Starting /dee2/code/volunteer_pipeline.sh SRR7171459 current disk space = 3116881162240 free memory = 1282643932 SRR7171459 SRAfilesize 9f98e9e8938fd60a39755120a935ba9a SRR7171459.sra SRR7171459.sra file validated SRR7171459 is paired end SRR7171459 is conventional basespace SRR7171459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85275 33.0 33.0 34.0 32.0 34.0 2 33.133 34.0 33.0 34.0 31.0 34.0 3 32.97675 33.0 33.0 34.0 32.0 34.0 4 32.72275 33.0 33.0 34.0 32.0 34.0 5 33.0755 33.0 33.0 34.0 32.0 34.0 6 36.58975 38.0 37.0 38.0 34.0 38.0 7 37.30875 38.0 38.0 38.0 37.0 38.0 8 37.48825 38.0 38.0 38.0 37.0 38.0 9 37.57325 38.0 38.0 38.0 38.0 38.0 10-14 37.4873 38.0 38.0 38.0 37.6 38.0 15-19 37.39825 38.0 38.0 38.0 37.2 38.0 20-24 37.52275 38.0 38.0 38.0 38.0 38.0 25-29 37.54425 38.0 38.0 38.0 38.0 38.0 30-34 37.551050000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.48205 38.0 38.0 38.0 38.0 38.0 40-44 37.438750000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.3359 38.0 38.0 38.0 37.0 38.0 50-54 37.214800000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.23655000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.3004 38.0 38.0 38.0 37.0 38.0 65-69 37.33825 38.0 38.0 38.0 37.0 38.0 70-74 37.25285 38.0 38.0 38.0 36.8 38.0 75-79 37.205149999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.20175 38.0 38.0 38.0 36.0 38.0 85-89 37.03055 38.0 38.0 38.0 35.8 38.0 90-94 36.9345 38.0 38.0 38.0 35.6 38.0 95-99 36.897099999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.864599999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.678399999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.6081 38.0 38.0 38.0 34.2 38.0 115-119 36.471199999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.40525 38.0 37.8 38.0 33.8 38.0 125-129 36.36495 38.0 37.8 38.0 33.8 38.0 130-134 36.06545 38.0 37.2 38.0 32.8 38.0 135-139 35.92785 38.0 36.2 38.0 32.2 38.0 140-144 35.592400000000005 38.0 36.0 38.0 31.0 38.0 145-149 35.3458 38.0 35.6 38.0 30.6 38.0 150-151 32.760374999999996 35.5 31.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 4.0 23 4.0 24 10.0 25 5.0 26 14.0 27 11.0 28 17.0 29 21.0 30 33.0 31 30.0 32 60.0 33 79.0 34 121.0 35 231.0 36 547.0 37 2811.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.03522898842476 10.191243080020131 9.536990437845999 40.23653749370911 2 20.925 14.799999999999999 34.375 29.9 3 19.8 19.5 26.125 34.575 4 23.25 25.75 23.025000000000002 27.975 5 22.125 32.824999999999996 24.325 20.724999999999998 6 19.6 35.825 25.074999999999996 19.5 7 14.725 26.224999999999998 40.775 18.275 8 17.75 25.25 31.3 25.7 9 16.7 24.15 35.125 24.025 10-14 19.79 29.375 27.55 23.285 15-19 19.67 27.63 28.505000000000003 24.195 20-24 19.715 29.12 27.705000000000002 23.46 25-29 20.105 28.71 27.67 23.515 30-34 19.780989049452472 28.546427321366068 27.791389569478476 23.881194059702985 35-39 20.27405481096219 27.905581116223242 28.055611122224445 23.76475295059012 40-44 20.73811071660749 28.09921488223234 27.489123368505275 23.6735510326549 45-49 20.402040204020402 28.272827282728276 27.2977297729773 24.027402740274027 50-54 20.16 28.349999999999998 27.529999999999998 23.96 55-59 19.68 28.15 28.244999999999997 23.925 60-64 20.51 27.860000000000003 27.96 