Starting /dee2/code/volunteer_pipeline.sh SRR7171452 current disk space = 3088263512064 free memory = 1412166236 SRR7171452 SRAfilesize cd908981c381f34a2884f565eab09e69 SRR7171452.sra SRR7171452.sra file validated SRR7171452 is paired end SRR7171452 is conventional basespace SRR7171452 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 34.0 33.0 34.0 32.0 34.0 2 33.18775 34.0 33.0 34.0 32.0 34.0 3 32.78 33.0 33.0 34.0 31.0 34.0 4 32.96275 33.0 33.0 34.0 32.0 34.0 5 33.0815 34.0 33.0 34.0 32.0 34.0 6 36.66975 38.0 37.0 38.0 34.0 38.0 7 37.35525 38.0 38.0 38.0 36.0 38.0 8 37.469 38.0 38.0 38.0 37.0 38.0 9 37.57575 38.0 38.0 38.0 38.0 38.0 10-14 37.576350000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.465199999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.3955 38.0 38.0 38.0 37.0 38.0 25-29 37.45895 38.0 38.0 38.0 37.4 38.0 30-34 37.50295 38.0 38.0 38.0 38.0 38.0 35-39 36.372499999999995 38.0 37.6 38.0 32.2 38.0 40-44 37.10225 38.0 38.0 38.0 35.0 38.0 45-49 37.4056 38.0 38.0 38.0 37.0 38.0 50-54 37.349 38.0 38.0 38.0 37.0 38.0 55-59 37.2449 38.0 38.0 38.0 37.0 38.0 60-64 37.2673 38.0 38.0 38.0 36.8 38.0 65-69 37.25485 38.0 38.0 38.0 36.6 38.0 70-74 34.5161 33.6 33.6 37.8 32.2 38.0 75-79 35.284749999999995 36.2 35.0 38.0 31.8 38.0 80-84 37.1344 38.0 38.0 38.0 36.0 38.0 85-89 37.187850000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.12325 38.0 38.0 38.0 36.0 38.0 95-99 37.04165 38.0 38.0 38.0 36.0 38.0 100-104 36.925149999999995 38.0 38.0 38.0 35.6 38.0 105-109 36.82865 38.0 38.0 38.0 35.0 38.0 110-114 36.647299999999994 38.0 38.0 38.0 34.2 38.0 115-119 36.5818 38.0 38.0 38.0 34.2 38.0 120-124 36.39785 38.0 38.0 38.0 34.0 38.0 125-129 36.276700000000005 38.0 37.6 38.0 33.4 38.0 130-134 36.1669 38.0 37.0 38.0 33.2 38.0 135-139 36.16275 38.0 37.4 38.0 33.0 38.0 140-144 36.01935 38.0 36.2 38.0 32.8 38.0 145-149 35.799549999999996 38.0 36.0 38.0 31.6 38.0 150-151 33.529375 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 6.0 25 10.0 26 5.0 27 8.0 28 23.0 29 28.0 30 28.0 31 46.0 32 62.0 33 94.0 34 130.0 35 231.0 36 716.0 37 2607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.374590370557094 11.998991681371313 9.150491555331485 36.47592639274011 2 22.3 13.350000000000001 33.025 31.324999999999996 3 21.525 19.025 24.575 34.875 4 23.775 27.125 22.225 26.875 5 23.549999999999997 29.65 24.125 22.675 6 20.175 34.4 25.1 20.325 7 15.825 26.0 39.550000000000004 18.625 8 18.025 26.525 30.575000000000003 24.875 9 18.2 24.95 32.550000000000004 24.3 10-14 19.945 29.37 26.66 24.025 15-19 20.445 27.975 27.76 23.82 20-24 20.215 27.79 27.365000000000002 24.63 25-29 20.32304845726859 28.404260639095863 27.254088113216984 24.018602790418562 30-34 20.328131252501 27.931172468987597 27.62605042016807 24.114645858343337 35-39 20.20510255127564 28.009004502251127 27.46873436718359 24.317158579289643 40-44 20.525131282820706 28.617154288572145 27.081770442610654 23.775943985996502 45-49 20.797279047666684 28.074826189166206 26.969439303756314 24.158455459410792 50-54 20.94209420942094 27.81278127812781 27.782778277827784 23.462346234623464 55-59 20.05 27.715 27.894999999999996 24.34 60-64 20.169999999999998 28.1 27.810000000000002 23.919999999999998 65-69 20.205000000000002 27.839999999999996 27.534999999999997 24.42 