Starting /dee2/code/volunteer_pipeline.sh SRR7171461 current disk space = 3114893045760 free memory = 1569008004 SRR7171461 SRAfilesize 0d91e6fb3c480e6cb3ed800162ae8701 SRR7171461.sra SRR7171461.sra file validated SRR7171461 is paired end SRR7171461 is conventional basespace SRR7171461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17225 33.0 33.0 34.0 31.0 34.0 2 32.069 33.0 32.0 34.0 28.0 34.0 3 32.1285 33.0 32.0 33.0 30.0 34.0 4 32.69375 33.0 33.0 33.0 32.0 34.0 5 33.08925 33.0 33.0 34.0 33.0 34.0 6 37.05175 38.0 37.0 38.0 35.0 38.0 7 37.41675 38.0 38.0 38.0 37.0 38.0 8 37.53275 38.0 38.0 38.0 37.0 38.0 9 37.635 38.0 38.0 38.0 38.0 38.0 10-14 37.68125 38.0 38.0 38.0 38.0 38.0 15-19 37.69395 38.0 38.0 38.0 38.0 38.0 20-24 37.6854 38.0 38.0 38.0 38.0 38.0 25-29 37.6562 38.0 38.0 38.0 38.0 38.0 30-34 37.6227 38.0 38.0 38.0 38.0 38.0 35-39 37.6004 38.0 38.0 38.0 38.0 38.0 40-44 37.596050000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.58325000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.539750000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.50145 38.0 38.0 38.0 37.8 38.0 60-64 37.504599999999996 38.0 38.0 38.0 37.4 38.0 65-69 37.463800000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.4219 38.0 38.0 38.0 37.0 38.0 75-79 37.34355000000001 38.0 38.0 38.0 37.0 38.0 80-84 37.31155 38.0 38.0 38.0 37.0 38.0 85-89 37.3087 38.0 38.0 38.0 36.8 38.0 90-94 37.21615 38.0 38.0 38.0 36.2 38.0 95-99 37.028949999999995 38.0 38.0 38.0 36.2 38.0 100-104 36.969849999999994 38.0 38.0 38.0 35.8 38.0 105-109 36.9418 38.0 38.0 38.0 35.4 38.0 110-114 36.8652 38.0 38.0 38.0 35.0 38.0 115-119 36.80375 38.0 38.0 38.0 35.0 38.0 120-124 36.68964999999999 38.0 38.0 38.0 34.4 38.0 125-129 36.51375 38.0 38.0 38.0 34.0 38.0 130-134 36.4091 38.0 37.6 38.0 34.0 38.0 135-139 36.162150000000004 38.0 37.0 38.0 33.2 38.0 140-144 36.00320000000001 38.0 36.0 38.0 32.6 38.0 145-149 35.7739 38.0 36.0 38.0 31.8 38.0 150-151 33.30075 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 3.0 24 5.0 25 6.0 26 9.0 27 9.0 28 12.0 29 12.0 30 25.0 31 27.0 32 33.0 33 53.0 34 89.0 35 175.0 36 556.0 37 2985.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.109697933227345 11.658717541070482 10.0688924218336 39.16269210386857 2 21.075 15.6 32.45 30.875000000000004 3 21.325 18.275 26.375 34.025 4 24.125 25.15 22.05 28.675 5 24.525 30.95 23.724999999999998 20.8 6 19.125 34.599999999999994 25.35 20.925 7 15.4 26.150000000000002 40.75 17.7 8 19.125 26.0 29.875 25.0 9 18.375 24.95 32.85 23.825 10-14 20.244999999999997 29.695 26.575 23.485 15-19 19.955000000000002 28.29 27.639999999999997 24.115000000000002 20-24 20.285 27.655 28.17 23.89 25-29 19.97 28.23 27.595 24.205 30-34 20.355 28.044999999999998 28.044999999999998 23.555 35-39 20.03 28.139999999999997 27.634999999999998 24.195 40-44 20.169999999999998 28.07 27.889999999999997 23.87 45-49 19.66 28.165000000000003 28.275 23.9 50-54 20.05 28.444999999999997 27.515 23.990000000000002 55-59 20.405 27.765 27.99 23.84 60-64 20.25 28.84 27.744999999999997 23.165 65-69 19.535 28.360000000000003 28.125 23.98 70-74 20.035 27.845 28.27 23.849999999999998 75-79 20.79 27.575 27.935 23.7 80-84 19.875 27.63 28.599999999999998 23.895 85-89 20.8 27.555000000000003 28.24 23.405 90-94 20.39 27.41 27.894999999999996 24.305 95-99 20.919999999999998 27.529999999999998 28.03 23.52 100-104 20.08200820082008 28.472847284728473 27.602760276027606 23.84238423842384 105-109 20.58308746311947 28.31924788718308 28.049207381107166 23.04845726859029 110-114 20.530132533133283 28.43710927731933 27.89697424356089 23.135783945986496 115-119 20.99814972245837 27.614142121318196 