23.669999999999998 65-69 20.1 28.470000000000002 27.689999999999998 23.74 70-74 20.044999999999998 27.6 28.28 24.075 75-79 20.705000000000002 28.12 27.015 24.16 80-84 19.97 28.804999999999996 27.474999999999998 23.75 85-89 20.075000000000003 28.21 27.794999999999998 23.919999999999998 90-94 21.075 29.025000000000002 26.665 23.235 95-99 20.405 28.225 27.57 23.799999999999997 100-104 20.294999999999998 28.384999999999998 27.700000000000003 23.62 105-109 20.630000000000003 28.305000000000003 27.91 23.155 110-114 20.915 27.66 27.250000000000004 24.175 115-119 20.599999999999998 28.345 27.42 23.635 120-124 20.905 28.12 26.935 24.04 125-129 20.805 27.855 27.485 23.855 130-134 20.96 28.025 27.139999999999997 23.875 135-139 21.07 28.03 26.939999999999998 23.96 140-144 21.015 27.665 27.33 23.990000000000002 145-149 21.095 28.175 26.845000000000002 23.885 150-151 21.7 27.575 26.525 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 5.5 28 7.0 29 12.5 30 21.0 31 23.0 32 26.5 33 35.5 34 47.5 35 59.5 36 80.0 37 110.5 38 127.0 39 148.0 40 183.0 41 215.0 42 248.5 43 270.0 44 285.5 45 295.5 46 283.0 47 255.5 48 218.5 49 191.0 50 180.0 51 144.5 52 111.5 53 100.0 54 74.0 55 52.0 56 38.0 57 23.0 58 21.0 59 21.5 60 13.5 61 12.5 62 11.5 63 6.0 64 6.5 65 7.0 66 4.0 67 4.0 68 3.0 69 0.5 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.02 40-44 0.015 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.2625 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAGTG 10 0.006830828 145.0 5 AAATCCT 10 0.006830828 145.0 9 CTCTAGT 10 0.006830828 145.0 4 >>END_MODULE SRR7171459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96925 33.0 33.0 34.0 32.0 34.0 2 33.04 34.0 33.0 34.0 32.0 34.0 3 33.04525 34.0 33.0 34.0 32.0 34.0 4 33.01325 34.0 33.0 34.0 32.0 34.0 5 32.965 34.0 33.0 34.0 32.0 34.0 6 37.11375 38.0 38.0 38.0 37.0 38.0 7 37.14 38.0 38.0 38.0 37.0 38.0 8 37.18075 38.0 38.0 38.0 37.0 38.0 9 37.10625 38.0 38.0 38.0 37.0 38.0 10-14 37.014250000000004 38.0 38.0 38.0 36.6 38.0 15-19 36.997 38.0 38.0 38.0 36.4 38.0 20-24 37.075700000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.06185 38.0 38.0 38.0 37.0 38.0 30-34 37.05624999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.03275000000001 38.0 38.0 38.0 36.6 38.0 40-44 36.99385 38.0 38.0 38.0 36.6 38.0 45-49 36.89685 38.0 38.0 38.0 36.0 38.0 50-54 36.84165 38.0 38.0 38.0 35.8 38.0 55-59 36.8424 38.0 38.0 38.0 36.0 38.0 60-64 36.7887 38.0 38.0 38.0 36.0 38.0 65-69 36.8649 38.0 38.0 38.0 36.0 38.0 70-74 36.8204 38.0 38.0 38.0 35.8 38.0 75-79 36.81735 38.0 38.0 38.0 35.8 38.0 80-84 36.776650000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.6644 38.0 38.0 38.0 35.2 38.0 90-94 36.52165 38.0 38.0 38.0 34.4 38.0 95-99 36.440200000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.39790000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.3457 38.0 38.0 38.0 34.0 38.0 110-114 36.12545 38.0 38.0 38.0 33.2 38.0 115-119 36.00625 38.0 37.8 38.0 32.6 38.0 120-124 35.8957 38.0 37.2 38.0 31.6 38.0 125-129 35.696600000000004 38.0 37.0 38.0 31.0 38.0 130-134 35.62455 38.0 36.0 38.0 31.0 38.0 135-139 35.17405 38.0 35.6 38.0 28.6 38.0 140-144 34.91415 38.0 35.2 38.0 27.8 38.0 145-149 34.549549999999996 38.0 33.2 38.0 24.8 38.0 150-151 32.062125 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 2.0 5 0.0 6 2.