70-74 21.145 28.52 26.040000000000003 24.295 75-79 20.87 27.16 27.810000000000002 24.16 80-84 20.765 27.474999999999998 28.01 23.75 85-89 20.73 28.025 27.36 23.885 90-94 20.919999999999998 27.765 26.8 24.515 95-99 20.54 27.705000000000002 27.279999999999998 24.474999999999998 100-104 21.01 27.87 27.355 23.765 105-109 21.4 27.575 27.54 23.485 110-114 21.305 28.09 26.700000000000003 23.905 115-119 21.310000000000002 27.55 26.845000000000002 24.295 120-124 21.33 27.155 27.38 24.135 125-129 20.830000000000002 27.68 27.33 24.16 130-134 21.25 27.04 27.54 24.169999999999998 135-139 21.5 27.55 26.419999999999998 24.529999999999998 140-144 21.315 27.794999999999998 26.88 24.01 145-149 21.6 27.51 26.405 24.485 150-151 22.3 27.650000000000002 25.4625 24.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 1.0 27 1.5 28 4.0 29 8.0 30 9.5 31 14.5 32 21.0 33 27.0 34 46.5 35 61.5 36 72.0 37 91.5 38 112.5 39 131.5 40 167.5 41 193.0 42 215.5 43 255.0 44 276.0 45 283.0 46 279.5 47 254.0 48 247.0 49 245.5 50 214.0 51 173.0 52 131.0 53 100.5 54 81.5 55 66.5 56 54.5 57 44.0 58 27.5 59 19.0 60 15.0 61 8.5 62 7.0 63 6.0 64 7.5 65 7.0 66 3.5 67 2.0 68 0.5 69 1.0 70 1.5 71 1.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.04 35-39 0.05 40-44 0.025 45-49 0.034999999999999996 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.4875 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.5875 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.425000000000001 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTCT 10 0.006830828 145.0 3 >>END_MODULE SRR7171452 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171452_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9885 33.0 33.0 34.0 32.0 34.0 2 32.95875 34.0 33.0 34.0 32.0 34.0 3 33.007 34.0 33.0 34.0 32.0 34.0 4 33.0525 34.0 33.0 34.0 33.0 34.0 5 33.0605 34.0 33.0 34.0 32.0 34.0 6 37.2135 38.0 38.0 38.0 37.0 38.0 7 37.17125 38.0 38.0 38.0 37.0 38.0 8 37.15825 38.0 38.0 38.0 37.0 38.0 9 37.13225 38.0 38.0 38.0 37.0 38.0 10-14 37.1541 38.0 38.0 38.0 37.0 38.0 15-19 37.1478 38.0 38.0 38.0 37.0 38.0 20-24 37.07985 38.0 38.0 38.0 36.6 38.0 25-29 37.085300000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.1268 38.0 38.0 38.0 36.8 38.0 35-39 37.01219999999999 38.0 38.0 38.0 36.4 38.0 40-44 36.8645 38.0 38.0 38.0 36.0 38.0 45-49 36.8956 38.0 38.0 38.0 36.0 38.0 50-54 36.931349999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.032050000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.9262 38.0 38.0 38.0 36.0 38.0 65-69 36.88995 38.0 38.0 38.0 36.0 38.0 70-74 36.858 38.0 38.0 38.0 35.8 38.0 75-79 36.80705 38.0 38.0 38.0 35.6 38.0 80-84 36.70995 38.0 38.0 38.0 34.8 38.0 85-89 36.691449999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.53085 38.0 38.0 38.0 34.2 38.0 95-99 36.53955 38.0 38.0 38.0 34.0 38.0 100-104 36.443949999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.3928 38.0 38.0 38.0 34.0 38.0 110-114 36.380700000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.177499999999995 38.0 38.0 38.0 33.6 38.0 120-124 35.9286 38.0 37.2 38.0 32.2 38.0 125-129 35.814949999999996 38.0 37.0 38.0 31.6 38.0 130-134 35.8703 38.0 36.8 38.0 32.0 38.0 135-139 35.53175 38.0 36.0 38.0 30.4 38.0 140-144 35.2937 38.0 35.8 38.0 28.8 38.0 145-149 35.0293 38.0 35.2 38.0 27.6 38.0 150-151 32.326 35.5 28.