Starting /dee2/code/volunteer_pipeline.sh SRR7171451 current disk space = 3088239759360 free memory = 1463203008 SRR7171451 SRAfilesize 69be71493d73bb7a18726fd1392bf7fe SRR7171451.sra SRR7171451.sra file validated SRR7171451 is paired end SRR7171451 is conventional basespace SRR7171451 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.548 33.0 33.0 34.0 32.0 34.0 2 32.10475 33.0 32.0 34.0 28.0 34.0 3 32.1825 33.0 32.0 33.0 30.0 34.0 4 32.94175 33.0 33.0 34.0 32.0 34.0 5 32.7475 33.0 33.0 34.0 32.0 34.0 6 36.52 38.0 37.0 38.0 34.0 38.0 7 37.25275 38.0 38.0 38.0 36.0 38.0 8 37.5275 38.0 38.0 38.0 37.0 38.0 9 37.61525 38.0 38.0 38.0 38.0 38.0 10-14 37.6183 38.0 38.0 38.0 38.0 38.0 15-19 37.6262 38.0 38.0 38.0 38.0 38.0 20-24 37.644400000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.60455 38.0 38.0 38.0 38.0 38.0 30-34 37.5856 38.0 38.0 38.0 38.0 38.0 35-39 37.599599999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.59545000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.53415 38.0 38.0 38.0 38.0 38.0 50-54 37.46585 38.0 38.0 38.0 37.2 38.0 55-59 37.44185 38.0 38.0 38.0 37.0 38.0 60-64 37.440549999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.4 38.0 38.0 38.0 37.0 38.0 70-74 37.3163 38.0 38.0 38.0 36.8 38.0 75-79 37.331900000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.2521 38.0 38.0 38.0 36.2 38.0 85-89 37.199949999999994 38.0 38.0 38.0 36.2 38.0 90-94 37.12705 38.0 38.0 38.0 36.0 38.0 95-99 36.975100000000005 38.0 38.0 38.0 35.8 38.0 100-104 36.957049999999995 38.0 38.0 38.0 35.2 38.0 105-109 36.87365 38.0 38.0 38.0 35.2 38.0 110-114 36.71145 38.0 38.0 38.0 34.8 38.0 115-119 36.7236 38.0 38.0 38.0 34.4 38.0 120-124 36.57425 38.0 38.0 38.0 34.0 38.0 125-129 36.3106 38.0 37.6 38.0 33.6 38.0 130-134 36.210499999999996 38.0 37.0 38.0 33.2 38.0 135-139 35.987700000000004 38.0 36.2 38.0 33.0 38.0 140-144 35.78365 38.0 36.0 38.0 31.6 38.0 145-149 35.6156 38.0 36.0 38.0 31.0 38.0 150-151 33.002875 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 4.0 25 3.0 26 6.0 27 9.0 28 9.0 29 22.0 30 26.0 31 29.0 32 45.0 33 83.0 34 120.0 35 213.0 36 562.0 37 2865.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.26642240251243 13.97539911018058 8.767338393090814 34.990840094216175 2 21.6 16.775000000000002 31.474999999999998 30.15 3 19.1 22.275 27.775 30.85 4 23.275000000000002 27.700000000000003 23.0 26.025 5 23.425 32.375 23.525 20.674999999999997 6 20.974999999999998 34.075 24.65 20.3 7 15.325 26.125 40.25 18.3 8 18.625 25.575 29.875 25.924999999999997 9 16.85 24.8 33.375 24.975 10-14 20.419999999999998 29.654999999999998 26.56 23.365 15-19 20.200000000000003 28.075 27.85 23.875 20-24 20.23 28.645 27.765 23.36 25-29 20.19 28.68 27.529999999999998 23.599999999999998 30-34 20.345 28.025 27.584999999999997 24.044999999999998 35-39 19.994999999999997 28.185 27.715 24.104999999999997 40-44 20.150000000000002 28.000000000000004 27.35 24.5 45-49 20.535 27.765 27.744999999999997 23.955000000000002 50-54 20.285 28.225 27.6 23.89 55-59 19.869999999999997 28.615000000000002 27.155 24.36 60-64 20.145 28.199999999999996 27.744999999999997 23.91 65-69 20.445 28.185 