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 4.0 17 8.0 18 6.0 19 5.0 20 8.0 21 8.0 22 12.0 23 10.0 24 17.0 25 7.0 26 16.0 27 20.0 28 33.0 29 49.0 30 44.0 31 49.0 32 66.0 33 86.0 34 113.0 35 224.0 36 478.0 37 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.525 20.225 13.775 28.475 2 25.632040050062578 26.533166458072593 30.813516896120152 17.02127659574468 3 20.650813516896118 29.111389236545683 29.987484355444305 20.250312891113893 4 24.524524524524523 33.48348348348348 23.14814814814815 18.843843843843842 5 23.00375469336671 37.52190237797247 21.60200250312891 17.872340425531917 6 19.303955933900852 38.958437656484726 24.036054081121684 17.70155232849274 7 19.759579263711498 20.36063110443276 37.51565239168545 22.364137240170297 8 21.788129226145756 24.693213122965187 27.798647633358375 25.720010017530683 9 21.96343601302279 24.843476083145504 30.37816178312046 22.814926120711245 10-14 23.2591924656848 28.839795611662154 26.214808135457368 21.68620378719567 15-19 23.793777243348867 27.902199508993437 27.827045443158475 20.476977804499224 20-24 23.202925412012224 28.417572509141912 27.29048740169313 21.089014677152733 25-29 23.673142399359104 27.999198878429805 27.403364710594836 20.92429401161626 30-34 23.375193876019413 28.17831590533847 27.848101265822784 20.59838895281933 35-39 22.912601931062085 28.400620341187654 27.585171844514484 21.10160588323578 40-44 23.788303625075105 28.24954936911676 27.453434808732226 20.50871219707591 45-49 23.5747921049995 27.97314898306783 27.617473199078248 20.834585712854423 50-54 23.40649428743235 27.480457005411907 27.991581479254357 21.121467227901384 55-59 23.321306875125273 28.166967328121867 28.05171377029465 20.46001202645821 60-64 22.974394949140652 27.564263165806484 28.70671944681064 20.754622438242222 65-69 23.106591865357643 27.885193348026448 28.28090563013424 20.727309156481667 70-74 24.062859716730895 27.88649216755918 27.521145087833442 20.529503027876483 75-79 24.04240424042404 27.507750775077504 28.16281628162816 20.287028702870288 80-84 23.799999999999997 27.375 27.950000000000003 20.875 85-89 23.570034529349947 28.414152029224844 26.99294400240204 21.02286943902317 90-94 23.84912087361619 27.871562390422284 27.61108049892301 20.66823623703852 95-99 23.5252844183832 27.80033077732672 28.20628476920764 20.468100035082443 100-104 23.92982456140351 27.824561403508774 27.839598997493738 20.406015037593985 105-109 24.690429638542135 28.244848849451042 27.146939389381863 19.917782122624956 110-114 24.150205554998497 28.426752231023766 27.14328687456132 20.279755339416425 115-119 24.37593984962406 27.959899749373434 27.24310776942356 20.42105263157895 120-124 24.27461789025307 27.932848910047607 27.38160861939364 20.410924580305686 125-129 24.61307287753569 28.089156023040317 27.362885048835462 19.93488605058853 130-134 24.709535256410255 27.408854166666668 27.64423076923077 20.237379807692307 135-139 25.003758079871723 27.86992032870672 27.0230996642782 20.10322192714336 140-144 25.349641586044413 27.570304275903556 27.304626798335757 19.775427339716277 145-149 25.438772440076217 28.377294153043824 26.597131681877446 19.586801725002505 150-151 26.09077231695085 27.143931795386155 26.817953861584755 19.947342026078235 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.5 14 1.