Starting /dee2/code/volunteer_pipeline.sh SRR7171456 current disk space = 3087861846016 free memory = 1419563952 SRR7171456 SRAfilesize 070cd87e1c8c6e184f555a57637076e3 SRR7171456.sra SRR7171456.sra file validated SRR7171456 is paired end SRR7171456 is conventional basespace SRR7171456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31575 33.0 33.0 33.0 32.0 34.0 2 31.43325 33.0 31.0 33.0 27.0 34.0 3 32.65275 33.0 33.0 34.0 32.0 34.0 4 32.09775 33.0 32.0 33.0 31.0 34.0 5 32.693 33.0 33.0 33.0 32.0 34.0 6 36.54775 38.0 37.0 38.0 34.0 38.0 7 37.2645 38.0 38.0 38.0 36.0 38.0 8 37.52775 38.0 38.0 38.0 37.0 38.0 9 37.59725 38.0 38.0 38.0 38.0 38.0 10-14 37.62595 38.0 38.0 38.0 38.0 38.0 15-19 37.65840000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.66065 38.0 38.0 38.0 38.0 38.0 25-29 37.61 38.0 38.0 38.0 38.0 38.0 30-34 37.58284999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.5952 38.0 38.0 38.0 38.0 38.0 40-44 37.57265 38.0 38.0 38.0 38.0 38.0 45-49 37.52705 38.0 38.0 38.0 38.0 38.0 50-54 37.5065 38.0 38.0 38.0 37.4 38.0 55-59 37.462450000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.4582 38.0 38.0 38.0 37.2 38.0 65-69 37.401050000000005 38.0 38.0 38.0 37.2 38.0 70-74 37.38845 38.0 38.0 38.0 37.0 38.0 75-79 37.33045 38.0 38.0 38.0 37.0 38.0 80-84 37.21235 38.0 38.0 38.0 36.8 38.0 85-89 37.17635 38.0 38.0 38.0 36.2 38.0 90-94 37.1579 38.0 38.0 38.0 36.0 38.0 95-99 37.059549999999994 38.0 38.0 38.0 36.0 38.0 100-104 37.0002 38.0 38.0 38.0 36.0 38.0 105-109 36.86985 38.0 38.0 38.0 35.4 38.0 110-114 36.8255 38.0 38.0 38.0 35.0 38.0 115-119 36.8341 38.0 38.0 38.0 35.0 38.0 120-124 36.639799999999994 38.0 38.0 38.0 34.2 38.0 125-129 36.423 38.0 38.0 38.0 34.0 38.0 130-134 36.3129 38.0 38.0 38.0 33.6 38.0 135-139 36.1621 38.0 36.6 38.0 33.2 38.0 140-144 35.9503 38.0 36.0 38.0 32.6 38.0 145-149 35.72240000000001 38.0 36.0 38.0 31.8 38.0 150-151 33.046875 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 1.0 24 2.0 25 7.0 26 4.0 27 6.0 28 21.0 29 21.0 30 23.0 31 37.0 32 50.0 33 54.0 34 117.0 35 184.0 36 539.0 37 2930.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.602883355176935 11.926605504587156 9.82961992136304 37.640891218872866 2 20.674999999999997 14.274999999999999 33.925 31.125000000000004 3 19.475 18.075 25.35 37.1 4 22.675 26.400000000000002 22.525000000000002 28.4 5 22.25 30.099999999999998 24.425 23.225 6 20.0 33.725 24.925 21.349999999999998 7 15.5 26.5 40.300000000000004 17.7 8 18.475 25.85 31.075000000000003 24.6 9 18.4 24.825 31.8 24.975 10-14 19.535 29.555 27.66 23.25 15-19 20.095 27.99 28.235 23.68 20-24 20.03 28.43 28.060000000000002 23.48 25-29 19.7 28.03 28.215 24.055 30-34 20.445 28.455000000000002 27.36 23.74 35-39 20.54 28.37 27.779999999999998 23.31 40-44 20.255000000000003 28.555000000000003 27.689999999999998 23.5 45-49 20.03 27.855 28.37 23.745 50-54 20.65 28.285 27.6 23.465 55-59 20.385 28.155 27.62 23.84 60-64 20.395 28.389999999999997 27.445000000000004 23.77 65-69 20.73 27.705000000000002 27.6 23.965 70-74 20.4 28.035 27.450000000000003 24.115000000000002 75-79 20.335 28.044999999999998 27.700000000000003 23.919999999999998 80-84 20.65 28.084999999999997 27.525 23.74 85-89 20.405 27.634999999999998 28.244999999999997 23.715 90-94 20.73 28.470000000000002 27.495000000000005 23.305 95-99 20.51 27.744999999999997 27.91 23.835 100-104 20.749149829965994 27.715543108621727 27.880576115223043 23.654730946189236 105-109 20.367312215383077 27.863684131511786 27.62347995796427 24.14552369514087 110-114 20.761609287429945 27.95736589271417 27.632105684547636 23.648919135308248 115-119 21.091327398219466 28.118435530659198 27.368210463138944 23.422026607982392 120-124 21.205 28.17 27.255000000000003 