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 3.0 17 3.0 18 6.0 19 7.0 20 6.0 21 6.0 22 5.0 23 3.0 24 11.0 25 17.0 26 23.0 27 27.0 28 22.0 29 38.0 30 39.0 31 53.0 32 56.0 33 122.0 34 109.0 35 198.0 36 421.0 37 2817.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.94347173586793 19.459729864932466 16.05802901450725 27.538769384692348 2 26.720040030022517 27.120340255191394 27.970978233675257 18.188641481110835 3 22.54190642982237 28.521391043282463 29.697272954716038 19.239429572179134 4 24.574574574574577 34.08408408408408 22.57257257257257 18.76876876876877 5 24.680851063829788 34.267834793491865 23.504380475594495 17.546933667083856 6 21.226533166458072 37.04630788485607 22.90362953692115 18.823529411764707 7 20.851063829787233 22.177722152690862 36.67083854818523 20.30037546933667 8 22.453066332916144 25.456821026282856 26.90863579474343 25.18147684605757 9 23.028785982478098 25.33166458072591 27.98498122653317 23.654568210262827 10-14 22.91364205256571 29.561952440550687 25.57196495619524 21.952440550688358 15-19 23.779724655819777 27.9549436795995 26.708385481852314 21.55694618272841 20-24 23.128911138923655 28.37546933667084 26.673341677096367 21.822277847309138 25-29 23.567102167492617 28.102317665315113 27.09115482805226 21.239425339140013 30-34 23.272454340755566 27.830873154866147 27.290467850888167 21.606204653490117 35-39 23.556778389194598 27.693846923461727 26.96848424212106 21.78089044522261 40-44 23.867900925694272 27.60570427820866 27.50562922191644 21.020765574180636 45-49 24.31295990388947 28.11232917855534 26.730740351404116 20.843970566151075 50-54 23.379224030037545 28.23028785982478 27.04881101376721 21.34167709637046 55-59 24.225281602002504 27.579474342928663 26.823529411764707 21.37171464330413 60-64 23.844806007509387 28.11514392991239 26.988735919899874 21.051314142678347 65-69 24.174008810572687 27.78334000800961 27.09251101321586 20.95014016820184 70-74 24.44966980188113 27.476485891534917 27.04622773664199 21.027616569941966 75-79 24.033411694092933 27.91977192017206 27.679687890761766 20.36712849497324 80-84 23.91097774443611 27.721930482620653 27.001750437609402 21.365341335333834 85-89 24.042021010505252 27.593796898449224 27.238619309654826 21.125562781390695 90-94 24.110315831623204 27.724110315831624 27.478852795435206 20.686721057109967 95-99 24.09511889862328 27.964956195244056 27.414267834793492 20.52565707133917 100-104 23.9549436795995 28.650813516896118 26.87859824780976 20.515644555694617 105-109 24.010012515644554 27.609511889862326 27.574468085106385 20.806007509386735 110-114 24.500625782227782 27.41927409261577 26.65832290362954 21.42177722152691 115-119 24.660826032540676 27.62453066332916 26.758448060075096 20.956195244055067 120-124 24.54945935122147 27.928514217060474 27.17761313576292 20.344413295955146 125-129 25.2326628640048 27.514259981987394 26.97888521965376 20.274191934354047 130-134 24.893670252689517 27.52564423317488 27.270452839629723 20.31023267450588 135-139 25.121401752190238 27.62453066332916 26.933667083854818 20.320400500625784 140-144 26.037546933667084 27.314142678347935 26.83354192740926 19.814768460575717 145-149 25.63704630788486 27.349186483103882 26.938673341677095 20.075093867334168 150-151 25.944931163954944 27.972465581977474 26.858573216520647 19.22403003754693 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 1.5 28 3.5 29 6.0 30 8.0 31 9.5 32 14.0 33 24.5 34 32.5 35 41.5 36 52.5 37 73.0 38 105.0 39 135.0 40 180.5 41 217.5 42 253.5 43 289.0 44 285.0 45 277.0 46 288.5 47 295.0 48 270.0 49 229.0 50 196.5 51 166.0 52 128.0 53 97.5 54 78.5 55 58.5 56 37.5 57 25.5 58 21.5 59 16.0 60 14.5 61 14.5 62 13.0 63 10.0 64 5.0 65 2.0 66 2.0 67 3.0 68 2.5 69 1.