Starting /dee2/code/volunteer_pipeline.sh SRR7171460 current disk space = 3115155460096 free memory = 1573066620 SRR7171460 SRAfilesize 7c02a07cb6528554bff4372694309b6d SRR7171460.sra SRR7171460.sra file validated SRR7171460 is paired end SRR7171460 is conventional basespace SRR7171460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.1995 32.0 28.0 33.0 18.0 33.0 2 31.55425 33.0 31.0 33.0 27.0 34.0 3 31.29425 33.0 32.0 33.0 27.0 33.0 4 31.18225 33.0 31.0 33.0 28.0 33.0 5 32.3225 33.0 33.0 33.0 31.0 34.0 6 36.53025 38.0 37.0 38.0 34.0 38.0 7 37.02225 38.0 38.0 38.0 35.0 38.0 8 37.1905 38.0 38.0 38.0 36.0 38.0 9 37.4275 38.0 38.0 38.0 37.0 38.0 10-14 37.5033 38.0 38.0 38.0 37.2 38.0 15-19 37.45695 38.0 38.0 38.0 37.2 38.0 20-24 37.49865 38.0 38.0 38.0 37.6 38.0 25-29 37.4367 38.0 38.0 38.0 37.0 38.0 30-34 37.401500000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.4088 38.0 38.0 38.0 37.0 38.0 40-44 37.350849999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.3454 38.0 38.0 38.0 37.0 38.0 50-54 37.2778 38.0 38.0 38.0 36.8 38.0 55-59 37.2384 38.0 38.0 38.0 36.6 38.0 60-64 37.10765 38.0 38.0 38.0 36.0 38.0 65-69 37.02075 38.0 38.0 38.0 36.0 38.0 70-74 37.04235 38.0 38.0 38.0 35.8 38.0 75-79 37.0006 38.0 38.0 38.0 36.0 38.0 80-84 36.858549999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.681200000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.63635 38.0 38.0 38.0 34.0 38.0 95-99 36.66825 38.0 38.0 38.0 34.2 38.0 100-104 36.447050000000004 38.0 37.6 38.0 34.0 38.0 105-109 36.3582 38.0 37.2 38.0 34.0 38.0 110-114 36.171400000000006 38.0 37.0 38.0 33.0 38.0 115-119 35.901700000000005 38.0 36.8 38.0 31.8 38.0 120-124 35.712849999999996 38.0 36.4 38.0 31.0 38.0 125-129 35.58645 38.0 36.0 38.0 30.2 38.0 130-134 35.6047 38.0 36.0 38.0 30.6 38.0 135-139 35.27004999999999 38.0 35.6 38.0 28.6 38.0 140-144 34.99765 38.0 35.2 38.0 27.6 38.0 145-149 34.5455 38.0 34.8 38.0 24.4 38.0 150-151 32.25975 36.0 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 4.0 24 3.0 25 3.0 26 13.0 27 14.0 28 22.0 29 43.0 30 37.0 31 73.0 32 87.0 33 112.0 34 178.0 35 318.0 36 747.0 37 2343.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.331639135959335 11.689961880559085 10.292249047013977 40.6861499364676 2 20.32540675844806 14.943679599499374 34.36795994993742 30.36295369211515 3 19.925 19.8 24.725 35.55 4 21.45 27.375 22.35 28.825 5 22.85 30.925000000000004 24.425 21.8 6 20.625 35.5 23.549999999999997 20.325 7 15.075 26.25 40.475 18.2 8 17.424999999999997 26.55 30.099999999999998 25.924999999999997 9 16.675 25.974999999999998 34.150000000000006 23.200000000000003 10-14 18.985 30.19 27.474999999999998 23.35 15-19 19.45 28.475 28.03 24.044999999999998 20-24 19.97 28.735 28.275 23.02 25-29 19.6 29.005 28.07 23.325000000000003 30-34 18.78 29.185 28.12 23.915 35-39 19.275000000000002 28.78 28.225 23.72 40-44 19.5 29.060000000000002 27.544999999999998 23.895 45-49 19.35 28.21 28.115000000000002 24.325 50-54 19.36 28.95 27.685 24.005000000000003 55-59 19.595000000000002 28.685 27.694999999999997 24.025 60-64 19.42 29.425 27.675 23.48 65-69 19.86996749187297 28.562140535133786 