Starting /dee2/code/volunteer_pipeline.sh SRR7171457 current disk space = 3115673079808 free memory = 1578221972 SRR7171457 SRAfilesize b55dae58d8a22f6f9393b39633f15b28 SRR7171457.sra SRR7171457.sra file validated SRR7171457 is paired end SRR7171457 is conventional basespace SRR7171457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.82875 32.0 27.0 33.0 18.0 34.0 2 31.45125 33.0 31.0 33.0 27.0 34.0 3 31.24 33.0 31.0 33.0 27.0 33.0 4 31.16675 33.0 31.0 33.0 28.0 33.0 5 32.4125 33.0 33.0 33.0 32.0 34.0 6 36.69325 38.0 37.0 38.0 34.0 38.0 7 37.069 38.0 38.0 38.0 35.0 38.0 8 37.50125 38.0 38.0 38.0 37.0 38.0 9 37.4665 38.0 38.0 38.0 37.0 38.0 10-14 37.5382 38.0 38.0 38.0 37.8 38.0 15-19 37.5104 38.0 38.0 38.0 37.6 38.0 20-24 37.47305 38.0 38.0 38.0 37.6 38.0 25-29 37.40905 38.0 38.0 38.0 37.0 38.0 30-34 37.42555 38.0 38.0 38.0 37.0 38.0 35-39 37.370400000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.36155 38.0 38.0 38.0 37.0 38.0 45-49 37.31145 38.0 38.0 38.0 37.0 38.0 50-54 37.2631 38.0 38.0 38.0 36.8 38.0 55-59 37.20545 38.0 38.0 38.0 36.6 38.0 60-64 37.09439999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.9894 38.0 38.0 38.0 35.8 38.0 70-74 36.990300000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.95165 38.0 38.0 38.0 35.6 38.0 80-84 36.784499999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.612300000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.6047 38.0 38.0 38.0 34.0 38.0 95-99 36.6892 38.0 38.0 38.0 34.4 38.0 100-104 36.439750000000004 38.0 37.8 38.0 33.8 38.0 105-109 36.284749999999995 38.0 37.4 38.0 34.0 38.0 110-114 36.157250000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.860549999999996 38.0 36.6 38.0 31.8 38.0 120-124 35.71365000000001 38.0 36.0 38.0 31.0 38.0 125-129 35.596050000000005 38.0 36.0 38.0 30.2 38.0 130-134 35.658849999999994 38.0 36.0 38.0 31.0 38.0 135-139 35.2905 38.0 35.6 38.0 28.4 38.0 140-144 34.9999 38.0 35.0 38.0 28.0 38.0 145-149 34.6088 38.0 34.8 38.0 25.0 38.0 150-151 32.42475 36.5 29.5 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 5.0 25 13.0 26 14.0 27 18.0 28 26.0 29 40.0 30 44.0 31 52.0 32 93.0 33 115.0 34 150.0 35 326.0 36 718.0 37 2381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.137727622467295 12.54167735316748 9.720441138753527 40.6001538856117 2 21.63786626596544 13.648885549711995 33.88429752066116 30.82895066366141 3 18.025 21.2 25.324999999999996 35.449999999999996 4 21.875 28.025 24.474999999999998 25.624999999999996 5 23.400000000000002 32.324999999999996 23.400000000000002 20.875 6 18.35 36.425000000000004 25.124999999999996 20.1 7 13.675 25.85 42.625 17.849999999999998 8 17.325 25.025 30.599999999999998 27.05 9 16.975 24.224999999999998 34.025 24.775 10-14 19.845 29.110000000000003 27.845 23.200000000000003 15-19 19.384999999999998 28.89 27.665 24.060000000000002 20-24 19.645000000000003 28.084999999999997 27.935 24.335 25-29 20.21 28.16 27.644999999999996 23.985 30-34 20.145 28.144999999999996 27.48 24.23 35-39 19.49 28.444999999999997 28.110000000000003 23.955000000000002 40-44 19.8 28.37 27.860000000000003 23.97 45-49 20.02 28.115000000000002 27.865000000000002 24.0 50-54 19.775000000000002 28.51 28.24 23.474999999999998 55-59 20.015 28.125 28.349999999999998 23.51 60-64 19.715 28.005000000000003 