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 2.0 27 2.5 28 4.5 29 8.0 30 10.0 31 14.0 32 20.0 33 30.5 34 44.5 35 65.5 36 87.5 37 105.0 38 132.0 39 171.0 40 209.5 41 238.0 42 263.5 43 277.5 44 285.5 45 289.0 46 261.5 47 227.5 48 215.5 49 208.0 50 170.5 51 130.5 52 110.5 53 93.5 54 75.0 55 57.5 56 42.5 57 31.5 58 25.0 59 18.0 60 13.5 61 9.5 62 8.0 63 9.0 64 8.5 65 4.5 66 2.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.1 5 0.125 6 0.15 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.19 15-19 0.20500000000000002 20-24 0.185 25-29 0.13999999999999999 30-34 0.065 35-39 0.055 40-44 0.13999999999999999 45-49 0.19 50-54 0.22 55-59 0.22 60-64 0.215 65-69 0.18 70-74 0.095 75-79 0.01 80-84 0.0 85-89 0.08499999999999999 90-94 0.185 95-99 0.23500000000000001 100-104 0.25 105-109 0.265 110-114 0.27 115-119 0.25 120-124 0.22499999999999998 125-129 0.17500000000000002 130-134 0.16 135-139 0.215 140-144 0.255 145-149 0.29 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.300000000000001 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868437 spots for SRR7171459.sra Written 868437 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra Read 868419 spots for SRR7171459.sra Written 868419 spots for SRR7171459.sra SRR ids: ['SRR7171459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6efgi_f5 SRR7171459.sra spots: 17368398 blocks: [[1, 868419], [868420, 1736838], [1736839, 2605257], [2605258, 3473676], [3473677, 4342095], [4342096, 5210514], [5210515, 6078933], [6078934, 6947352], [6947353, 7815771], [7815772, 8684190], [8684191, 9552609], [9552610, 10421028], [10421029, 11289447], [11289448, 12157866], [12157867, 13026285], [13026286, 13894704], [13894705, 14763123], [14763124, 15631542], [15631543, 16499961], [16499962, 17368398]] SRR7171459 file size 5863879 SRR7171459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171459 SRR7171459_1.fastq SRR7171459_2.fastq Input file: SRR7171459_1.fastq Paired file: SRR7171459_2.fastq trimmed: SRR7171459-trimmed-pair1.fastq, SRR7171459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:20:50 2025 >> started Fri Feb 14 09:21:12 2025 >> done (21.153s) 17368398 read pairs processed; of these: 118 ( 0.00%) short read pairs filtered out after trimming by size control 788 ( 0.00%) empty read pairs filtered out after trimming by size control 17367492 (99.99%) read pairs available; of these: 2021964 (11.64%) trimmed read pairs available after processing 15345528 (88.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 6 0.00% 39 3 0.00% 40 2 0.00% 41 6 0.00% 42 6 0.00% 43 7 0.00% 44 1 0.00% 45 10 0.00% 46 5 0.00% 47 9 0.00% 48 12 0.00% 49 17 0.00% 50 15 0.00% 51 11 0.00% 52 19 0.00% 53 19 0.00% 54 29 0.00% 55 33 0.00% 56 32 0.00% 57 51 0.00% 58 44 0.00% 59 51 0.00% 60 68 0.00% 61 100 0.00% 62 86 0.00% 63 106 0.00% 64 138 0.00% 65 169 0.00% 66 198 0.00% 67 208 0.00% 68 259 0.00% 69 319 0.00% 70 368 0.00% 71 390 0.00% 72 469 0.00% 73 579 0.00% 74 613 0.00% 75 736 0.00% 76 833 0.00% 77 920 0.01% 78 1106 0.01% 79 1309 0.01% 80 1475 0.01% 81 1633 0.01% 82 1907 0.01% 83 2158 0.01% 84 2365 0.01% 85 2847 0.02% 86 3111 0.02% 