Starting /dee2/code/volunteer_pipeline.sh SRR7171455 current disk space = 3087354449920 free memory = 1477343272 SRR7171455 SRAfilesize 8428a8fc29ca71f08cce40832cc101a5 SRR7171455.sra SRR7171455.sra file validated SRR7171455 is paired end SRR7171455 is conventional basespace SRR7171455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4225 33.0 33.0 33.0 32.0 34.0 2 29.514 31.0 28.0 33.0 18.0 33.0 3 31.5095 33.0 31.0 33.0 29.0 33.0 4 31.72125 33.0 32.0 33.0 30.0 33.0 5 32.462 33.0 33.0 33.0 32.0 34.0 6 36.7095 38.0 37.0 38.0 35.0 38.0 7 37.23325 38.0 38.0 38.0 36.0 38.0 8 37.468 38.0 38.0 38.0 37.0 38.0 9 37.525 38.0 38.0 38.0 38.0 38.0 10-14 37.54175 38.0 38.0 38.0 37.8 38.0 15-19 37.4406 38.0 38.0 38.0 37.4 38.0 20-24 37.40305 38.0 38.0 38.0 37.0 38.0 25-29 37.46645 38.0 38.0 38.0 37.8 38.0 30-34 37.49595 38.0 38.0 38.0 38.0 38.0 35-39 36.301849999999995 38.0 37.6 38.0 32.0 38.0 40-44 37.0871 38.0 38.0 38.0 35.0 38.0 45-49 37.35215 38.0 38.0 38.0 37.0 38.0 50-54 37.25165 38.0 38.0 38.0 36.8 38.0 55-59 37.20955 38.0 38.0 38.0 37.0 38.0 60-64 37.25815 38.0 38.0 38.0 37.0 38.0 65-69 37.222750000000005 38.0 38.0 38.0 36.6 38.0 70-74 34.609899999999996 33.6 33.6 38.0 32.0 38.0 75-79 35.365300000000005 36.2 35.0 38.0 31.8 38.0 80-84 37.14739999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.1136 38.0 38.0 38.0 36.0 38.0 90-94 37.134100000000004 38.0 38.0 38.0 36.0 38.0 95-99 37.04615 38.0 38.0 38.0 36.0 38.0 100-104 36.8628 38.0 38.0 38.0 35.4 38.0 105-109 36.76315 38.0 38.0 38.0 35.0 38.0 110-114 36.645300000000006 38.0 38.0 38.0 34.4 38.0 115-119 36.6023 38.0 38.0 38.0 34.2 38.0 120-124 36.4653 38.0 38.0 38.0 34.0 38.0 125-129 36.31655 38.0 37.8 38.0 33.6 38.0 130-134 36.18044999999999 38.0 37.2 38.0 33.2 38.0 135-139 36.2193 38.0 37.4 38.0 33.0 38.0 140-144 36.0798 38.0 36.4 38.0 33.0 38.0 145-149 35.841750000000005 38.0 36.0 38.0 32.4 38.0 150-151 33.422125 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 7.0 25 4.0 26 13.0 27 18.0 28 21.0 29 20.0 30 31.0 31 56.0 32 54.0 33 94.0 34 142.0 35 215.0 36 747.0 37 2570.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.63531477301229 12.089290193127665 9.857035364936042 36.418359668924005 2 24.95 13.750000000000002 32.125 29.175 3 21.55 16.75 24.975 36.725 4 23.1 24.675 23.549999999999997 28.675 5 22.525000000000002 29.325000000000003 25.05 23.1 6 20.575 33.025 25.75 20.65 7 16.525000000000002 26.1 39.800000000000004 17.575 8 18.275 25.825 30.65 25.25 9 17.9 24.15 33.875 24.075 10-14 20.515 28.655 27.295 23.535 15-19 20.185 27.375 28.205000000000002 24.235 20-24 20.0 27.744999999999997 27.834999999999997 24.42 25-29 20.042004200420042 27.682768276827684 27.917791779177918 24.357435743574356 30-34 20.70535267633817 27.428714357178592 27.85392696348174 24.012006003001503 35-39 20.761799889884376 28.31473046699034 27.098453376044844 23.825016267080436 40-44 20.649292181481666 28.112650692811762 26.992146465909663 24.24591065979691 45-49 20.352211326796077 27.22133279967981 27.971783069841905 24.454672803682207 50-54 20.25202520252025 27.972797279727974 27.627762776277624 24.147414741474147 55-59 20.29 28.139999999999997 27.405 24.165 60-64 20.585 27.925 27.63 23.86 65-69 20.61 28.09 27.334999999999997 23.965 70-74 21.145 28.58 26.224999999999998 24.05 75-79 20.31 27.6 27.884999999999998 24.205 80-84 20.13 27.939999999999998 27.49 24.44 85-89 20.59 27.465 27.66 24.285 90-94 20.724999999999998 28.084999999999997 27.115000000000002 24.075 95-99 