28.435 23.845 65-69 19.84595378613584 28.943683104931477 26.90807242172652 24.302290687206163 70-74 20.076022806842055 28.763629088726617 27.39821946583975 23.76212863859158 75-79 20.005 27.965 27.52 24.51 80-84 19.79 28.4 27.855 23.955000000000002 85-89 20.46 27.88 27.744999999999997 23.915 90-94 20.315 28.655 27.18 23.849999999999998 95-99 20.34 27.77 28.04 23.849999999999998 100-104 20.085 28.689999999999998 27.060000000000002 24.165 105-109 20.44 28.139999999999997 27.805000000000003 23.615 110-114 20.815407703851925 28.254127063531765 27.368684342171086 23.56178089044522 115-119 20.58337919647771 28.298393956071443 27.047580927602944 24.0706459198479 120-124 20.344068813762753 28.430686137227447 27.150430086017202 24.0748149629926 125-129 20.974999999999998 28.925 26.765 23.335 130-134 21.425 28.449999999999996 26.284999999999997 23.84 135-139 20.995 28.235 26.655 24.115000000000002 140-144 20.785 27.839999999999996 27.115000000000002 24.26 145-149 21.555 28.249999999999996 26.655 23.54 150-151 21.099999999999998 27.900000000000002 26.275 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 2.5 24 3.5 25 3.5 26 4.5 27 4.0 28 7.5 29 11.5 30 11.0 31 16.5 32 27.5 33 34.5 34 43.5 35 57.5 36 89.5 37 118.0 38 128.0 39 159.0 40 191.5 41 219.0 42 252.5 43 281.0 44 295.0 45 286.5 46 272.0 47 261.0 48 234.5 49 201.0 50 163.0 51 128.0 52 114.5 53 95.5 54 73.5 55 55.5 56 40.0 57 29.0 58 19.0 59 12.0 60 13.0 61 11.5 62 8.0 63 7.0 64 3.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.03 70-74 0.03 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.065 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.5125 0.0 0.0 0.0 0.0 126-127 6.1125 0.0 0.0 0.0 0.0 128-129 6.762499999999999 0.0 0.0 0.0 0.0 130-131 7.2625 0.0 0.0 0.0 0.0 132-133 7.775 0.0 0.0 0.0 0.0 134-135 8.475 0.0 0.0 0.0 0.0 136-137 9.1 0.0 0.0 0.0 0.0 138-139 9.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62725 33.0 33.0 34.0 32.0 34.0 2 32.75675 34.0 33.0 34.0 32.0 34.0 3 32.835 34.0 33.0 34.0 32.0 34.0 4 32.812 34.0 33.0 34.0 32.0 34.0 5 32.90675 34.0 33.0 34.0 32.0 34.0 6 37.027 38.0 38.0 38.0 36.0 38.0 7 36.95625 38.0 38.0 38.0 36.0 38.0 8 36.9565 38.0 38.0 38.0 36.0 38.0 9 36.986 38.0 38.0 38.0 36.0 38.0 10-14 36.8055 38.0 38.0 38.0 35.6 38.0 15-19 36.77755 38.0 38.0 38.0 35.4 38.0 20-24 36.76075 38.0 38.0 38.0 35.4 38.0 25-29 36.7349 38.0 38.0 38.0 35.2 38.0 30-34 36.796299999999995 38.0 38.0 38.0 35.6 38.0 35-39 36.7895 38.0 38.0 38.0 35.4 38.0 40-44 36.81855 38.0 38.0 38.0 35.6 38.0 45-49 36.85265 38.0 38.0 38.0 35.8 38.0 50-54 36.7957 38.0 38.0 38.0 35.4 38.0 55-59 36.6549 38.0 38.0 38.0 34.8 38.0 60-64 36.5082 38.0 38.0 38.0 34.2 38.0 65-69 36.4678 38.0 38.0 38.0 34.0 38.0 70-74 36.42385 38.0 38.0 38.0 34.0 38.0 75-79 36.4467 38.0 38.0 38.0 34.0 38.0 80-84 36.4508 38.0 38.0 38.0 34.0 38.0 85-89 36.27475 38.0 38.0 38.0 33.4 38.0 90-94 36.00125 38.0 37.6 38.0 32.2 38.0 95-99 36.021049999999995 38.0 37.4 38.0 32.2 38.0 100-104 35.818650000000005 38.0 37.0 38.0 31.4 38.0 105-109 35.58245 38.0 37.0 38.0 29.8 38.0 110-114 35.412 38.0 36.6 38.0 29.0 38.0 115-119 35.4562 38.0 36.2 38.0 29.4 38.0 120-124 35.0567 38.0 35.6 38.0 27.0 38.0 125-129 35.043 38.0 35.8 38.0 26.8 38.0 130-134 34.78145000000001 38.0 35.0 38.0 24.8 38.0 135-139 34.0167 38.0 