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.075 4 0.1 5 0.125 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.125 20-24 0.125 25-29 0.11499999999999999 30-34 0.075 35-39 0.05 40-44 0.075 45-49 0.11499999999999999 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.12 70-74 0.06 75-79 0.034999999999999996 80-84 0.025 85-89 0.05 90-94 0.105 95-99 0.125 100-104 0.125 105-109 0.125 110-114 0.125 115-119 0.125 120-124 0.12 125-129 0.06999999999999999 130-134 0.075 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 6.95 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.45 0.0 0.0 0.0 0.0 138-139 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781407 spots for SRR7171452.sra Written 781407 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra Read 781400 spots for SRR7171452.sra Written 781400 spots for SRR7171452.sra SRR ids: ['SRR7171452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kx1qlwp0 SRR7171452.sra spots: 15628007 blocks: [[1, 781400], [781401, 1562800], [1562801, 2344200], [2344201, 3125600], [3125601, 3907000], [3907001, 4688400], [4688401, 5469800], [5469801, 6251200], [6251201, 7032600], [7032601, 7814000], [7814001, 8595400], [8595401, 9376800], [9376801, 10158200], [10158201, 10939600], [10939601, 11721000], [11721001, 12502400], [12502401, 13283800], [13283801, 14065200], [14065201, 14846600], [14846601, 15628007]] SRR7171452 file size 5274118 SRR7171452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171452 SRR7171452_1.fastq SRR7171452_2.fastq Input file: SRR7171452_1.fastq Paired file: SRR7171452_2.fastq trimmed: SRR7171452-trimmed-pair1.fastq, SRR7171452-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:16:43 2025 >> started Thu Feb 13 18:17:12 2025 >> done (28.896s) 15628007 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 1837 ( 0.01%) empty read pairs filtered out after trimming by size control 15626126 (99.99%) read pairs available; of these: 2358093 (15.09%) trimmed read pairs available after processing 13268033 (84.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 1 0.00% 34 1 0.00% 35 3 0.00% 36 1 0.00% 37 2 0.00% 38 2 0.00% 39 2 0.00% 40 5 0.00% 41 2 0.00% 42 4 0.00% 43 4 0.00% 44 7 0.00% 45 2 0.00% 46 10 0.00% 47 8 0.00% 48 13 0.00% 49 15 0.00% 50 17 0.00% 51 14 0.00% 52 27 0.00% 53 36 0.00% 54 34 0.00% 55 31 0.00% 56 36 0.00% 57 48 0.00% 58 58 0.00% 59 78 0.00% 60 76 0.00% 61 107 0.00% 62 126 0.00% 63 134 0.00% 64 168 0.00% 65 192 0.00% 66 227 0.00% 67 248 0.00% 68 304 0.00% 69 344 0.00% 70 375 0.00% 71 534 0.00% 72 562 0.00% 73 728 0.00% 74 733 0.00% 75 878 0.01% 76 1022 0.01% 77 1127 0.01% 78 1308 0.01% 79 1568 0.01% 80 1799 0.01% 81 2089 0.01% 82 2337 0.01% 83 2681 0.02% 84 3177 0.02% 85 3450 0.02% 86 3858 0.02% 87 4228 0.03% 88 4728 0.03% 89 5189 0.03% 90 5736 0.04% 91 6472 0.04% 92 7104 0.05% 93 