27.506876719179797 24.06101525381345 70-74 20.300075018754686 28.10202550637659 27.651912978244564 23.945986496624155 75-79 19.715 28.505000000000003 28.155 23.625 80-84 19.900000000000002 28.63 27.529999999999998 23.94 85-89 19.96 28.26 27.339999999999996 24.44 90-94 20.244999999999997 28.105000000000004 28.08 23.57 95-99 19.64 28.975 27.425 23.96 100-104 19.735 28.42 28.000000000000004 23.845 105-109 19.85 28.694999999999997 27.445000000000004 24.01 110-114 20.344154869691362 28.217697964083836 27.7124706117753 23.7256765544495 115-119 19.94796617801571 27.92815329964477 27.823085005253418 24.300795517086108 120-124 20.342034203420344 28.007800780078007 27.787778777877786 23.862386238623863 125-129 20.31 28.285 27.560000000000002 23.845 130-134 19.855 29.160000000000004 27.065 23.919999999999998 135-139 20.155 28.64 27.495000000000005 23.71 140-144 20.599999999999998 28.82 26.939999999999998 23.64 145-149 20.325 29.075 26.695 23.905 150-151 20.8125 28.050000000000004 27.0125 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 4.5 27 4.0 28 7.0 29 12.5 30 17.5 31 30.0 32 43.0 33 47.5 34 55.5 35 78.5 36 101.5 37 116.0 38 142.0 39 162.5 40 191.0 41 225.0 42 231.0 43 255.5 44 277.0 45 276.5 46 271.0 47 242.0 48 216.5 49 207.5 50 184.0 51 143.0 52 115.5 53 91.5 54 60.5 55 42.0 56 34.0 57 27.0 58 19.5 59 17.5 60 13.0 61 7.5 62 5.5 63 4.0 64 3.5 65 2.0 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.065 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.003540148 20.710714 140-144 >>END_MODULE SRR7171460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68775 33.0 33.0 34.0 32.0 34.0 2 32.745 34.0 33.0 34.0 32.0 34.0 3 32.88 34.0 33.0 34.0 32.0 34.0 4 32.859 34.0 33.0 34.0 32.0 34.0 5 32.89725 34.0 33.0 34.0 32.0 34.0 6 37.075 38.0 38.0 38.0 36.0 38.0 7 37.037 38.0 38.0 38.0 36.0 38.0 8 37.1115 38.0 38.0 38.0 37.0 38.0 9 37.0 38.0 38.0 38.0 36.0 38.0 10-14 36.8914 38.0 38.0 38.0 35.6 38.0 15-19 36.88815 38.0 38.0 38.0 35.8 38.0 20-24 36.85125 38.0 38.0 38.0 35.8 38.0 25-29 36.87915 38.0 38.0 38.0 35.8 38.0 30-34 36.92275 38.0 38.0 38.0 36.0 38.0 35-39 36.8626 38.0 38.0 38.0 35.8 38.0 40-44 36.881550000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.79805 38.0 38.0 38.0 35.6 38.0 50-54 36.8229 38.0 38.0 38.0 35.6 38.0 55-59 36.665800000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.523399999999995 38.0 38.0 38.0 34.4 38.0 65-69 36.52185 38.0 38.0 38.0 34.0 38.0 70-74 36.483850000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.51695 38.0 38.0 38.0 34.0 38.0 80-84 36.42675 38.0 38.0 38.0 34.0 38.0 85-89 36.317949999999996 38.0 38.0 38.0 33.4 38.0 90-94 36.1359 38.0 37.6 38.0 32.8 38.0 95-99 36.08095 38.0 37.4 38.0 33.2 38.0 100-104 35.83325 38.0 37.0 38.0 31.0 38.0 105-109 35.63295000000001 38.0 37.0 38.0 30.2 38.0 110-114 35.44564999999999 38.0 36.6 38.0 29.2 38.0 115-119 35.4622 38.0 36.4 38.0 29.2 38.0 120-124 35.0594 38.0 35.6 38.0 27.2 38.0 125-129 35.13845 38.0 35.4 38.0 27.6 38.0 130-134 34.9331 38.0 35.0 38.0 25.8 38.0 135-139 34.24225 38.0 34.4 38.0 22.2 38.0 140-144 33.84204999999999 38.0 33.8 38.0 21.8 38.0 145-149 33.714600000000004 38.0 33.6 38.0 21.0 38.0 150-151 31.054125 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 5.0 16 7.0 17 7.0 18 4.0 19 10.0 20 11.0 21 7.0 22 11.0 23 7.0 24 15.0 25 23.0 26 21.0 27 30.0 28 42.0 29 47.0 30 67.0 31 73.0 32 89.0 33 129.0 34 162.0 35 310.0 36 653.0 37 2268.