34.0 38.0 21.0 38.0 140-144 33.5597 38.0 33.4 38.0 21.0 38.0 145-149 33.531 38.0 33.4 38.0 19.8 38.0 150-151 30.88675 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 10.0 18 12.0 19 7.0 20 3.0 21 17.0 22 10.0 23 13.0 24 16.0 25 26.0 26 35.0 27 30.0 28 44.0 29 47.0 30 49.0 31 78.0 32 101.0 33 138.0 34 193.0 35 298.0 36 622.0 37 2246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.74115876598947 21.494858289440682 14.622523200401305 28.141459744168547 2 26.1 25.174999999999997 31.175000000000004 17.549999999999997 3 20.375 27.150000000000002 31.8 20.674999999999997 4 23.2982982982983 32.58258258258258 23.8988988988989 20.22022022022022 5 22.992244183137352 37.3530147610708 21.891418563922944 17.7633224918689 6 19.35 38.35 24.25 18.05 7 20.225 21.25 38.574999999999996 19.950000000000003 8 20.5 25.025 27.375 27.1 9 21.26594946209657 25.293970477858394 30.34776082061546 23.092319239429575 10-14 23.194715508181954 28.414152029224844 26.63764199569634 21.753490466896864 15-19 23.225903312981682 28.08027224502052 27.93013712341107 20.76368731858673 20-24 23.171951585475643 27.673301990597178 27.928378513554065 21.226367910373114 25-29 22.855 28.560000000000002 27.98 20.605 30-34 23.549999999999997 28.044999999999998 27.450000000000003 20.955 35-39 23.52 28.389999999999997 27.075 21.015 40-44 23.669999999999998 28.13 27.655 20.544999999999998 45-49 23.065766441610403 28.207051762940733 27.851962990747687 20.875218804701177 50-54 23.635362985940862 28.038224846149994 27.813078501025668 20.513333666883472 55-59 23.9401371440012 27.95935732519145 27.784173382051154 20.316332148756196 60-64 23.363363363363362 28.053053053053052 27.8978978978979 20.685685685685687 65-69 23.85954381752701 28.281312525010005 27.275910364145656 20.583233293317328 70-74 23.61 27.944999999999997 27.315 21.13 75-79 23.945 28.155 27.6 20.3 80-84 24.385 27.634999999999998 27.66 20.32 85-89 23.855 27.72 28.04 20.385 90-94 24.028409943480217 28.655029260241083 27.419596858900615 19.896963937378082 95-99 23.79522594205074 27.688535254966723 28.173947855677326 20.34229094730521 100-104 24.221331997996995 27.97696544817226 27.511266900350527 20.29043565348022 105-109 24.02603905858788 28.41762643965949 27.491236855282924 20.065097646469702 110-114 24.09578198577297 27.707644524596738 27.552349463981564 20.644224025648732 115-119 24.87482475465652 28.029240937312238 27.02783897456439 20.068095333466854 120-124 25.3891196636805 27.871477904008806 27.29092638006106 19.448476052249635 125-129 25.44 27.96 27.065 19.535 130-134 25.430000000000003 27.91 27.165 19.495 135-139 25.386578591803033 27.823650102587198 27.338237501876595 19.451533803733174 140-144 26.14290721546242 27.795303189624953 27.079264934154523 18.9825246607581 145-149 26.7408075343152 27.637511271415686 26.891093076846005 18.730588117423103 150-151 26.804511278195488 28.157894736842103 26.44110275689223 18.596491228070175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 0.0 25 1.5 26 2.0 27 3.0 28 5.5 29 6.0 30 8.0 31 16.0 32 22.5 33 24.5 34 38.5 35 63.0 36 88.0 37 113.5 38 136.5 39 159.5 40 200.5 41 243.0 42 251.0 43 250.5 44 278.0 45 291.0 46 289.5 47 276.0 48 242.5 49 214.5 50 175.0 51 135.0 52 118.0 53 98.0 54 61.0 55 40.0 56 32.0 57 30.5 58 24.0 59 13.0 60 8.5 61 7.5 62 8.5 63 4.5 64 2.5 65 1.5 66 1.0 67 2.5 68 2.0 69 1.5 70 1.0 71 1.