Starting /dee2/code/volunteer_pipeline.sh SRR7171458 current disk space = 3114946359296 free memory = 1567505800 SRR7171458 SRAfilesize a5c32fdb39d1fecf7ce4a98af8afa82d SRR7171458.sra SRR7171458.sra file validated SRR7171458 is paired end SRR7171458 is conventional basespace SRR7171458 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06975 34.0 33.0 34.0 32.0 34.0 2 33.27025 34.0 33.0 34.0 32.0 34.0 3 33.132 34.0 33.0 34.0 32.0 34.0 4 33.313 34.0 33.0 34.0 33.0 34.0 5 33.351 34.0 33.0 34.0 33.0 34.0 6 36.9225 38.0 37.0 38.0 35.0 38.0 7 37.40525 38.0 38.0 38.0 37.0 38.0 8 37.49025 38.0 38.0 38.0 37.0 38.0 9 37.5965 38.0 38.0 38.0 38.0 38.0 10-14 37.549699999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.48245 38.0 38.0 38.0 37.2 38.0 20-24 37.489000000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.435 38.0 38.0 38.0 37.2 38.0 30-34 37.40315 38.0 38.0 38.0 37.4 38.0 35-39 37.404399999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.433800000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.45205 38.0 38.0 38.0 37.0 38.0 50-54 37.34605 38.0 38.0 38.0 37.0 38.0 55-59 37.309149999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.29135 38.0 38.0 38.0 37.0 38.0 65-69 37.3181 38.0 38.0 38.0 37.0 38.0 70-74 37.15495 38.0 38.0 38.0 36.2 38.0 75-79 37.14665 38.0 38.0 38.0 36.0 38.0 80-84 37.0674 38.0 38.0 38.0 36.0 38.0 85-89 37.01055 38.0 38.0 38.0 36.0 38.0 90-94 36.962650000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.7493 38.0 38.0 38.0 34.8 38.0 100-104 36.5827 38.0 38.0 38.0 34.0 38.0 105-109 36.63275 38.0 38.0 38.0 34.2 38.0 110-114 36.4831 38.0 38.0 38.0 34.0 38.0 115-119 36.61915 38.0 38.0 38.0 34.2 38.0 120-124 36.4772 38.0 38.0 38.0 34.0 38.0 125-129 36.399750000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.153800000000004 38.0 37.6 38.0 33.4 38.0 135-139 35.913799999999995 38.0 36.4 38.0 32.4 38.0 140-144 35.80225 38.0 36.0 38.0 31.6 38.0 145-149 35.62355 38.0 36.0 38.0 31.0 38.0 150-151 33.488625 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 3.0 23 2.0 24 7.0 25 6.0 26 8.0 27 16.0 28 22.0 29 22.0 30 38.0 31 49.0 32 56.0 33 89.0 34 105.0 35 214.0 36 494.0 37 2867.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.59577677224736 9.82905982905983 11.664152840623428 42.91101055806938 2 21.625 13.725000000000001 36.0 28.65 3 21.025 18.525 25.2 35.25 4 23.925 25.6 22.125 28.349999999999998 5 22.05 33.475 23.525 20.95 6 19.375 34.150000000000006 25.775 20.7 7 14.825 26.125 41.775 17.275 8 17.875 25.424999999999997 31.275 25.424999999999997 9 16.85 23.925 35.5 23.724999999999998 10-14 19.465 29.520000000000003 27.415 23.599999999999998 15-19 19.645000000000003 28.439999999999998 27.32 24.595 20-24 19.895 27.92 28.244999999999997 23.94 25-29 19.976997699769978 28.14281428142814 27.84278427842784 24.03740374037404 30-34 19.854963740935233 28.092023005751436 27.9869967491873 24.066016504126033 35-39 20.365091272818205 28.02700675168792 27.786946736684172 23.820955238809702 40-44 20.116034810443136 28.223467040112034 28.16845053516055 23.492047614284285 45-49 20.095023755938985 27.551887971993 27.916979244811202 24.436109027256812 50-54 20.251012550627532 28.32141607080354 27.60638031901595 23.821191059552977 55-59 19.845 28.945 27.800000000000004 23.41 60-64 20.25 27.985 27.200000000000003 24.565 65-69 20.385 28.21 27.615000000000002 23.79 70-74 20.185 28.395 27.26 24.16 75-79 20.845 