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4366373902133 18.64491844416562 17.013801756587203 27.904642409033876 2 25.974999999999998 26.775 29.599999999999998 17.65 3 20.825 28.925 30.325000000000003 19.925 4 23.873873873873876 34.909909909909906 23.44844844844845 17.76776776776777 5 25.937968984492244 33.56678339169585 22.886443221610804 17.608804402201102 6 21.325 36.075 24.45 18.15 7 19.725 21.9 38.475 19.900000000000002 8 22.075 25.074999999999996 28.999999999999996 23.849999999999998 9 21.03551775887944 26.013006503251624 30.240120060030012 22.71135567783892 10-14 23.757818363772827 28.49637227920941 26.434826119589694 21.310983237428072 15-19 23.26361088871097 28.242594075260207 27.9273418734988 20.566453162530024 20-24 23.461730865432717 28.29414707353677 27.773886943471737 20.47023511755878 25-29 23.131156557827893 27.566378318915945 28.22641132056603 21.076053802690133 30-34 23.805 27.750000000000004 27.97 20.474999999999998 35-39 23.265 27.625 28.689999999999998 20.419999999999998 40-44 23.855 27.544999999999998 28.410000000000004 20.19 45-49 23.554421768707485 27.901160464185676 28.406362545018006 20.138055222088834 50-54 23.20892535521313 27.531518911346808 28.63217930758455 20.627376425855513 55-59 23.713456147376853 28.11373648378054 27.873448137765315 20.299359231077293 60-64 23.767579200240228 27.746359041089036 28.201791702117013 20.284270056553726 65-69 23.93316323978188 27.640202111161138 28.40562309270099 20.021011556355997 70-74 23.630000000000003 28.335 27.779999999999998 20.255000000000003 75-79 23.315 28.720000000000002 27.655 20.31 80-84 24.185000000000002 27.975 28.165000000000003 19.675 85-89 23.830000000000002 28.499999999999996 28.09 19.580000000000002 90-94 24.45733720116035 27.28818645593678 28.253476042812842 20.001000300090027 95-99 23.941335469015918 28.241065171688856 28.03083391730904 19.786765441986184 100-104 24.31254695717506 28.1893313298272 27.723516153268218 19.774605559729526 105-109 23.806661657901326 27.948910593538695 27.968945654896064 20.275482093663914 110-114 23.502304147465438 28.426167100781406 27.980364656381486 20.09116409537167 115-119 24.167292762334082 27.39794640621087 28.089156023040317 20.345604808414723 120-124 24.00160144129717 27.679911920728657 28.415574016614954 19.902912621359224 125-129 24.8112405620281 27.811390569528477 27.796389819490976 19.58097904895245 130-134 24.65746574657466 27.827782778277825 27.85778577857786 19.656965696569657 135-139 24.627089798778655 28.29112023225548 27.71548703573931 19.36630293322655 140-144 25.128975707488106 27.312797395442022 28.35962935136489 19.198597545704985 145-149 25.27048687637748 27.97034662392306 27.349228611500703 19.40993788819876 150-151 25.288076152304612 28.507014028056112 27.091683366733466 19.113226452905813 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 4.5 27 5.0 28 4.5 29 7.5 30 13.0 