27.77 23.599999999999998 70-74 20.68 28.475 27.07 23.775 75-79 20.495 28.249999999999996 27.224999999999998 24.03 80-84 20.76 28.625 27.255000000000003 23.36 85-89 21.02 27.96 27.275 23.745 90-94 20.43 28.71 27.0 23.86 95-99 20.89 28.175 27.345000000000002 23.59 100-104 21.03341336534614 28.186274509803923 27.080832332933173 23.699479791916765 105-109 20.76368731858673 27.679911920728657 27.900110099089183 23.656290661595435 110-114 20.793515785260418 28.523540301195776 27.202681743133038 23.480262170410768 115-119 20.52423590615777 28.60287129208144 26.922114951728275 23.950777850032516 120-124 20.345 28.005000000000003 27.83 23.82 125-129 21.015 27.73 26.71 24.545 130-134 21.22 28.28 26.755000000000003 23.745 135-139 21.560000000000002 28.139999999999997 26.224999999999998 24.075 140-144 21.46 27.765 26.889999999999997 23.885 145-149 21.48 27.955000000000002 26.240000000000002 24.325 150-151 21.875 26.787499999999998 26.224999999999998 25.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 2.5 25 3.0 26 4.5 27 5.0 28 8.0 29 11.0 30 15.0 31 23.5 32 26.5 33 32.5 34 48.5 35 65.0 36 80.0 37 102.5 38 127.0 39 151.0 40 177.5 41 213.0 42 244.0 43 258.0 44 283.5 45 274.5 46 238.5 47 241.5 48 231.5 49 211.5 50 197.5 51 160.0 52 125.5 53 96.0 54 78.0 55 67.5 56 46.5 57 31.0 58 24.0 59 19.0 60 14.5 61 10.0 62 9.0 63 9.0 64 7.0 65 5.5 66 4.0 67 3.5 68 3.0 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.09 110-114 0.065 115-119 0.045 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.15 0.0 0.0 0.025 0.0 88-89 0.2 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.4125 0.0 0.0 0.025 0.0 94-95 0.575 0.0 0.0 0.025 0.0 96-97 0.7749999999999999 0.0 0.0 0.025 0.0 98-99 0.8875 0.0 0.0 0.025 0.0 100-101 1.0750000000000002 0.0 0.0 0.025 0.0 102-103 1.2125 0.0 0.0 0.025 0.0 104-105 1.525 0.0 0.0 0.025 0.0 106-107 1.7625 0.0 0.0 0.025 0.0 108-109 1.975 0.0 0.0 0.025 0.0 110-111 2.35 0.0 0.0 0.025 0.0 112-113 2.7375 0.0 0.0 0.025 0.0 114-115 2.9749999999999996 0.0 0.0 0.025 0.0 116-117 3.3125 0.0 0.0 0.025 0.0 118-119 3.6125 0.0 0.0 0.025 0.0 120-121 3.925 0.0 0.0 0.025 0.0 122-123 4.4375 0.0 0.0 0.025 0.0 124-125 4.8625 0.0 0.0 0.025 0.0 126-127 5.525 0.0 0.0 0.025 0.0 128-129 6.262499999999999 0.0 0.0 0.025 0.0 130-131 6.7375 0.0 0.0 0.025 0.0 132-133 7.2875 0.0 0.0 0.025 0.0 134-135 7.862500000000001 0.0 0.0 0.025 0.0 136-137 8.6125 0.0 0.0 0.025 0.0 138-139 9.525 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTGT 10 0.006843168 144.91249 9 >>END_MODULE SRR7171451 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171451_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07725 33.0 33.0 34.0 33.0 34.0 2 33.217 34.0 33.0 34.0 33.0 34.0 3 33.25275 34.0 33.0 34.0 33.0 34.0 4 33.187 34.0 33.0 34.0 33.0 34.0 5 33.23525 34.0 33.0 34.0 33.0 34.0 6 37.47 38.0 38.0 38.0 38.0 38.0 7 37.42075 38.0 38.0 38.0 38.0 38.0 8 37.3545 38.0 38.0 38.0 37.