27.549132369855478 23.838575786367954 120-124 20.62 28.225 27.450000000000003 23.705000000000002 125-129 20.925 28.525 27.305 23.244999999999997 130-134 21.044999999999998 28.255000000000003 27.11 23.59 135-139 21.68 28.005000000000003 26.655 23.66 140-144 21.195 27.91 27.125 23.77 145-149 21.015 28.16 26.605 24.22 150-151 20.575 27.437499999999996 26.9625 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 2.0 26 3.5 27 4.0 28 7.0 29 9.0 30 16.5 31 23.5 32 22.0 33 27.0 34 42.0 35 61.0 36 81.0 37 98.5 38 115.5 39 160.5 40 194.0 41 211.5 42 245.5 43 262.5 44 278.5 45 287.0 46 294.5 47 270.5 48 236.0 49 209.5 50 169.5 51 141.5 52 107.0 53 95.5 54 87.5 55 60.0 56 39.5 57 31.0 58 24.0 59 17.5 60 13.5 61 10.5 62 9.5 63 8.0 64 3.5 65 2.0 66 2.0 67 3.0 68 3.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.015 110-114 0.025 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.387499999999999 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.324999999999999 0.0 0.0 0.0 0.0 136-137 7.9625 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAACT 10 0.006836113 144.9625 7 >>END_MODULE SRR7171461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15225 33.0 33.0 34.0 33.0 34.0 2 33.245 34.0 33.0 34.0 33.0 34.0 3 33.28275 34.0 33.0 34.0 33.0 34.0 4 33.263 34.0 33.0 34.0 33.0 34.0 5 33.2975 34.0 33.0 34.0 33.0 34.0 6 37.456 38.0 38.0 38.0 38.0 38.0 7 37.504 38.0 38.0 38.0 38.0 38.0 8 37.5255 38.0 38.0 38.0 38.0 38.0 9 37.463 38.0 38.0 38.0 38.0 38.0 10-14 37.477199999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4763 38.0 38.0 38.0 38.0 38.0 20-24 37.489200000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5017 38.0 38.0 38.0 38.0 38.0 30-34 37.4786 38.0 38.0 38.0 38.0 38.0 35-39 37.4366 38.0 38.0 38.0 38.0 38.0 40-44 37.4456 38.0 38.0 38.0 38.0 38.0 45-49 37.3448 38.0 38.0 38.0 37.4 38.0 50-54 37.3192 38.0 38.0 38.0 37.2 38.0 55-59 37.37235 38.0 38.0 38.0 37.2 38.0 60-64 37.3253 38.0 38.0 38.0 37.2 38.0 65-69 37.3307 38.0 38.0 38.0 37.0 38.0 70-74 37.272099999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.25005 38.0 38.0 38.0 37.0 38.0 80-84 37.198100000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.14765 38.0 38.0 38.0 36.2 38.0 90-94 37.031 38.0 38.0 38.0 36.0 38.0 95-99 36.9582 38.0 38.0 38.0 36.0 38.0 100-104 36.866200000000006 38.0 38.0 38.0 35.6 38.0 105-109 36.782349999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.74375 38.0 38.0 38.0 34.8 38.0 115-119 36.59045 38.0 38.0 38.0 34.2 38.0 120-124 36.42645 38.0 38.0 38.0 34.0 38.0 125-129 36.31725 38.0 38.0 38.0 34.0 38.0 130-134 36.0933 38.0 37.6 38.0 33.4 38.0 135-139 35.9052 38.0 36.2 38.0 32.0 38.0 140-144 35.63545 38.0 36.0 38.0 31.0 38.0 145-149 35.09715 38.0 35.2 38.0 28.6 38.0 150-151 32.208 35.5 29.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 5.0 18 3.0 19 4.0 20 1.0 21 5.0 22 3.0 23 8.0 24 7.0 25 4.0 26 12.0 27 14.0 28 15.0 29 23.0 30 29.0 31 29.0 32 42.0 33 55.0 34 96.0 35 191.0 36 525.0 37 2928.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 18.175 16.1 27.975 2 25.324999999999996 26.6 30.475 17.599999999999998 3 21.224999999999998 28.375 30.525000000000002 19.875 4 23.0 33.324999999999996 24.224999999999998 19.45 5 25.174999999999997 35.325 22.55 16.950000000000003 6 20.5 37.8 24.5 17.2 7 20.4 20.674999999999997 38.875 20.05 8 23.799999999999997 25.7 26.3 24.2 9 21.6 24.425 29.65 24.325 10-14 23.630000000000003 29.205 25.91 21.255 15-19 23.06 28.49 27.72 20.73 20-24 22.869999999999997 28.07 27.66 21.4 25-29 23.169999999999998 28.775000000000002 26.99 21.065 30-34 22.915 28.189999999999998 27.365000000000002 21.529999999999998 35-39 23.165 27.73 27.36 21.745 40-44 