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.075 10-14 0.08499999999999999 15-19 0.09 20-24 0.03 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.065 55-59 0.105 60-64 0.1 65-69 0.04 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.034999999999999996 95-99 0.08499999999999999 100-104 0.15 105-109 0.15 110-114 0.19 115-119 0.13999999999999999 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.08499999999999999 140-144 0.145 145-149 0.19 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 3.0875000000000004 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.6375 0.0 0.0 0.0 0.0 122-123 5.0125 0.0 0.0 0.0 0.0 124-125 5.574999999999999 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.825 0.0 0.0 0.0 0.0 130-131 7.3375 0.0 0.0 0.0 0.0 132-133 7.85 0.0 0.0 0.0 0.0 134-135 8.55 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATATT 10 0.006830828 145.0 6 >>END_MODULE Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884506 spots for SRR7171457.sra Written 884506 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra Read 884487 spots for SRR7171457.sra Written 884487 spots for SRR7171457.sra SRR ids: ['SRR7171457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z1pu23e6 SRR7171457.sra spots: 17689759 blocks: [[1, 884487], [884488, 1768974], [1768975, 2653461], [2653462, 3537948], [3537949, 4422435], [4422436, 5306922], [5306923, 6191409], [6191410, 7075896], [7075897, 7960383], [7960384, 8844870], [8844871, 9729357], [9729358, 10613844], [10613845, 11498331], [11498332, 12382818], [12382819, 13267305], [13267306, 14151792], [14151793, 15036279], [15036280, 15920766], [15920767, 16805253], [16805254, 17689759]] SRR7171457 file size 5972778 SRR7171457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171457 SRR7171457_1.fastq SRR7171457_2.fastq Input file: SRR7171457_1.fastq Paired file: SRR7171457_2.fastq trimmed: SRR7171457-trimmed-pair1.fastq, SRR7171457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:24:20 2025 >> started Fri Feb 14 10:24:50 2025 >> done (29.863s) 17689759 read pairs processed; of these: 164 ( 0.00%) short read pairs filtered out after trimming by size control 774 ( 0.00%) empty read pairs filtered out after trimming by size control 17688821 (99.99%) read pairs available; of these: 2676599 (15.13%) trimmed read pairs available after processing 15012222 (84.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 3 0.00% 33 2 0.00% 34 1 0.00% 35 3 0.00% 36 9 0.00% 37 3 0.00% 38 3 0.00% 39 7 0.00% 40 6 0.00% 41 10 0.00% 42 7 0.00% 43 7 0.00% 44 8 0.00% 45 17 0.00% 46 12 0.00% 47 22 0.00% 48 19 0.00% 49 15 0.00% 50 24 0.00% 51 31 0.00% 52 41 0.00% 53 46 0.00% 54 46 0.00% 55 53 0.00% 56 56 0.00% 57 72 0.00% 58 75 0.00% 59 77 0.00% 60 97 0.00% 61 127 0.00% 62 147 0.00% 63 187 0.00% 64 195 0.00% 65 229 0.00% 66 275 0.00% 67 338 0.00% 68 409 0.00% 69 506 0.00% 70 546 0.00% 71 710 0.00% 72 746 0.00% 73 991 0.01% 74 1117 0.01% 75 1195 0.01% 76 1450 0.01% 77 1616 0.01% 78 1820 0.01% 79 2015 0.01% 80 2379 0.01% 81 2744 0.02% 82 3173 0.02% 83 3647 0.02% 84 3999 0.02% 85 4596 0.03% 86 5111 0.03% 87 5573 0.03% 88 6190 0.03% 89 6701 0.04% 90 7500 0.04% 91 8290 0.05% 92 9296 0.05% 93 10323 0.06% 94 11404 0.06% 95 12414 