20.765 27.279999999999998 27.845 24.11 100-104 21.015 27.685 27.029999999999998 24.27 105-109 20.845 27.694999999999997 27.6 23.86 110-114 21.14 27.46 27.435 23.965 115-119 21.2 27.27 27.11 24.42 120-124 21.01 27.04 27.794999999999998 24.154999999999998 125-129 20.9 27.775 26.75 24.575 130-134 20.93 27.815 26.565 24.69 135-139 21.349999999999998 27.765 26.935 23.95 140-144 21.16 27.715 26.325 24.8 145-149 21.475 27.72 26.534999999999997 24.27 150-151 21.0 27.150000000000002 26.8375 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.5 26 4.5 27 3.5 28 4.5 29 6.5 30 9.5 31 15.5 32 29.0 33 32.5 34 34.5 35 47.5 36 74.0 37 95.0 38 118.5 39 141.5 40 162.5 41 197.0 42 222.5 43 253.5 44 260.0 45 278.0 46 287.0 47 260.0 48 248.5 49 222.0 50 186.0 51 163.5 52 142.0 53 114.5 54 83.0 55 53.5 56 49.5 57 46.5 58 30.0 59 23.5 60 22.0 61 16.5 62 13.0 63 11.5 64 7.0 65 6.0 66 3.5 67 0.5 68 2.0 69 2.0 70 0.5 71 1.5 72 2.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.05 35-39 0.105 40-44 0.045 45-49 0.06 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.9625000000000004 0.0 0.0 0.0 0.0 120-121 4.737500000000001 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 5.7125 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.824999999999999 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 9.0625 0.0 0.0 0.0 0.0 138-139 10.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.852 33.0 33.0 34.0 32.0 34.0 2 32.912 34.0 33.0 34.0 32.0 34.0 3 32.9675 34.0 33.0 34.0 32.0 34.0 4 32.982 34.0 33.0 34.0 32.0 34.0 5 32.9975 34.0 33.0 34.0 33.0 34.0 6 37.1435 38.0 38.0 38.0 37.0 38.0 7 37.09875 38.0 38.0 38.0 37.0 38.0 8 37.0935 38.0 38.0 38.0 37.0 38.0 9 37.149 38.0 38.0 38.0 37.0 38.0 10-14 37.15725 38.0 38.0 38.0 37.0 38.0 15-19 37.1062 38.0 38.0 38.0 37.0 38.0 20-24 37.0236 38.0 38.0 38.0 37.0 38.0 25-29 37.08275 38.0 38.0 38.0 37.0 38.0 30-34 37.11465 38.0 38.0 38.0 37.0 38.0 35-39 36.988150000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.85885 38.0 38.0 38.0 36.0 38.0 45-49 36.908300000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.94885000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.920550000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.9368 38.0 38.0 38.0 36.0 38.0 65-69 36.88915000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.84565 38.0 38.0 38.0 36.0 38.0 75-79 36.7979 38.0 38.0 38.0 35.2 38.0 80-84 36.76944999999999 38.0 38.0 38.0 35.2 38.0 85-89 36.7457 38.0 38.0 38.0 35.2 38.0 90-94 36.6231 38.0 38.0 38.0 34.8 38.0 95-99 36.5925 38.0 38.0 38.0 34.6 38.0 100-104 36.465250000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.47475 38.0 38.0 38.0 34.0 38.0 110-114 36.28515 38.0 38.0 38.0 34.0 38.0 115-119 36.1967 38.0 38.0 38.0 33.8 38.0 120-124 35.99435 38.0 37.8 38.0 32.8 38.0 125-129 35.97650000000001 38.0 37.8 38.0 33.0 38.0 130-134 35.935050000000004 38.0 37.4 38.0 32.4 38.0 135-139 35.6007 38.0 36.0 38.0 30.6 38.0 140-144 35.4009 38.0 36.0 38.0 29.6 38.0 145-149 35.081050000000005 38.0 35.8 38.0 28.2 38.0 150-151 32.306375 35.5 29.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 4.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 4.0 19 2.0 20 3.0 21 5.0 22 6.0 23 13.0 24 13.0 25 20.0 26 15.0 27 19.0 28 20.0 29 51.0 30 37.0 31 47.0 32 67.0 33 97.0 34 111.0 35 196.0 36 448.0 37 2809.