23.369999999999997 125-129 20.825 28.525 27.05 23.599999999999998 130-134 21.175 28.035 26.855 23.935000000000002 135-139 20.979999999999997 27.925 26.505000000000003 24.59 140-144 21.3 27.97 26.939999999999998 23.79 145-149 21.45 28.04 26.865 23.645 150-151 20.8625 28.7 26.174999999999997 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.0 27 3.0 28 3.5 29 6.5 30 11.5 31 15.5 32 23.5 33 36.0 34 44.0 35 56.0 36 68.5 37 96.0 38 126.0 39 148.5 40 194.0 41 239.0 42 258.5 43 273.5 44 295.5 45 288.0 46 271.5 47 277.5 48 246.5 49 197.0 50 165.5 51 137.0 52 107.0 53 81.0 54 67.0 55 58.5 56 48.5 57 36.0 58 26.0 59 16.0 60 15.0 61 13.5 62 8.0 63 6.0 64 5.0 65 5.0 66 3.5 67 1.0 68 1.0 69 2.0 70 1.0 71 1.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.08499999999999999 110-114 0.08 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.7 0.0 0.0 0.0 0.0 132-133 7.387499999999999 0.0 0.0 0.0 0.0 134-135 7.9625 0.0 0.0 0.0 0.0 136-137 8.625 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGATC 10 0.0068343505 144.975 2 TTCAGCT 10 0.0068343505 144.975 8 >>END_MODULE SRR7171456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06175 33.0 33.0 34.0 32.0 34.0 2 33.21975 34.0 33.0 34.0 33.0 34.0 3 33.22125 34.0 33.0 34.0 33.0 34.0 4 33.201 34.0 33.0 34.0 33.0 34.0 5 33.202 34.0 33.0 34.0 33.0 34.0 6 37.38325 38.0 38.0 38.0 38.0 38.0 7 37.42275 38.0 38.0 38.0 38.0 38.0 8 37.40475 38.0 38.0 38.0 38.0 38.0 9 37.41275 38.0 38.0 38.0 38.0 38.0 10-14 37.360299999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.32685000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.363200000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.3621 38.0 38.0 38.0 37.4 38.0 30-34 37.3289 38.0 38.0 38.0 37.4 38.0 35-39 37.279900000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.2821 38.0 38.0 38.0 37.0 38.0 45-49 37.22405 38.0 38.0 38.0 37.0 38.0 50-54 37.19505 38.0 38.0 38.0 37.0 38.0 55-59 37.181799999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.1267 38.0 38.0 38.0 36.6 38.0 65-69 37.12485 38.0 38.0 38.0 36.2 38.0 70-74 37.044349999999994 38.0 38.0 38.0 36.2 38.0 75-79 36.98825 38.0 38.0 38.0 36.0 38.0 80-84 36.9281 38.0 38.0 38.0 36.0 38.0 85-89 36.86685 38.0 38.0 38.0 35.8 38.0 90-94 36.71659999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.6748 38.0 38.0 38.0 34.4 38.0 100-104 36.532050000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.42484999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.4144 38.0 38.0 38.0 34.0 38.0 115-119 36.21735 38.0 37.8 38.0 33.4 38.0 120-124 36.00625 38.0 37.2 38.0 32.8 38.0 125-129 35.8501 38.0 36.4 38.0 31.6 38.0 130-134 35.6327 38.0 36.0 38.0 31.0 38.0 135-139 35.34740000000001 38.0 36.0 38.0 29.0 38.0 140-144 34.98935 38.0 34.6 38.0 27.0 38.0 145-149 34.44330000000001 38.0 33.0 38.0 24.6 38.0 150-151 31.366875 35.5 27.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 4.0 18 2.0 19 2.0 20 6.0 21 2.0 22 5.0 23 9.0 24 11.0 25 18.0 26 16.0 27 23.0 28 22.0 29 35.0 30 35.0 31 51.0 32 54.0 33 78.0 34 131.0 35 190.0 36 606.0 37 2699.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.325 18.125 15.950000000000001 28.599999999999998 2 25.4 25.424999999999997 31.574999999999996 17.599999999999998 3 19.625 28.999999999999996 31.95 19.425 4 25.05 31.624999999999996 23.25 20.075000000000003 5 24.325 34.675 22.575 18.425 6 20.225 38.65 22.975 18.15 7 19.025 21.525 38.25 21.2 8 21.349999999999998 25.25 27.825 25.575 9 20.3 25.374999999999996 31.424999999999997 22.900000000000002 10-14 23.71 28.73 26.245 21.315 15-19 23.044999999999998 27.725 28.244999999999997 20.985 20-24 23.080000000000002 28.51 27.365000000000002 21.044999999999998 25-29 23.69 28.349999999999998 27.315 20.645 30-34 