28.249999999999996 27.08 23.825 80-84 20.565 27.54 27.815 24.08 85-89 20.560000000000002 27.36 28.050000000000004 24.03 90-94 21.005 27.700000000000003 27.49 23.805 95-99 20.275000000000002 27.73 27.48 24.515 100-104 20.93 28.110000000000003 27.295 23.665 105-109 20.95 27.47 27.700000000000003 23.880000000000003 110-114 20.895 28.255000000000003 27.315 23.535 115-119 20.974999999999998 27.884999999999998 27.250000000000004 23.89 120-124 21.105 28.29 26.445 24.16 125-129 20.849999999999998 28.275 26.669999999999998 24.205 130-134 21.279999999999998 27.625 26.87 24.224999999999998 135-139 20.919999999999998 28.105000000000004 26.805 24.169999999999998 140-144 20.8 27.73 26.939999999999998 24.529999999999998 145-149 21.224999999999998 27.83 26.340000000000003 24.605 150-151 20.837500000000002 28.125 26.487500000000004 24.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 1.5 25 1.0 26 5.0 27 6.5 28 9.0 29 11.5 30 16.0 31 17.5 32 24.0 33 30.0 34 37.5 35 58.5 36 79.0 37 101.5 38 111.0 39 138.5 40 192.5 41 221.0 42 235.0 43 253.5 44 269.5 45 282.0 46 273.5 47 263.0 48 257.0 49 220.5 50 172.0 51 147.5 52 125.0 53 99.5 54 80.0 55 60.0 56 52.0 57 40.5 58 24.0 59 16.5 60 13.0 61 12.0 62 9.5 63 6.5 64 4.5 65 1.5 66 1.0 67 3.5 68 3.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.025 35-39 0.025 40-44 0.03 45-49 0.025 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.5374999999999996 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.3 0.0 0.0 0.0 0.0 126-127 5.9875 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 7.1125 0.0 0.0 0.0 0.0 132-133 7.6625 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAGTG 10 0.0068343505 144.975 6 TCAACAC 10 0.0068343505 144.975 8 >>END_MODULE SRR7171458 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66775 33.0 33.0 34.0 32.0 34.0 2 32.68525 34.0 33.0 34.0 32.0 34.0 3 32.7025 34.0 33.0 34.0 32.0 34.0 4 32.558 34.0 33.0 34.0 32.0 34.0 5 32.57625 34.0 33.0 34.0 32.0 34.0 6 36.6105 38.0 38.0 38.0 35.0 38.0 7 36.61975 38.0 38.0 38.0 35.0 38.0 8 36.58025 38.0 38.0 38.0 35.0 38.0 9 36.75375 38.0 38.0 38.0 35.0 38.0 10-14 36.71435 38.0 38.0 38.0 35.4 38.0 15-19 36.971349999999994 38.0 38.0 38.0 36.2 38.0 20-24 36.99679999999999 38.0 38.0 38.0 36.2 38.0 25-29 37.0705 38.0 38.0 38.0 37.0 38.0 30-34 37.06935 38.0 38.0 38.0 37.0 38.0 35-39 37.03705 38.0 38.0 38.0 36.4 38.0 40-44 36.9863 38.0 38.0 38.0 36.2 38.0 45-49 37.0068 38.0 38.0 38.0 36.2 38.0 50-54 36.888000000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.8809 38.0 38.0 38.0 36.0 38.0 60-64 36.8605 38.0 38.0 38.0 36.0 38.0 65-69 36.932500000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.91245 38.0 38.0 38.0 36.0 38.0 75-79 36.9134 38.0 38.0 38.0 36.0 38.0 80-84 36.896100000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.82125 38.0 38.0 38.0 35.2 38.0 90-94 36.6998 38.0 38.0 38.0 35.0 38.0 95-99 36.540800000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.40925 38.0 38.0 38.0 34.0 38.0 105-109 36.29545 38.0 38.0 38.0 34.0 38.0 110-114 36.2573 38.0 38.0 38.0 34.0 38.0 115-119 36.03765 38.0 37.8 38.0 32.6 38.0 120-124 35.98285 38.0 37.4 38.0 32.4 38.0 125-129 35.9379 38.0 37.0 38.0 32.6 38.0 130-134 35.7606 38.0 36.6 38.0 31.8 38.0 135-139 35.4542 38.0 36.0 38.0 30.6 38.0 140-144 35.1625 38.0 35.6 38.0 28.6 38.0 145-149 34.7787 38.0 35.0 38.0 25.4 38.0 150-151 32.3005 35.5 28.