31 20.5 32 24.5 33 30.5 34 42.0 35 61.0 36 78.5 37 104.0 38 147.5 39 184.5 40 214.5 41 238.0 42 251.0 43 273.5 44 292.5 45 304.0 46 303.0 47 253.0 48 220.5 49 195.5 50 155.0 51 132.5 52 109.5 53 87.5 54 59.0 55 47.5 56 42.5 57 27.0 58 15.5 59 11.0 60 8.0 61 4.0 62 3.5 63 4.5 64 4.0 65 3.0 66 2.0 67 0.5 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.1 5 0.05 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.075 15-19 0.08 20-24 0.05 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.06 55-59 0.12 60-64 0.095 65-69 0.055 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.11 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.18 115-119 0.17500000000000002 120-124 0.09 125-129 0.005 130-134 0.01 135-139 0.11 140-144 0.17500000000000002 145-149 0.18 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.9 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATT 10 0.006832588 144.9875 2 GCCTCTC 10 0.006832588 144.9875 7 >>END_MODULE Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708661 spots for SRR7171460.sra Written 708661 spots for SRR7171460.sra Read 708673 spots for SRR7171460.sra Written 708673 spots for SRR7171460.sra SRR ids: ['SRR7171460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_3ylzk9 SRR7171460.sra spots: 14173232 blocks: [[1, 708661], [708662, 1417322], [1417323, 2125983], [2125984, 2834644], [2834645, 3543305], [3543306, 4251966], [4251967, 4960627], [4960628, 5669288], [5669289, 6377949], [6377950, 7086610], [7086611, 7795271], [7795272, 8503932], [8503933, 9212593], [9212594, 9921254], [9921255, 10629915], [10629916, 11338576], [11338577, 12047237], [12047238, 12755898], [12755899, 13464559], [13464560, 14173232]] SRR7171460 file size 4781142 SRR7171460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171460 SRR7171460_1.fastq SRR7171460_2.fastq Input file: SRR7171460_1.fastq Paired file: SRR7171460_2.fastq trimmed: SRR7171460-trimmed-pair1.fastq, SRR7171460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:04:12 2025 >> started Fri Feb 14 11:04:27 2025 >> done (15.507s) 14173232 read pairs processed; of these: 149 ( 0.00%) short read pairs filtered out after trimming by size control 550 ( 0.00%) empty read pairs filtered out after trimming by size control 14172533 (100.00%) read pairs available; of these: 1254577 ( 8.85%) trimmed read pairs available after processing 12917956 (91.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 3 0.00% 34 0 0.00% 35 1 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 1 0.00% 40 2 0.00% 41 3 0.00% 42 2 0.00% 43 6 0.00% 44 3 0.00% 45 0 0.00% 46 2 0.00% 47 5 0.00% 48 2 0.00% 49 6 0.00% 50 9 0.00% 51 11 0.00% 52 11 0.00% 53 18 0.00% 54 9 0.00% 55 10 0.00% 56 22 0.00% 57 21 0.00% 58 23 0.00% 59 32 0.00% 60 34 0.00% 61 35 0.00% 62 42 0.00% 63 45 0.00% 64 71 0.00% 65 60 0.00% 66 76 0.00% 67 76 0.00% 68 94 0.00% 69 135 0.00% 70 144 0.00% 71 152 0.00% 72 202 0.00% 73 245 0.00% 74 287 0.00% 75 309 0.00% 76 357 0.00% 77 428 0.00% 78 518 0.00% 79 554 0.00% 80 604 0.00% 81 759 0.01% 82 841 0.01% 83 1015 0.01% 84 1175 0.01% 85 1270 0.01% 86 1374 0.01% 87 1512 0.01% 88 1717 0.01% 89 1858 0.01% 90 