23.305 27.775 27.845 21.075 45-49 23.1 28.335 27.650000000000002 20.915 50-54 23.325000000000003 28.18 27.515 20.979999999999997 55-59 23.23 28.050000000000004 27.905 20.815 60-64 23.79 28.02 27.58 20.61 65-69 23.285 28.015 27.034999999999997 21.665 70-74 23.445 28.470000000000002 27.544999999999998 20.54 75-79 23.635 27.965 27.555000000000003 20.845 80-84 23.26 27.994999999999997 27.775 20.97 85-89 23.745 28.15 27.495000000000005 20.61 90-94 23.57 28.360000000000003 27.834999999999997 20.235 95-99 23.57 28.215 27.815 20.4 100-104 24.240000000000002 27.525 27.894999999999996 20.34 105-109 24.365000000000002 28.110000000000003 27.694999999999997 19.830000000000002 110-114 24.37 28.015 27.395000000000003 20.22 115-119 24.01 28.285 26.86 20.845 120-124 23.9 27.800000000000004 27.205000000000002 21.095 125-129 25.05 27.794999999999998 27.305 19.85 130-134 25.455 28.050000000000004 26.655 19.84 135-139 25.595000000000002 27.765 27.065 19.575 140-144 25.564999999999998 28.249999999999996 26.66 19.525000000000002 145-149 25.655 28.025 26.5 19.82 150-151 26.150000000000002 28.725 26.400000000000002 18.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 3.5 28 7.5 29 8.5 30 10.0 31 14.5 32 20.5 33 30.5 34 39.5 35 51.0 36 66.5 37 95.0 38 139.0 39 180.0 40 202.5 41 226.5 42 258.0 43 283.5 44 286.5 45 271.5 46 276.5 47 273.0 48 245.5 49 214.0 50 179.0 51 134.5 52 100.0 53 85.5 54 73.0 55 54.5 56 35.0 57 25.5 58 21.5 59 18.5 60 14.0 61 8.5 62 7.0 63 7.5 64 5.0 65 3.5 66 4.5 67 3.0 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.1624999999999996 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.487500000000001 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884074 spots for SRR7171461.sra Written 884074 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra Read 884061 spots for SRR7171461.sra Written 884061 spots for SRR7171461.sra SRR ids: ['SRR7171461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_05nv2wgg SRR7171461.sra spots: 17681233 blocks: [[1, 884061], [884062, 1768122], [1768123, 2652183], [2652184, 3536244], [3536245, 4420305], [4420306, 5304366], [5304367, 6188427], [6188428, 7072488], [7072489, 7956549], [7956550, 8840610], [8840611, 9724671], [9724672, 10608732], [10608733, 11492793], [11492794, 12376854], [12376855, 13260915], [13260916, 14144976], [14144977, 15029037], [15029038, 15913098], [15913099, 16797159], [16797160, 17681233]] SRR7171461 file size 5969889 SRR7171461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171461 SRR7171461_1.fastq SRR7171461_2.fastq Input file: SRR7171461_1.fastq Paired file: SRR7171461_2.fastq trimmed: SRR7171461-trimmed-pair1.fastq, SRR7171461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:58:17 2025 >> started Fri Feb 14 10:58:41 2025 >> done (24.251s) 17681233 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 1289 ( 0.01%) empty read pairs filtered out after trimming by size control 17679919 (99.99%) read pairs available; of these: 2394903 (13.55%) trimmed read pairs available after processing 15285016 (86.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 1 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 1 0.00% 39 2 0.00% 40 3 0.00% 41 5 0.00% 42 11 0.00% 43 7 0.00% 44 6 0.00% 45 10 0.00% 46 13 0.00% 47 7 0.00% 48 11 0.00% 49 14 0.00% 50 20 0.00% 51 21 0.00% 52 14 0.00% 53 28 0.00% 54 45 0.00% 55 43 0.00% 56 39 0.00% 57 55 0.00% 58 58 0.00% 59 72 0.00% 60 93 0.00% 61 113 0.00% 62 132 0.00% 63 163 0.00% 64 150 0.00% 65 207 0.00% 66 219 0.00% 67 307 0.00% 68 318 0.00% 69 388 0.00% 70 457 0.00% 71 492 0.00% 72 600 0.00% 73 754 0.00% 74 895 0.01% 75 983 0.01% 76 1100 0.01% 77 1222 0.01% 78 1337 0.01% 