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 3.0 18 7.0 19 6.0 20 10.0 21 10.0 22 5.0 23 8.0 24 11.0 25 12.0 26 13.0 27 16.0 28 38.0 29 39.0 30 50.0 31 50.0 32 81.0 33 89.0 34 129.0 35 218.0 36 487.0 37 2709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.44272136068034 18.33416708354177 16.683341670835418 29.539769884942473 2 26.533166458072593 24.90613266583229 31.939924906132667 16.62077596996245 3 20.125156445556946 28.085106382978726 31.11389236545682 20.67584480600751 4 24.20525657071339 32.64080100125156 23.52941176470588 19.62453066332916 5 24.461692538808215 35.60340510766149 21.28192288432649 18.652979469203807 6 21.09746930593836 37.3089451265347 23.92883988975194 17.66474567777499 7 20.485850237916353 20.135236664162285 38.76784372652141 20.61106937139995 8 21.93839218632607 25.39444027047333 26.82193839218633 25.845229151014276 9 21.442885771543086 25.851703406813627 29.43386773547094 23.271543086172343 10-14 23.59043752819125 28.953039643161425 25.755525484889493 21.70099734375783 15-19 23.31980153360397 27.990778329073322 26.93329323911191 21.756126898210795 20-24 23.369592460774978 28.322221665246378 27.19935836382776 21.108827510150885 25-29 23.353203426338727 28.222211090517458 26.774532885838802 21.650052597305013 30-34 23.451969765230015 28.457726385343147 27.311408119337237 20.7788957300896 35-39 22.682475361448798 28.145480014007706 27.640202111161138 21.531842513382358 40-44 23.46136511592969 28.05849066052381 27.437528168661423 21.042616054885073 45-49 23.13548710242925 27.30778863010268 28.054094665664913 21.502629601803154 50-54 23.09465350503583 28.376008418098913 27.368843012476823 21.160495064388435 55-59 23.199157852523935 28.27710662188581 27.54022758032984 20.983507945260413 60-64 23.50553690434434 27.75968331913614 27.714586360675455 21.020193415844066 65-69 23.627529553195753 27.930274494089364 27.57463434181527 20.867561610899617 70-74 23.830980274356666 28.52207870231301 27.20036046860919 20.446580554721137 75-79 23.390847711927982 28.02700675168792 27.54688672168042 21.035258814703674 80-84 23.532059617885366 27.71331399419826 27.283184955486643 21.471441432429728 85-89 23.54472195805596 27.85925221482557 27.85424695930727 20.741778867811203 90-94 23.573896929934392 28.121400310512346 27.555466519757598 20.749236239795664 95-99 23.849854665731183 28.57071263906986 27.302796431793126 20.276636263405834 100-104 24.475770041135746 28.05759004715561 27.169659877596068 20.296980034112572 105-109 24.731614327280024 27.60108357580014 27.32015651650446 20.347145580415372 110-114 24.50822962665596 28.166399036531516 26.96206342834203 20.363307908470492 115-119 24.41813804173355 27.99959871589085 27.09169341894061 20.490569823434992 120-124 24.644217278011627 28.111846061334937 26.949288434556024 20.294648226097415 125-129 24.94742113169755 27.846770155232846 27.300951427140713 19.90485728592889 130-134 24.979971960745043 27.788904466252756 27.17804926897657 20.053074304025635 135-139 25.956722099779604 27.935283510318577 26.813263874974957 19.29473051492687 140-144 25.56051562421628 28.228921101469627 26.58875457691729 19.6218086973968 145-149 25.896934116112195 27.723418134377038 26.609463595764964 19.7701841537458 150-151 26.555444054189664 27.99799297541395 26.455092824887107 18.991470145509282 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.0 24 0.5 25 1.0 26 0.5 27 1.5 28 4.5 29 7.0 30 8.5 31 11.0 32 17.0 33 24.0 34 32.5 35 47.0 36 75.0 37 108.5 