7916 0.05% 94 8856 0.06% 95 9639 0.06% 96 10541 0.07% 97 11100 0.07% 98 11766 0.08% 99 12712 0.08% 100 13721 0.09% 101 14589 0.09% 102 15793 0.10% 103 16711 0.11% 104 18237 0.12% 105 19190 0.12% 106 20494 0.13% 107 21321 0.14% 108 22143 0.14% 109 23102 0.15% 110 23840 0.15% 111 25214 0.16% 112 26938 0.17% 113 28251 0.18% 114 29933 0.19% 115 31225 0.20% 116 32985 0.21% 117 36465 0.23% 118 37711 0.24% 119 36657 0.23% 120 36381 0.23% 121 37339 0.24% 122 38564 0.25% 123 40363 0.26% 124 41990 0.27% 125 43544 0.28% 126 45532 0.29% 127 46375 0.30% 128 47064 0.30% 129 48028 0.31% 130 49083 0.31% 131 49883 0.32% 132 51180 0.33% 133 52711 0.34% 134 54800 0.35% 135 56087 0.36% 136 57016 0.36% 137 58584 0.37% 138 59569 0.38% 139 59481 0.38% 140 61642 0.39% 141 65458 0.42% 142 65719 0.42% 143 67519 0.43% 144 67760 0.43% 145 71086 0.45% 146 67205 0.43% 147 69469 0.44% 148 72253 0.46% 149 69820 0.45% 150 75451 0.48% 151 13268033 84.91% 15626126 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.17 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=4.1 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=372.69 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=33.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=24.95 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171452 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:18:09 Started mapping on | Feb 13 18:18:10 Finished on | Feb 13 18:20:55 Mapping speed, Million of reads per hour | 340.93 Number of input reads | 15626126 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14251675 Uniquely mapped reads % | 91.20% Average mapped length | 294.02 Number of splices: Total | 14265356 Number of splices: Annotated (sjdb) | 14024641 Number of splices: GT/AG | 14045185 Number of splices: GC/AG | 175046 Number of splices: AT/AC | 10222 Number of splices: Non-canonical | 34903 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396968 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 254226 % of reads mapped to too many loci | 1.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 977483 977483 977483 N_multimapping 396968 396968 396968 N_noFeature 298146 14136006 346230 N_ambiguous 140982 1151 72470 UnstrandedReadsAssigned:13812547 PositiveStrandReadsAssigned:114518 NegativeStrandReadsAssigned:13832975 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171452 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171452-trimmed-pair1.fastq SRR7171452-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,626,126 reads, 14,076,364 reads pseudoaligned [quant] estimated average fragment length: 218.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR7171452.ke.tsv 34699 SRR7171452.se.tsv 87100 total ==> SRR7171452.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.39 1028 39.6801 Potri.005G024800.1.v4.1 1035 817.389 229 19.4694 Potri.004G059700.1.v4.1 961 743.395 7 0.654372 Potri.007G009000.2.v4.1 1416 1198.39 0 0 Potri.003G141000.2.v4.1 2943 2725.39 488 12.4434 Potri.016G087400.1.v4.1 270 87.9525 944 745.882 Potri.015G069301.1.v4.1 564 348.588 0 0 Potri.010G195200.1.v4.1 1773 1555.39 251 11.2145 Potri.012G127500.1.v4.1 977 759.395 4677 428.002 ==> SRR7171452.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 112 SRR7171452 completed mapping pipeline successfully