2107 0.01% 91 2447 0.02% 92 2772 0.02% 93 3067 0.02% 94 3435 0.02% 95 3805 0.03% 96 4087 0.03% 97 4389 0.03% 98 4618 0.03% 99 4916 0.03% 100 5529 0.04% 101 5942 0.04% 102 6463 0.05% 103 7074 0.05% 104 7654 0.05% 105 8190 0.06% 106 8605 0.06% 107 9116 0.06% 108 9660 0.07% 109 10019 0.07% 110 10497 0.07% 111 11108 0.08% 112 11896 0.08% 113 13087 0.09% 114 13903 0.10% 115 14794 0.10% 116 15102 0.11% 117 16952 0.12% 118 19716 0.14% 119 17380 0.12% 120 17193 0.12% 121 17778 0.13% 122 18898 0.13% 123 19904 0.14% 124 21184 0.15% 125 22050 0.16% 126 22733 0.16% 127 23865 0.17% 128 23875 0.17% 129 24801 0.17% 130 25483 0.18% 131 26628 0.19% 132 27546 0.19% 133 28644 0.20% 134 29703 0.21% 135 30792 0.22% 136 31756 0.22% 137 32772 0.23% 138 33730 0.24% 139 34202 0.24% 140 34814 0.25% 141 36601 0.26% 142 42078 0.30% 143 40873 0.29% 144 41150 0.29% 145 44054 0.31% 146 42041 0.30% 147 46307 0.33% 148 44068 0.31% 149 44971 0.32% 150 49553 0.35% 151 12917956 91.15% 14172533 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=192.81 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.4 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=354.36 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=26.8 sequence=AAGAAGAAGAAA SRR7171460 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:05:51 Started mapping on | Feb 14 11:05:51 Finished on | Feb 14 11:07:39 Mapping speed, Million of reads per hour | 472.42 Number of input reads | 14172533 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13190404 Uniquely mapped reads % | 93.07% Average mapped length | 297.28 Number of splices: Total | 12985699 Number of splices: Annotated (sjdb) | 12734928 Number of splices: GT/AG | 12787657 Number of splices: GC/AG | 158242 Number of splices: AT/AC | 9236 Number of splices: Non-canonical | 30564 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306116 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 112094 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 676013 676013 676013 N_multimapping 306116 306116 306116 N_noFeature 365302 13077866 410213 N_ambiguous 130851 742 62758 UnstrandedReadsAssigned:12694251 PositiveStrandReadsAssigned:111796 NegativeStrandReadsAssigned:12717433 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171460-trimmed-pair1.fastq SRR7171460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,172,533 reads, 12,800,293 reads pseudoaligned [quant] estimated average fragment length: 238.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7171460.ke.tsv 34699 SRR7171460.se.tsv 87100 total ==> SRR7171460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.93 1924 77.4468 Potri.005G024800.1.v4.1 1035 797.928 928 83.3737 Potri.004G059700.1.v4.1 961 723.939 10 0.990245 Potri.007G009000.2.v4.1 1416 1178.93 0 0 Potri.003G141000.2.v4.1 2943 2705.93 759.749 20.1279 Potri.016G087400.1.v4.1 270 77.0153 986 917.793 Potri.015G069301.1.v4.1 564 329.679 0 0 Potri.010G195200.1.v4.1 1773 1535.93 216.463 10.1032 Potri.012G127500.1.v4.1 977 739.934 4057 393.058 ==> SRR7171460.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 153 SRR7171460 completed mapping pipeline successfully