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.38945 38.0 38.0 38.0 37.4 38.0 15-19 37.36165 38.0 38.0 38.0 37.2 38.0 20-24 37.351 38.0 38.0 38.0 37.4 38.0 25-29 37.33975 38.0 38.0 38.0 37.4 38.0 30-34 37.34475 38.0 38.0 38.0 37.0 38.0 35-39 37.280649999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.2996 38.0 38.0 38.0 37.0 38.0 45-49 37.2036 38.0 38.0 38.0 37.0 38.0 50-54 37.158 38.0 38.0 38.0 37.0 38.0 55-59 37.1588 38.0 38.0 38.0 36.8 38.0 60-64 37.179950000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.13925 38.0 38.0 38.0 36.4 38.0 70-74 37.100699999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.9908 38.0 38.0 38.0 36.0 38.0 80-84 36.99855 38.0 38.0 38.0 36.0 38.0 85-89 36.917699999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.775150000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.71915 38.0 38.0 38.0 34.8 38.0 100-104 36.64895 38.0 38.0 38.0 34.6 38.0 105-109 36.53985 38.0 38.0 38.0 34.0 38.0 110-114 36.439949999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.2611 38.0 37.6 38.0 33.8 38.0 120-124 36.0573 38.0 37.2 38.0 32.6 38.0 125-129 35.9062 38.0 36.8 38.0 32.4 38.0 130-134 35.668400000000005 38.0 36.0 38.0 30.6 38.0 135-139 35.34935 38.0 35.8 38.0 29.6 38.0 140-144 35.0496 38.0 34.6 38.0 27.6 38.0 145-149 34.5376 38.0 33.2 38.0 25.8 38.0 150-151 31.758125 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 4.0 18 5.0 19 7.0 20 6.0 21 7.0 22 7.0 23 3.0 24 13.0 25 13.0 26 7.0 27 10.0 28 21.0 29 23.0 30 25.0 31 40.0 32 73.0 33 81.0 34 117.0 35 231.0 36 577.0 37 2727.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.15 19.675 14.124999999999998 25.05 2 25.7 27.3 28.749999999999996 18.25 3 21.8 29.175 29.599999999999998 19.425 4 23.075000000000003 34.599999999999994 22.75 19.575 5 23.825 35.65 22.625 17.9 6 20.375 36.65 23.1 19.875 7 20.599999999999998 20.825 36.975 21.6 8 21.224999999999998 25.650000000000002 27.250000000000004 25.874999999999996 9 21.675 25.95 29.549999999999997 22.825 10-14 23.78 28.199999999999996 26.27 21.75 15-19 23.085 27.665 27.584999999999997 21.665 20-24 23.035 27.860000000000003 27.439999999999998 21.665 25-29 22.994999999999997 28.315 27.634999999999998 21.055 30-34 22.965 28.33 27.155 21.55 35-39 23.544999999999998 28.439999999999998 27.025 20.990000000000002 40-44 23.48 28.395 27.26 20.865000000000002 45-49 22.97 28.139999999999997 27.76 21.13 50-54 23.995 27.105 28.044999999999998 20.855 55-59 22.705000000000002 28.46 27.900000000000002 20.935000000000002 60-64 23.925 27.845 27.565 20.665 65-69 23.93 28.22 26.995 20.855 70-74 23.61 27.255000000000003 28.205000000000002 20.93 75-79 23.525 27.935 27.775 20.765 80-84 23.585 28.189999999999998 27.67 20.555 85-89 23.755000000000003 27.58 27.58 21.085 90-94 23.815 27.839999999999996 27.36 20.985 95-99 24.355 26.91 27.66 21.075 100-104 23.74 28.16 26.825 21.275 105-109 24.060000000000002 27.525 27.785 20.630000000000003 110-114 24.185000000000002 27.57 27.54 20.705000000000002 115-119 24.455 28.095 26.995 20.455000000000002 120-124 24.38 28.01 27.315 20.294999999999998 125-129 25.145 27.515 26.965 20.375 130-134 25.430000000000003 27.74 27.07 19.759999999999998 135-139 25.44 27.634999999999998 27.025 19.900000000000002 140-144 25.745 27.67 26.590000000000003 19.994999999999997 145-149 26.375 27.62 25.929999999999996 20.075000000000003 150-151 26.625 27.1625 26.775 19.