23.145 28.845 27.205000000000002 20.805 35-39 22.955000000000002 28.76 27.735 20.549999999999997 40-44 22.745 28.325 27.91 21.02 45-49 22.63 28.139999999999997 27.72 21.51 50-54 23.06 27.815 28.315 20.810000000000002 55-59 23.625 27.800000000000004 27.865000000000002 20.71 60-64 23.265 28.215 27.805000000000003 20.715 65-69 23.5 28.325 27.845 20.330000000000002 70-74 23.845 28.26 27.384999999999998 20.51 75-79 23.66 27.894999999999996 27.63 20.815 80-84 23.915 28.13 27.029999999999998 20.925 85-89 24.135 27.339999999999996 27.565 20.96 90-94 23.68 27.889999999999997 28.299999999999997 20.13 95-99 23.65 28.02 27.375 20.955 100-104 23.785 27.55 27.67 20.995 105-109 24.23 28.04 27.115000000000002 20.615 110-114 24.745 27.97 26.695 20.59 115-119 24.58 27.955000000000002 27.084999999999997 20.380000000000003 120-124 24.575 27.91 26.955000000000002 20.560000000000002 125-129 24.38 28.29 27.134999999999998 20.195 130-134 25.2 27.900000000000002 26.915 19.985 135-139 24.82 28.38 27.055 19.744999999999997 140-144 25.86 28.21 26.174999999999997 19.755 145-149 26.155 28.125 26.51 19.21 150-151 26.525 26.887499999999996 27.1625 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 2.0 25 3.5 26 3.0 27 2.5 28 6.0 29 8.0 30 6.5 31 12.0 32 18.0 33 27.0 34 43.0 35 60.0 36 76.0 37 103.5 38 146.0 39 183.0 40 197.5 41 236.5 42 263.5 43 268.5 44 295.0 45 295.0 46 271.5 47 252.5 48 237.5 49 203.0 50 166.0 51 143.5 52 112.5 53 77.0 54 58.5 55 50.0 56 38.5 57 26.0 58 20.5 59 18.5 60 16.0 61 11.5 62 9.5 63 9.0 64 5.0 65 2.0 66 2.0 67 3.0 68 2.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69871955812202 99.275 2 0.25106703489831783 0.5 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.2874999999999996 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.825 0.0 0.0 0.0 0.0 132-133 7.512499999999999 0.0 0.0 0.0 0.0 134-135 8.0875 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATG 10 0.006830828 145.0 145 >>END_MODULE Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722767 spots for SRR7171456.sra Written 722767 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra Read 722763 spots for SRR7171456.sra Written 722763 spots for SRR7171456.sra SRR ids: ['SRR7171456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_si42jyf7 SRR7171456.sra spots: 14455264 blocks: [[1, 722763], [722764, 1445526], [1445527, 2168289], [2168290, 2891052], [2891053, 3613815], [3613816, 4336578], [4336579, 5059341], [5059342, 5782104], [5782105, 6504867], [6504868, 7227630], [7227631, 7950393], [7950394, 8673156], [8673157, 9395919], [9395920, 10118682], [10118683, 10841445], [10841446, 11564208], [11564209, 12286971], [12286972, 13009734], [13009735, 13732497], [13732498, 14455264]] SRR7171456 file size 4876714 SRR7171456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171456 SRR7171456_1.fastq SRR7171456_2.fastq Input file: SRR7171456_1.fastq Paired file: SRR7171456_2.fastq trimmed: SRR7171456-trimmed-pair1.fastq, SRR7171456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:32:42 2025 >> started Thu Feb 13 18:33:07 2025 >> done (24.648s) 14455264 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 779 ( 0.01%) empty read pairs filtered out after trimming by size control 14454452 (99.99%) read pairs available; of these: 2122198 (14.68%) trimmed read pairs available after processing 12332254 (85.