79 1498 0.01% 80 1798 0.01% 81 2138 0.01% 82 2463 0.01% 83 2821 0.02% 84 3091 0.02% 85 3452 0.02% 86 3847 0.02% 87 4378 0.02% 88 4702 0.03% 89 5306 0.03% 90 5918 0.03% 91 6517 0.04% 92 7155 0.04% 93 7863 0.04% 94 8836 0.05% 95 9811 0.06% 96 10385 0.06% 97 10857 0.06% 98 11538 0.07% 99 12354 0.07% 100 13692 0.08% 101 14309 0.08% 102 15419 0.09% 103 16869 0.10% 104 17830 0.10% 105 19149 0.11% 106 20246 0.11% 107 21510 0.12% 108 22310 0.13% 109 23012 0.13% 110 24139 0.14% 111 25450 0.14% 112 26824 0.15% 113 28420 0.16% 114 30218 0.17% 115 31549 0.18% 116 32911 0.19% 117 33565 0.19% 118 34261 0.19% 119 35587 0.20% 120 36430 0.21% 121 38079 0.22% 122 39689 0.22% 123 41033 0.23% 124 43145 0.24% 125 44277 0.25% 126 46055 0.26% 127 46746 0.26% 128 48199 0.27% 129 49265 0.28% 130 50217 0.28% 131 51357 0.29% 132 53101 0.30% 133 54696 0.31% 134 55915 0.32% 135 58410 0.33% 136 59461 0.34% 137 60289 0.34% 138 61326 0.35% 139 62758 0.35% 140 63397 0.36% 141 64556 0.37% 142 66263 0.37% 143 66838 0.38% 144 69100 0.39% 145 70355 0.40% 146 71615 0.41% 147 73161 0.41% 148 74321 0.42% 149 74553 0.42% 150 75852 0.43% 151 15285016 86.45% 17679919 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=22.74 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.4 sequence=ACAGCAAATACCAGCGGCCCTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTGCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTTCTTGGTACCTATTCCTCCAGGAATTACTGACCATAGTGCTCGTACGCTAGTCTAGCCTAGTAAAACCACGATCAGCCGACGGTCTGGATGCCGACGCCCGTATACTGTGAGCAGCTTGG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=22.03 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171461 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:59:56 Started mapping on | Feb 14 10:59:56 Finished on | Feb 14 11:03:35 Mapping speed, Million of reads per hour | 290.63 Number of input reads | 17679919 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15887547 Uniquely mapped reads % | 89.86% Average mapped length | 294.90 Number of splices: Total | 15203749 Number of splices: Annotated (sjdb) | 14897025 Number of splices: GT/AG | 14948591 Number of splices: GC/AG | 197601 Number of splices: AT/AC | 11429 Number of splices: Non-canonical | 46128 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408266 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 91654 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.17% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1384106 1384106 1384106 N_multimapping 408266 408266 408266 N_noFeature 439060 15739435 497164 N_ambiguous 168581 835 78194 UnstrandedReadsAssigned:15279906 PositiveStrandReadsAssigned:147277 NegativeStrandReadsAssigned:15312189 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171461-trimmed-pair1.fastq SRR7171461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,679,919 reads, 15,286,057 reads pseudoaligned [quant] estimated average fragment length: 221.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR7171461.ke.tsv 34699 SRR7171461.se.tsv 87100 total ==> SRR7171461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.34 1664 65.0842 Potri.005G024800.1.v4.1 1035 814.336 254 21.9271 Potri.004G059700.1.v4.1 961 740.352 8 0.759632 Potri.007G009000.2.v4.1 1416 1195.34 0 0 Potri.003G141000.2.v4.1 2943 2722.34 669.25 17.2822 Potri.016G087400.1.v4.1 270 85.5259 821 674.834 Potri.015G069301.1.v4.1 564 345.389 0 0 Potri.010G195200.1.v4.1 1773 1552.34 590 26.7188 Potri.012G127500.1.v4.1 977 756.347 6326 587.976 ==> SRR7171461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 623 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 656 SRR7171461 completed mapping pipeline successfully