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.48122183274912 20.080120180270406 14.321482223335003 28.11717576364547 2 25.68922305764411 26.36591478696742 29.74937343358396 18.195488721804512 3 21.748935103983964 27.862691054873466 29.16562265096467 21.2227511901779 4 23.1328320802005 32.98245614035088 23.909774436090224 19.974937343358395 5 25.31328320802005 34.06015037593985 23.383458646616543 17.24310776942356 6 21.88518425670594 37.001754825770874 23.539734269240412 17.573326648282777 7 20.807219854600152 21.634494860867385 37.52820255703184 20.030082727500627 8 22.63725244422161 26.72348959639007 26.62321383805465 24.016044121333668 9 21.83504637753823 26.29731762346453 29.029832038104786 22.837803960892455 10-14 24.05336275640704 28.60223682230804 26.20994031796981 21.13446010331511 15-19 23.470411233701103 28.25977933801404 26.614844533600802 21.654964894684053 20-24 24.09106865252495 28.273406549320494 26.854219948849106 20.781304849305453 25-29 24.033689276582944 28.575725673033535 26.109189351782224 21.281395698601294 30-34 23.352873390450423 28.177764417054963 26.9302069241946 21.539155268300014 35-39 24.002203415293703 27.83814913115329 26.956783013671192 21.202864439881814 40-44 24.15451675935668 28.057517911719028 26.694724184578384 21.09324114434591 45-49 23.646480850210548 27.71706436735512 27.421295367956688 21.21515941447764 50-54 24.437202306342442 28.26272248683881 26.558034595136625 20.742040611682125 55-59 24.25017554418698 27.485204132811713 27.12910021065302 21.13552011234828 60-64 24.097110754414125 27.518057784911715 27.312399678972714 21.072431781701447 65-69 23.911953469715204 28.544925792218212 26.203369434416366 21.33975130365022 70-74 23.864148675048842 28.06191454190252 26.92481090016531 21.149125882883336 75-79 23.45728442019919 27.596216405585306 27.651268705270006 21.295230468945498 80-84 24.168458960636222 27.81973690791777 26.75936577802231 21.2524383534237 85-89 24.123773282595636 28.054275986380933 26.547166032445425 21.27478469857801 90-94 24.0 27.50877192982456 27.037593984962406 21.453634085213032 95-99 24.794383149448347 27.843530591775327 27.00100300902708 20.36108324974925 100-104 23.756711998795605 28.298288753951923 27.339790234355398 20.605209012897074 105-109 24.434298329235865 27.640359239375844 27.43966685063469 20.4856755807536 110-114 24.692473766129435 27.870663252497867 26.811266757041725 20.625596224330973 115-119 24.89339286610144 27.025535544072643 27.321527115838055 20.75954447398786 120-124 24.947357866238846 27.92539857615562 27.11821919181791 20.009024365787624 125-129 25.240529164161153 27.911405091200642 26.964321507316097 19.88374423732211 130-134 24.973693440897932 28.01523275041339 26.532043894372904 20.47902991431578 135-139 25.705690649285533 27.395337177237405 26.783655051391325 20.115317122085735 140-144 26.4775295003766 27.16545317599799 26.68340446899322 19.673612854632186 145-149 26.31922478284882 28.277351006677716 25.79203695335643 19.611387257117034 150-151 25.796737766624844 28.08030112923463 26.16060225846926 19.962358845671268 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.5 4 2.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 1.5 26 1.5 27 3.0 28 3.5 29 6.5 30 8.0 31 8.0 32 11.0 33 20.5 34 29.0 35 38.0 36 60.5 37 80.0 38 93.5 39 123.5 40 169.5 41 216.0 42 270.5 43 294.0 44 303.5 45 306.5 46 288.0 47 269.5 48 240.5 49 226.5 50 205.0 51 157.0 52 107.5 53 85.5 54 78.0 55 64.5 56 56.0 57 38.0 58 23.0 59 19.0 60 14.5 61 11.5 62 10.5 63 11.5 64 7.0 65 3.5 66 4.0 67 3.5 68 3.5 69 3.5 70 2.5 71 1.