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 3.5 27 5.0 28 4.0 29 5.0 30 9.5 31 15.5 32 19.0 33 22.5 34 34.5 35 51.5 36 75.5 37 98.5 38 128.0 39 168.0 40 186.5 41 217.0 42 259.5 43 283.0 44 298.0 45 270.5 46 250.5 47 256.0 48 239.5 49 208.0 50 182.5 51 169.5 52 133.0 53 94.0 54 75.5 55 53.5 56 40.0 57 32.0 58 22.5 59 19.0 60 13.5 61 9.0 62 7.0 63 8.0 64 5.5 65 2.5 66 3.5 67 5.5 68 4.5 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2007024586051179 0.4 3 0.07526342197691922 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 6.2625 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.3625 0.0 0.0 0.0 0.0 134-135 7.9625 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATCAT 20 3.5877043E-4 108.75 8 >>END_MODULE Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra Read 745708 spots for SRR7171451.sra Written 745708 spots for SRR7171451.sra Read 745700 spots for SRR7171451.sra Written 745700 spots for SRR7171451.sra SRR ids: ['SRR7171451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lm2vq5fa SRR7171451.sra spots: 14914008 blocks: [[1, 745700], [745701, 1491400], [1491401, 2237100], [2237101, 2982800], [2982801, 3728500], [3728501, 4474200], [4474201, 5219900], [5219901, 5965600], [5965601, 6711300], [6711301, 7457000], [7457001, 8202700], [8202701, 8948400], [8948401, 9694100], [9694101, 10439800], [10439801, 11185500], [11185501, 11931200], [11931201, 12676900], [12676901, 13422600], [13422601, 14168300], [14168301, 14914008]] SRR7171451 file size 5032167 SRR7171451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171451 SRR7171451_1.fastq SRR7171451_2.fastq Input file: SRR7171451_1.fastq Paired file: SRR7171451_2.fastq trimmed: SRR7171451-trimmed-pair1.fastq, SRR7171451-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:18:28 2025 >> started Thu Feb 13 18:18:44 2025 >> done (15.706s) 14914008 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 1225 ( 0.01%) empty read pairs filtered out after trimming by size control 14912767 (99.99%) read pairs available; of these: 2279534 (15.29%) trimmed read pairs available after processing 12633233 (84.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 1 0.00% 35 3 0.00% 36 2 0.00% 37 6 0.00% 38 5 0.00% 39 2 0.00% 40 4 0.00% 41 7 0.00% 42 4 0.00% 43 9 0.00% 44 10 0.00% 45 11 0.00% 46 11 0.00% 47 11 0.00% 48 14 0.00% 49 15 0.00% 50 28 0.00% 51 34 0.00% 52 20 0.00% 53 41 0.00% 54 50 0.00% 55 42 0.00% 56 60 0.00% 57 56 0.00% 58 82 0.00% 59 90 0.00% 60 120 0.00% 61 153 0.00% 62 175 0.00% 63 231 0.00% 64 231 0.00% 65 262 0.00% 66 321 0.00% 67 380 0.00% 68 451 0.00% 69 526 0.00% 70 638 0.00% 71 779 0.01% 72 876 0.01% 73 993 0.01% 74 1135 0.01% 75 1330 0.01% 76 1447 0.01% 77 1684 0.01% 78 1906 0.01% 79 2146 0.01% 80 2514 0.02% 81 3057 0.02% 82 3305 0.02% 83 3751 0.03% 84 4303 0.03% 85 4594 0.03% 86 5000 0.03% 87 5630 0.04% 88 6144 0.04% 89 6557 0.04% 90 7153 0.05% 91 8037 0.05% 92 9121 0.06% 93 9839 0.07% 94 10821 0.07% 95 11648 0.08% 96 12381 0.08% 97 12791 0.09% 98 13437 0.09% 99 14461 0.10% 100 15362 0.10% 101 16501 0.11% 102 17915 0.12% 103 19135 0.13% 104 20353 0.14% 105 20988 0.14% 106 22208 0.15% 107 22945 0.15% 108 23456 0.16% 109 24210 