38 123.5 39 143.0 40 186.0 41 232.0 42 276.5 43 292.5 44 285.5 45 293.5 46 286.0 47 255.0 48 224.5 49 201.0 50 183.0 51 157.5 52 130.0 53 101.0 54 71.0 55 52.5 56 40.0 57 28.0 58 22.0 59 15.5 60 9.5 61 9.0 62 7.5 63 5.0 64 4.0 65 2.5 66 2.5 67 3.0 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.125 3 0.125 4 0.125 5 0.15 6 0.22499999999999998 7 0.17500000000000002 8 0.17500000000000002 9 0.2 10-14 0.23500000000000001 15-19 0.23500000000000001 20-24 0.255 25-29 0.185 30-34 0.11499999999999999 35-39 0.055 40-44 0.155 45-49 0.17500000000000002 50-54 0.215 55-59 0.255 60-64 0.215 65-69 0.18 70-74 0.13 75-79 0.025 80-84 0.03 85-89 0.105 90-94 0.165 95-99 0.22999999999999998 100-104 0.33 105-109 0.33 110-114 0.36 115-119 0.32 120-124 0.22 125-129 0.15 130-134 0.13999999999999999 135-139 0.18 140-144 0.315 145-149 0.35500000000000004 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.7625 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 6.0125 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.6625 0.0 0.0 0.0 0.0 134-135 8.225 0.0 0.0 0.0 0.0 136-137 8.7125 0.0 0.0 0.0 0.0 138-139 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102843 spots for SRR7171458.sra Written 1102843 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra Read 1102829 spots for SRR7171458.sra Written 1102829 spots for SRR7171458.sra SRR ids: ['SRR7171458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bzovpm_ SRR7171458.sra spots: 22056594 blocks: [[1, 1102829], [1102830, 2205658], [2205659, 3308487], [3308488, 4411316], [4411317, 5514145], [5514146, 6616974], [6616975, 7719803], [7719804, 8822632], [8822633, 9925461], [9925462, 11028290], [11028291, 12131119], [12131120, 13233948], [13233949, 14336777], [14336778, 15439606], [15439607, 16542435], [16542436, 17645264], [17645265, 18748093], [18748094, 19850922], [19850923, 20953751], [20953752, 22056594]] SRR7171458 file size 7452555 SRR7171458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171458 SRR7171458_1.fastq SRR7171458_2.fastq Input file: SRR7171458_1.fastq Paired file: SRR7171458_2.fastq trimmed: SRR7171458-trimmed-pair1.fastq, SRR7171458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:58:01 2025 >> started Fri Feb 14 10:58:25 2025 >> done (23.922s) 22056594 read pairs processed; of these: 1133 ( 0.01%) short read pairs filtered out after trimming by size control 1859 ( 0.01%) empty read pairs filtered out after trimming by size control 22053602 (99.99%) read pairs available; of these: 3146923 (14.27%) trimmed read pairs available after processing 18906679 (85.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 5 0.00% 34 2 0.00% 35 2 0.00% 36 1 0.00% 37 4 0.00% 38 4 0.00% 39 3 0.00% 40 7 0.00% 41 9 0.00% 42 7 0.00% 43 7 0.00% 44 17 0.00% 45 14 0.00% 46 9 0.00% 47 13 0.00% 48 18 0.00% 49 18 0.00% 50 29 0.00% 51 43 0.00% 52 51 0.00% 53 35 0.00% 54 40 0.00% 55 57 0.00% 56 67 0.00% 57 81 0.00% 58 89 0.00% 59 111 0.00% 60 143 0.00% 61 153 0.00% 62 218 0.00% 63 203 0.00% 64 290 0.00% 65 294 0.00% 66 364 0.00% 67 380 0.00% 68 420 0.00% 69 522 0.00% 70 645 0.00% 71 732 0.00% 72 905 0.00% 73 1048 0.00% 74 1118 0.01% 75 1272 0.01% 76 1482 0.01% 77 1656 0.01% 78 1885 0.01% 79 2151 0.01% 80 2416 0.01% 81 2842 0.01% 82 3243 0.01% 83 3771 0.02% 84 4233 0.02% 85 4871 0.02% 86 5118 0.02% 87 5780 0.03% 88 6407 0.03% 89 6934 0.03% 90 7967 0.04% 91 8625 0.04% 92 9644 0.04% 93 10994 0.05% 94 