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 4 0.00% 37 3 0.00% 38 3 0.00% 39 4 0.00% 40 6 0.00% 41 1 0.00% 42 4 0.00% 43 9 0.00% 44 6 0.00% 45 4 0.00% 46 7 0.00% 47 3 0.00% 48 6 0.00% 49 12 0.00% 50 20 0.00% 51 17 0.00% 52 29 0.00% 53 33 0.00% 54 29 0.00% 55 26 0.00% 56 47 0.00% 57 59 0.00% 58 63 0.00% 59 71 0.00% 60 104 0.00% 61 103 0.00% 62 139 0.00% 63 164 0.00% 64 185 0.00% 65 203 0.00% 66 245 0.00% 67 285 0.00% 68 331 0.00% 69 381 0.00% 70 499 0.00% 71 573 0.00% 72 700 0.00% 73 835 0.01% 74 984 0.01% 75 1061 0.01% 76 1257 0.01% 77 1348 0.01% 78 1596 0.01% 79 1762 0.01% 80 2070 0.01% 81 2426 0.02% 82 2770 0.02% 83 3102 0.02% 84 3540 0.02% 85 3923 0.03% 86 4469 0.03% 87 4687 0.03% 88 5064 0.04% 89 5731 0.04% 90 6119 0.04% 91 6961 0.05% 92 7422 0.05% 93 8486 0.06% 94 9335 0.06% 95 9970 0.07% 96 10595 0.07% 97 11469 0.08% 98 12072 0.08% 99 12785 0.09% 100 13582 0.09% 101 14645 0.10% 102 15847 0.11% 103 16468 0.11% 104 17496 0.12% 105 18696 0.13% 106 19823 0.14% 107 20935 0.14% 108 21347 0.15% 109 22406 0.16% 110 22594 0.16% 111 24198 0.17% 112 24855 0.17% 113 26312 0.18% 114 28008 0.19% 115 29178 0.20% 116 30302 0.21% 117 31058 0.21% 118 32125 0.22% 119 32308 0.22% 120 33254 0.23% 121 34521 0.24% 122 35503 0.25% 123 36781 0.25% 124 38631 0.27% 125 39325 0.27% 126 40266 0.28% 127 41574 0.29% 128 42326 0.29% 129 43023 0.30% 130 43614 0.30% 131 44312 0.31% 132 45871 0.32% 133 47291 0.33% 134 48224 0.33% 135 50099 0.35% 136 50935 0.35% 137 51579 0.36% 138 52796 0.37% 139 53318 0.37% 140 53479 0.37% 141 54188 0.37% 142 54936 0.38% 143 56096 0.39% 144 57895 0.40% 145 58340 0.40% 146 59231 0.41% 147 61033 0.42% 148 60953 0.42% 149 61367 0.42% 150 63015 0.44% 151 12332254 85.32% 14454452 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=30 prefix-density=0.31 prefix-fanout=2.3 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=48.33 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.2 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=33 prefix-density=0.49 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=35.94 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171456 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:34:08 Started mapping on | Feb 13 18:34:08 Finished on | Feb 13 18:37:11 Mapping speed, Million of reads per hour | 284.35 Number of input reads | 14454452 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13328036 Uniquely mapped reads % | 92.21% Average mapped length | 294.08 Number of splices: Total | 12444375 Number of splices: Annotated (sjdb) | 12187584 Number of splices: GT/AG | 12230708 Number of splices: GC/AG | 165860 Number of splices: AT/AC | 10323 Number of splices: Non-canonical | 37484 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358759 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 75709 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.68% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 767657 767657 767657 N_multimapping 358759 358759 358759 N_noFeature 371680 13219418 422737 N_ambiguous 131092 888 72890 UnstrandedReadsAssigned:12825264 PositiveStrandReadsAssigned:107730 NegativeStrandReadsAssigned:12832409 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171456-trimmed-pair1.fastq SRR7171456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,454,452 reads, 12,850,922 reads pseudoaligned [quant] estimated average fragment length: 221.123 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7171456.ke.tsv 34699 SRR7171456.se.tsv 87100 total ==> SRR7171456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.88 1958 89.081 Potri.005G024800.1.v4.1 1035 814.877 396 39.7499 Potri.004G059700.1.v4.1 961 740.899 13 1.43521 Potri.007G009000.2.v4.1 1416 1195.88 0 0 Potri.003G141000.2.v4.1 2943 2722.88 507.234 15.2375 Potri.016G087400.1.v4.1 270 87.4382 541 506.091 Potri.015G069301.1.v4.1 564 346.353 0 0 Potri.010G195200.1.v4.1 1773 1552.88 668 35.1862 Potri.012G127500.1.v4.1 977 756.883 28928 3126.24 ==> SRR7171456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 176 SRR7171456 completed mapping pipeline successfully