0.16% 110 25301 0.17% 111 26584 0.18% 112 27780 0.19% 113 29169 0.20% 114 30778 0.21% 115 32338 0.22% 116 32829 0.22% 117 33596 0.23% 118 34212 0.23% 119 34756 0.23% 120 35766 0.24% 121 37320 0.25% 122 38599 0.26% 123 40066 0.27% 124 41991 0.28% 125 42613 0.29% 126 44184 0.30% 127 44629 0.30% 128 44971 0.30% 129 45772 0.31% 130 46278 0.31% 131 46879 0.31% 132 48729 0.33% 133 50249 0.34% 134 52072 0.35% 135 53168 0.36% 136 54076 0.36% 137 54081 0.36% 138 55228 0.37% 139 55184 0.37% 140 55424 0.37% 141 56523 0.38% 142 57663 0.39% 143 58435 0.39% 144 60453 0.41% 145 61832 0.41% 146 62396 0.42% 147 63326 0.42% 148 63404 0.43% 149 62897 0.42% 150 63940 0.43% 151 12633233 84.71% 14912767 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=78.60 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.2 sequence=AACATTCTCACACACTTCTTATAGCAATATTACATGATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTAT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=36.63 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.2 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR7171451 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:19:49 Started mapping on | Feb 13 18:19:49 Finished on | Feb 13 18:21:17 Mapping speed, Million of reads per hour | 610.07 Number of input reads | 14912767 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12304854 Uniquely mapped reads % | 82.51% Average mapped length | 291.35 Number of splices: Total | 12073903 Number of splices: Annotated (sjdb) | 11868824 Number of splices: GT/AG | 11879633 Number of splices: GC/AG | 151197 Number of splices: AT/AC | 9446 Number of splices: Non-canonical | 33627 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347783 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 243175 % of reads mapped to too many loci | 1.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.27% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2260130 2260130 2260130 N_multimapping 347783 347783 347783 N_noFeature 286748 12198287 328610 N_ambiguous 205490 1910 139492 UnstrandedReadsAssigned:11812616 PositiveStrandReadsAssigned:104657 NegativeStrandReadsAssigned:11836752 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171451 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171451-trimmed-pair1.fastq SRR7171451-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,912,767 reads, 13,382,612 reads pseudoaligned [quant] estimated average fragment length: 216.423 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7171451.ke.tsv 34699 SRR7171451.se.tsv 87100 total ==> SRR7171451.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.58 821 34.3344 Potri.005G024800.1.v4.1 1035 819.577 179 16.4643 Potri.004G059700.1.v4.1 961 745.583 58 5.86425 Potri.007G009000.2.v4.1 1416 1200.58 0 0 Potri.003G141000.2.v4.1 2943 2727.58 409.139 11.3077 Potri.016G087400.1.v4.1 270 92.24 960.506 784.985 Potri.015G069301.1.v4.1 564 351.329 0 0 Potri.010G195200.1.v4.1 1773 1557.58 230 11.1316 Potri.012G127500.1.v4.1 977 761.583 2577 255.081 ==> SRR7171451.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 90 SRR7171451 completed mapping pipeline successfully