87 3403 0.02% 88 3808 0.02% 89 3956 0.02% 90 4511 0.03% 91 5175 0.03% 92 5754 0.03% 93 6583 0.04% 94 6910 0.04% 95 7765 0.04% 96 8202 0.05% 97 8738 0.05% 98 9393 0.05% 99 9866 0.06% 100 10791 0.06% 101 11519 0.07% 102 12902 0.07% 103 13703 0.08% 104 14804 0.09% 105 15546 0.09% 106 16394 0.09% 107 17271 0.10% 108 17831 0.10% 109 18775 0.11% 110 19219 0.11% 111 20525 0.12% 112 21735 0.13% 113 22758 0.13% 114 24419 0.14% 115 25950 0.15% 116 27423 0.16% 117 29554 0.17% 118 30911 0.18% 119 31259 0.18% 120 29986 0.17% 121 31120 0.18% 122 32253 0.19% 123 34186 0.20% 124 35287 0.20% 125 36618 0.21% 126 37958 0.22% 127 39092 0.23% 128 39942 0.23% 129 40824 0.24% 130 41474 0.24% 131 42789 0.25% 132 43999 0.25% 133 45804 0.26% 134 46725 0.27% 135 48241 0.28% 136 49693 0.29% 137 51064 0.29% 138 51936 0.30% 139 52968 0.30% 140 53558 0.31% 141 56040 0.32% 142 57711 0.33% 143 61626 0.35% 144 62386 0.36% 145 63433 0.37% 146 61885 0.36% 147 63608 0.37% 148 65452 0.38% 149 64355 0.37% 150 67716 0.39% 151 15345528 88.36% 17367492 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=420.14 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=33.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=3.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=347.92 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=31.7 sequence=GAAGAAGAAGAAA SRR7171459 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:22:17 Started mapping on | Feb 14 09:22:18 Finished on | Feb 14 09:25:51 Mapping speed, Million of reads per hour | 293.54 Number of input reads | 17367492 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15886094 Uniquely mapped reads % | 91.47% Average mapped length | 295.77 Number of splices: Total | 16367786 Number of splices: Annotated (sjdb) | 16093141 Number of splices: GT/AG | 16113311 Number of splices: GC/AG | 204408 Number of splices: AT/AC | 11712 Number of splices: Non-canonical | 38355 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408252 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 129441 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1073146 1073146 1073146 N_multimapping 408252 408252 408252 N_noFeature 393566 15761847 442391 N_ambiguous 152400 986 76335 UnstrandedReadsAssigned:15340128 PositiveStrandReadsAssigned:123261 NegativeStrandReadsAssigned:15367368 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171459-trimmed-pair1.fastq SRR7171459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,367,492 reads, 15,470,708 reads pseudoaligned [quant] estimated average fragment length: 231.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR7171459.ke.tsv 34699 SRR7171459.se.tsv 87100 total ==> SRR7171459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.38 893 32.6791 Potri.005G024800.1.v4.1 1035 804.378 344 27.9726 Potri.004G059700.1.v4.1 961 730.394 20 1.79105 Potri.007G009000.2.v4.1 1416 1185.38 0 0 Potri.003G141000.2.v4.1 2943 2712.38 762.351 18.384 Potri.016G087400.1.v4.1 270 82.0761 1211 965.077 Potri.015G069301.1.v4.1 564 336.514 0 0 Potri.010G195200.1.v4.1 1773 1542.38 310 13.1464 Potri.012G127500.1.v4.1 977 746.389 2780 243.621 ==> SRR7171459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 53 SRR7171459 completed mapping pipeline successfully