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.25 3 0.22499999999999998 4 0.25 5 0.25 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.305 15-19 0.3 20-24 0.295 25-29 0.265 30-34 0.20500000000000002 35-39 0.155 40-44 0.20500000000000002 45-49 0.26 50-54 0.27499999999999997 55-59 0.31 60-64 0.32 65-69 0.27999999999999997 70-74 0.185 75-79 0.095 80-84 0.034999999999999996 85-89 0.13999999999999999 90-94 0.25 95-99 0.3 100-104 0.365 105-109 0.345 110-114 0.415 115-119 0.335 120-124 0.27 125-129 0.22 130-134 0.215 135-139 0.27499999999999997 140-144 0.42500000000000004 145-149 0.415 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52165156092649 98.825 2 0.3776435045317221 0.75 3 0.025176233635448138 0.075 4 0.050352467270896276 0.2 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.449999999999999 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.325 0.0 0.0 0.0 0.0 128-129 6.8125 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 7.95 0.0 0.0 0.0 0.0 134-135 8.4875 0.0 0.0 0.0 0.0 136-137 9.1125 0.0 0.0 0.0 0.0 138-139 10.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGAA 10 0.006830828 145.0 1 >>END_MODULE Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762121 spots for SRR7171455.sra Written 762121 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra Read 762117 spots for SRR7171455.sra Written 762117 spots for SRR7171455.sra SRR ids: ['SRR7171455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5vio02h6 SRR7171455.sra spots: 15242344 blocks: [[1, 762117], [762118, 1524234], [1524235, 2286351], [2286352, 3048468], [3048469, 3810585], [3810586, 4572702], [4572703, 5334819], [5334820, 6096936], [6096937, 6859053], [6859054, 7621170], [7621171, 8383287], [8383288, 9145404], [9145405, 9907521], [9907522, 10669638], [10669639, 11431755], [11431756, 12193872], [12193873, 12955989], [12955990, 13718106], [13718107, 14480223], [14480224, 15242344]] SRR7171455 file size 5143429 SRR7171455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171455 SRR7171455_1.fastq SRR7171455_2.fastq Input file: SRR7171455_1.fastq Paired file: SRR7171455_2.fastq trimmed: SRR7171455-trimmed-pair1.fastq, SRR7171455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:08:40 2025 >> started Thu Feb 13 19:08:56 2025 >> done (16.688s) 15242344 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 2219 ( 0.01%) empty read pairs filtered out after trimming by size control 15240098 (99.99%) read pairs available; of these: 2509371 (16.47%) trimmed read pairs available after processing 12730727 (83.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 3 0.00% 31 3 0.00% 32 1 0.00% 33 7 0.00% 34 7 0.00% 35 2 0.00% 36 2 0.00% 37 1 0.00% 38 2 0.00% 39 5 0.00% 40 2 0.00% 41 9 0.00% 42 6 0.00% 43 6 0.00% 44 7 0.00% 45 9 0.00% 46 9 0.00% 47 14 0.00% 48 16 0.00% 49 18 0.00% 50 17 0.00% 51 26 0.00% 52 35 0.00% 53 35 0.00% 54 54 0.00% 55 63 0.00% 56 61 0.00% 57 76 0.00% 58 89 0.00% 59 102 0.00% 60 130 0.00% 61 166 0.00% 62 187 0.00% 63 216 0.00% 64 232 0.00% 65 253 0.00% 66 336 0.00% 67 358 0.00% 68 429 0.00% 69 503 0.00% 70 578 0.00% 71 695 0.00% 72 872 0.01% 73 1018 0.01% 74 1090 0.01% 75 1257 0.01% 76 1460 0.01% 77 1607 0.01% 78 1900 0.01% 79 2158 0.01% 80 2513 0.02% 81 2769 0.02% 82 3312 0.02% 83 3689 0.02% 84 4218 0.03% 85 4555 0.03% 86 5079 0.03% 87 5645 0.04% 88 6251 0.04% 89 6664 0.04% 90 7405 0.05% 91 8094 0.05% 92 8964 0.06% 93 9885 0.06% 94 10767 0.07% 95 11676 0.08% 96 12694 0.08% 97 13234 0.09% 98 14440 0.09% 99 15163 0.10% 100 16025 0.11% 101 16950 0.11% 102 18222 0.12% 103 