3 18.4 6 21.8 37.125 23.35 17.724999999999998 7 19.575 22.0 37.75 20.674999999999997 8 21.425 25.775 27.500000000000004 25.3 9 22.375 26.174999999999997 29.299999999999997 22.15 10-14 23.56 29.23 25.94 21.27 15-19 23.075000000000003 28.494999999999997 27.04 21.39 20-24 23.43 28.43 27.43 20.71 25-29 23.150000000000002 28.849999999999998 27.0 21.0 30-34 23.03 28.205000000000002 27.544999999999998 21.22 35-39 22.905 28.76 27.139999999999997 21.195 40-44 23.54 28.615000000000002 27.134999999999998 20.71 45-49 23.46 28.34 27.42 20.78 50-54 23.585 28.29 27.66 20.465 55-59 23.400000000000002 28.28 27.29 21.029999999999998 60-64 23.544999999999998 27.445000000000004 28.025 20.985 65-69 23.015 28.005000000000003 27.644999999999996 21.335 70-74 23.71 27.544999999999998 28.07 20.674999999999997 75-79 23.355 27.67 28.33 20.645 80-84 23.555 28.244999999999997 27.725 20.474999999999998 85-89 23.395 27.584999999999997 28.17 20.849999999999998 90-94 24.075 27.925 27.375 20.625 95-99 23.76 27.88 27.779999999999998 20.580000000000002 100-104 24.34 27.48 27.465 20.715 105-109 24.21 28.23 27.445000000000004 20.115 110-114 23.89 27.555000000000003 27.525 21.029999999999998 115-119 24.335 27.905 27.47 20.29 120-124 24.335 27.51 27.74 20.415 125-129 24.745 28.49 27.01 19.755 130-134 24.57 28.005000000000003 27.125 20.3 135-139 24.87 28.105000000000004 27.005000000000003 20.02 140-144 25.09 28.005000000000003 27.185 19.72 145-149 25.95 27.715 27.089999999999996 19.245 150-151 25.85 27.750000000000004 27.55 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 2.0 28 4.0 29 6.0 30 13.0 31 14.0 32 17.0 33 27.5 34 37.5 35 54.0 36 81.0 37 104.5 38 137.0 39 164.5 40 182.5 41 228.0 42 260.0 43 265.0 44 290.5 45 320.5 46 304.5 47 261.5 48 223.0 49 199.0 50 183.0 51 144.0 52 118.0 53 99.5 54 65.5 55 45.0 56 38.0 57 30.0 58 16.5 59 11.5 60 10.0 61 9.5 62 9.0 63 6.0 64 3.0 65 1.5 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.125250501002004 0.25 3 0.0 0.0 4 0.0250501002004008 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.5374999999999996 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.7375 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTTG 10 0.006830828 145.0 3 CTCACCC 10 0.006830828 145.0 1 >>END_MODULE Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740478 spots for SRR7171449.sra Written 740478 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra Read 740472 spots for SRR7171449.sra Written 740472 spots for SRR7171449.sra SRR ids: ['SRR7171449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jprwvubz SRR7171449.sra spots: 14809446 blocks: [[1, 740472], [740473, 1480944], [1480945, 2221416], [2221417, 2961888], [2961889, 3702360], [3702361, 4442832], [4442833, 5183304], [5183305, 5923776], [5923777, 6664248], [6664249, 7404720], [7404721, 8145192], [8145193, 8885664], [8885665, 9626136], [9626137, 10366608], [10366609, 11107080], [11107081, 11847552], [11847553, 12588024], [12588025, 13328496], [13328497, 14068968], [14068969, 14809446]] SRR7171449 file size 4996734 SRR7171449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171449 SRR7171449_1.fastq SRR7171449_2.fastq Input file: SRR7171449_1.fastq Paired file: SRR7171449_2.fastq trimmed: SRR7171449-trimmed-pair1.fastq, SRR7171449-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:27:30 2025 >> started Thu Feb 13 18:27:55 2025 >> done (24.942s) 14809446 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 1271 ( 0.01%) empty read pairs filtered out after trimming by size control 14808151 (99.99%) read pairs available; of these: 1874829 (12.66%) trimmed read pairs available after processing 12933322 (87.