11847 0.05% 95 13112 0.06% 96 14222 0.06% 97 14995 0.07% 98 16008 0.07% 99 17372 0.08% 100 18630 0.08% 101 19705 0.09% 102 21604 0.10% 103 23195 0.11% 104 24873 0.11% 105 26214 0.12% 106 27865 0.13% 107 28933 0.13% 108 30059 0.14% 109 31788 0.14% 110 32817 0.15% 111 34216 0.16% 112 36295 0.16% 113 38180 0.17% 114 40581 0.18% 115 43042 0.20% 116 45835 0.21% 117 49528 0.22% 118 51064 0.23% 119 48586 0.22% 120 49076 0.22% 121 50472 0.23% 122 52264 0.24% 123 54629 0.25% 124 56404 0.26% 125 58360 0.26% 126 60268 0.27% 127 61933 0.28% 128 62744 0.28% 129 64657 0.29% 130 65093 0.30% 131 66504 0.30% 132 68161 0.31% 133 69774 0.32% 134 71382 0.32% 135 74222 0.34% 136 75890 0.34% 137 76877 0.35% 138 78228 0.35% 139 80097 0.36% 140 80266 0.36% 141 86085 0.39% 142 89709 0.41% 143 85527 0.39% 144 88953 0.40% 145 94812 0.43% 146 88505 0.40% 147 94295 0.43% 148 92118 0.42% 149 93232 0.42% 150 96324 0.44% 151 18906679 85.73% 22053602 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.81 fanout-score-rank=18 prefix-density=0.25 prefix-fanout=4.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=141.39 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=21.7 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.75 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=3.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=46.70 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.7 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171458 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:59:46 Started mapping on | Feb 14 10:59:46 Finished on | Feb 14 11:02:30 Mapping speed, Million of reads per hour | 484.10 Number of input reads | 22053602 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20445272 Uniquely mapped reads % | 92.71% Average mapped length | 294.30 Number of splices: Total | 20206160 Number of splices: Annotated (sjdb) | 19851149 Number of splices: GT/AG | 19885763 Number of splices: GC/AG | 255456 Number of splices: AT/AC | 14174 Number of splices: Non-canonical | 50767 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575504 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 213428 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1032829 1032829 1032829 N_multimapping 575504 575504 575504 N_noFeature 470526 20273045 546229 N_ambiguous 192698 1222 95470 UnstrandedReadsAssigned:19782048 PositiveStrandReadsAssigned:171005 NegativeStrandReadsAssigned:19803573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171458-trimmed-pair1.fastq SRR7171458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,053,602 reads, 19,963,073 reads pseudoaligned [quant] estimated average fragment length: 224.282 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR7171458.ke.tsv 34699 SRR7171458.se.tsv 87100 total ==> SRR7171458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.72 1039 29.1595 Potri.005G024800.1.v4.1 1035 811.718 273 16.9402 Potri.004G059700.1.v4.1 961 737.724 41 2.79931 Potri.007G009000.2.v4.1 1416 1192.72 0 0 Potri.003G141000.2.v4.1 2943 2719.72 711 13.1676 Potri.016G087400.1.v4.1 270 86.9163 1390.56 805.838 Potri.015G069301.1.v4.1 564 343.38 0 0 Potri.010G195200.1.v4.1 1773 1549.72 151 4.90778 Potri.012G127500.1.v4.1 977 753.718 2971 198.543 ==> SRR7171458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 549 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 136 SRR7171458 completed mapping pipeline successfully