0.07% 96 13016 0.07% 97 14174 0.08% 98 14716 0.08% 99 15708 0.09% 100 16913 0.10% 101 18052 0.10% 102 19475 0.11% 103 20922 0.12% 104 22356 0.13% 105 23403 0.13% 106 25093 0.14% 107 25841 0.15% 108 26776 0.15% 109 27939 0.16% 110 28959 0.16% 111 30280 0.17% 112 32009 0.18% 113 33820 0.19% 114 35601 0.20% 115 37532 0.21% 116 38733 0.22% 117 40638 0.23% 118 44001 0.25% 119 42197 0.24% 120 42605 0.24% 121 43892 0.25% 122 45061 0.25% 123 47048 0.27% 124 48997 0.28% 125 49859 0.28% 126 51527 0.29% 127 52897 0.30% 128 53392 0.30% 129 53879 0.30% 130 54660 0.31% 131 56130 0.32% 132 58156 0.33% 133 59601 0.34% 134 60977 0.34% 135 61877 0.35% 136 63304 0.36% 137 64128 0.36% 138 65029 0.37% 139 65948 0.37% 140 66346 0.38% 141 67885 0.38% 142 74082 0.42% 143 72154 0.41% 144 73023 0.41% 145 75448 0.43% 146 72333 0.41% 147 77572 0.44% 148 74941 0.42% 149 75938 0.43% 150 81006 0.46% 151 15012222 84.87% 17688821 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=32 prefix-density=0.15 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=390.68 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=31.0 sequence=TTCTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.86 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=4.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=273.50 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.6 sequence=GAAGAAGAAGAAA SRR7171457 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:26:13 Started mapping on | Feb 14 10:26:14 Finished on | Feb 14 10:28:16 Mapping speed, Million of reads per hour | 521.97 Number of input reads | 17688821 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16518728 Uniquely mapped reads % | 93.39% Average mapped length | 293.83 Number of splices: Total | 16560313 Number of splices: Annotated (sjdb) | 16287260 Number of splices: GT/AG | 16296084 Number of splices: GC/AG | 210860 Number of splices: AT/AC | 11046 Number of splices: Non-canonical | 42323 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468904 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 219242 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 701189 701189 701189 N_multimapping 468904 468904 468904 N_noFeature 365577 16367077 438044 N_ambiguous 156908 1075 76900 UnstrandedReadsAssigned:15996243 PositiveStrandReadsAssigned:150576 NegativeStrandReadsAssigned:16003784 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171457-trimmed-pair1.fastq SRR7171457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,688,821 reads, 16,177,585 reads pseudoaligned [quant] estimated average fragment length: 224.345 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7171457.ke.tsv 34699 SRR7171457.se.tsv 87100 total ==> SRR7171457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.65 954 31.8573 Potri.005G024800.1.v4.1 1035 811.655 162 11.9615 Potri.004G059700.1.v4.1 961 737.655 39 3.1685 Potri.007G009000.2.v4.1 1416 1192.65 0 0 Potri.003G141000.2.v4.1 2943 2719.65 465.224 10.2516 Potri.016G087400.1.v4.1 270 88.8796 1400 943.991 Potri.015G069301.1.v4.1 564 343.493 0 0 Potri.010G195200.1.v4.1 1773 1549.65 283 10.9444 Potri.012G127500.1.v4.1 977 753.655 3195 254.062 ==> SRR7171457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 126 SRR7171457 completed mapping pipeline successfully