19338 0.13% 104 20480 0.13% 105 21581 0.14% 106 23037 0.15% 107 24374 0.16% 108 24867 0.16% 109 25952 0.17% 110 26784 0.18% 111 27818 0.18% 112 29428 0.19% 113 30613 0.20% 114 32031 0.21% 115 33964 0.22% 116 35819 0.24% 117 38631 0.25% 118 40338 0.26% 119 39162 0.26% 120 39120 0.26% 121 40275 0.26% 122 41415 0.27% 123 43111 0.28% 124 44760 0.29% 125 45862 0.30% 126 47517 0.31% 127 48806 0.32% 128 49470 0.32% 129 50046 0.33% 130 51214 0.34% 131 52290 0.34% 132 53909 0.35% 133 54596 0.36% 134 57001 0.37% 135 58155 0.38% 136 59110 0.39% 137 60352 0.40% 138 61565 0.40% 139 62182 0.41% 140 63061 0.41% 141 67755 0.44% 142 67444 0.44% 143 69090 0.45% 144 69142 0.45% 145 71831 0.47% 146 69109 0.45% 147 71460 0.47% 148 73526 0.48% 149 71327 0.47% 150 76294 0.50% 151 12730727 83.53% 15240098 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=21 prefix-density=0.48 prefix-fanout=3.0 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=18.30 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.5 sequence=ACAGCAAATACCAGCGGCCCTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTGCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTTCTTGGTACCTATTCCTCCAGGAATTACTGACCATAGTGCTCGTACGCTAGTCTAGCCTAGTAAAACCACGATCAGCCGACGGTCTGGATGCCGACGCCCGTATACTGTGAGCAGCTTGG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=24 prefix-density=0.61 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=17 fanout-score=23.24 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171455 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:09:57 Started mapping on | Feb 13 19:09:58 Finished on | Feb 13 19:12:29 Mapping speed, Million of reads per hour | 363.34 Number of input reads | 15240098 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13569910 Uniquely mapped reads % | 89.04% Average mapped length | 293.23 Number of splices: Total | 13303924 Number of splices: Annotated (sjdb) | 13076733 Number of splices: GT/AG | 13095567 Number of splices: GC/AG | 164739 Number of splices: AT/AC | 10364 Number of splices: Non-canonical | 33254 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382716 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 335946 % of reads mapped to too many loci | 2.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1287472 1287472 1287472 N_multimapping 382716 382716 382716 N_noFeature 289480 13452249 333364 N_ambiguous 136562 1363 61718 UnstrandedReadsAssigned:13143868 PositiveStrandReadsAssigned:116298 NegativeStrandReadsAssigned:13174828 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171455-trimmed-pair1.fastq SRR7171455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,240,098 reads, 13,499,214 reads pseudoaligned [quant] estimated average fragment length: 213.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7171455.ke.tsv 34699 SRR7171455.se.tsv 87100 total ==> SRR7171455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.21 979 35.2803 Potri.005G024800.1.v4.1 1035 822.208 234 18.5145 Potri.004G059700.1.v4.1 961 748.224 49 4.26031 Potri.007G009000.2.v4.1 1416 1203.21 0 0 Potri.003G141000.2.v4.1 2943 2730.21 414 9.86465 Potri.016G087400.1.v4.1 270 89.2599 1003 731.008 Potri.015G069301.1.v4.1 564 352.898 0 0 Potri.010G195200.1.v4.1 1773 1560.21 240.828 10.0416 Potri.012G127500.1.v4.1 977 764.214 4944 420.863 ==> SRR7171455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 441 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 181 SRR7171455 completed mapping pipeline successfully