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 0 0.00% 31 2 0.00% 32 4 0.00% 33 0 0.00% 34 3 0.00% 35 2 0.00% 36 1 0.00% 37 2 0.00% 38 1 0.00% 39 7 0.00% 40 6 0.00% 41 7 0.00% 42 2 0.00% 43 2 0.00% 44 7 0.00% 45 9 0.00% 46 2 0.00% 47 10 0.00% 48 8 0.00% 49 16 0.00% 50 14 0.00% 51 12 0.00% 52 21 0.00% 53 22 0.00% 54 32 0.00% 55 25 0.00% 56 36 0.00% 57 26 0.00% 58 64 0.00% 59 68 0.00% 60 67 0.00% 61 82 0.00% 62 108 0.00% 63 102 0.00% 64 146 0.00% 65 152 0.00% 66 173 0.00% 67 203 0.00% 68 231 0.00% 69 258 0.00% 70 322 0.00% 71 396 0.00% 72 442 0.00% 73 512 0.00% 74 608 0.00% 75 684 0.00% 76 808 0.01% 77 895 0.01% 78 996 0.01% 79 1185 0.01% 80 1319 0.01% 81 1666 0.01% 82 1811 0.01% 83 1993 0.01% 84 2307 0.02% 85 2594 0.02% 86 2754 0.02% 87 3105 0.02% 88 3400 0.02% 89 3867 0.03% 90 4272 0.03% 91 4830 0.03% 92 5407 0.04% 93 5937 0.04% 94 6736 0.05% 95 7232 0.05% 96 7686 0.05% 97 8381 0.06% 98 8790 0.06% 99 9582 0.06% 100 10235 0.07% 101 11076 0.07% 102 12186 0.08% 103 13016 0.09% 104 13892 0.09% 105 14681 0.10% 106 15955 0.11% 107 16240 0.11% 108 17280 0.12% 109 17638 0.12% 110 18606 0.13% 111 19600 0.13% 112 20875 0.14% 113 22097 0.15% 114 23462 0.16% 115 24875 0.17% 116 25879 0.17% 117 26272 0.18% 118 26602 0.18% 119 27441 0.19% 120 28495 0.19% 121 29660 0.20% 122 30518 0.21% 123 32384 0.22% 124 33927 0.23% 125 35159 0.24% 126 36435 0.25% 127 37378 0.25% 128 37615 0.25% 129 38112 0.26% 130 39250 0.27% 131 40491 0.27% 132 41072 0.28% 133 43131 0.29% 134 44402 0.30% 135 45928 0.31% 136 47106 0.32% 137 47610 0.32% 138 47954 0.32% 139 49129 0.33% 140 49690 0.34% 141 50309 0.34% 142 52176 0.35% 143 52731 0.36% 144 54983 0.37% 145 56075 0.38% 146 57129 0.39% 147 58307 0.39% 148 58467 0.39% 149 58969 0.40% 150 59858 0.40% 151 12933322 87.34% 14808151 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=1.9 sequence=GCAATGATTGTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=26.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.5 sequence=CATTACAAACGAGGAAGCAGCCGCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=32 prefix-density=0.47 prefix-fanout=2.3 sequence=AGGAGGTTTCCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=26.10 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.5 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171449 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:28:53 Started mapping on | Feb 13 18:28:54 Finished on | Feb 13 18:31:21 Mapping speed, Million of reads per hour | 362.65 Number of input reads | 14808151 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13586975 Uniquely mapped reads % | 91.75% Average mapped length | 295.28 Number of splices: Total | 12960249 Number of splices: Annotated (sjdb) | 12697248 Number of splices: GT/AG | 12743611 Number of splices: GC/AG | 166768 Number of splices: AT/AC | 10332 Number of splices: Non-canonical | 39538 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324952 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 68672 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.47% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896224 896224 896224 N_multimapping 324952 324952 324952 N_noFeature 388727 13468871 441836 N_ambiguous 136381 757 70925 UnstrandedReadsAssigned:13061867 PositiveStrandReadsAssigned:117347 NegativeStrandReadsAssigned:13074214 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171449 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171449-trimmed-pair1.fastq SRR7171449-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,808,151 reads, 13,059,727 reads pseudoaligned [quant] estimated average fragment length: 225.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR7171449.ke.tsv 34699 SRR7171449.se.tsv 87100 total ==> SRR7171449.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.81 1420 62.0548 Potri.005G024800.1.v4.1 1035 810.808 198 19.143 Potri.004G059700.1.v4.1 961 736.808 20 2.12784 Potri.007G009000.2.v4.1 1416 1191.81 0 0 Potri.003G141000.2.v4.1 2943 2718.81 438.198 12.6344 Potri.016G087400.1.v4.1 270 84.0868 485 452.144 Potri.015G069301.1.v4.1 564 342.273 0 0 Potri.010G195200.1.v4.1 1773 1548.81 522.627 26.4519 Potri.012G127500.1.v4.1 977 752.808 25213 2625.45 ==> SRR7171449.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 404 SRR7171449 completed mapping pipeline successfully