Starting /dee2/code/volunteer_pipeline.sh SRR7171462 current disk space = 3116118822912 free memory = 1322278608 SRR7171462 SRAfilesize e3bb5fed88cabb78d0181576d081cb81 SRR7171462.sra SRR7171462.sra file validated SRR7171462 is paired end SRR7171462 is conventional basespace SRR7171462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9765 34.0 33.0 34.0 32.0 34.0 2 33.19225 34.0 33.0 34.0 32.0 34.0 3 33.13575 34.0 33.0 34.0 32.0 34.0 4 33.1905 34.0 33.0 34.0 32.0 34.0 5 33.288 34.0 33.0 34.0 33.0 34.0 6 36.8505 38.0 37.0 38.0 35.0 38.0 7 37.266 38.0 38.0 38.0 36.0 38.0 8 37.44 38.0 38.0 38.0 37.0 38.0 9 37.5585 38.0 38.0 38.0 38.0 38.0 10-14 37.5347 38.0 38.0 38.0 37.8 38.0 15-19 37.4652 38.0 38.0 38.0 37.2 38.0 20-24 37.467099999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.42925 38.0 38.0 38.0 37.0 38.0 30-34 37.349199999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.35265 38.0 38.0 38.0 37.0 38.0 40-44 37.3629 38.0 38.0 38.0 37.0 38.0 45-49 37.41955 38.0 38.0 38.0 37.0 38.0 50-54 37.382 38.0 38.0 38.0 37.0 38.0 55-59 37.3219 38.0 38.0 38.0 37.0 38.0 60-64 37.2809 38.0 38.0 38.0 37.0 38.0 65-69 37.24745 38.0 38.0 38.0 36.8 38.0 70-74 37.15315 38.0 38.0 38.0 36.2 38.0 75-79 37.101850000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.08055 38.0 38.0 38.0 36.0 38.0 85-89 37.057750000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.9848 38.0 38.0 38.0 35.8 38.0 95-99 36.76545 38.0 38.0 38.0 35.0 38.0 100-104 36.601800000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.584199999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.50995 38.0 38.0 38.0 34.0 38.0 115-119 36.5296 38.0 38.0 38.0 34.0 38.0 120-124 36.46175 38.0 38.0 38.0 34.0 38.0 125-129 36.403499999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.1056 38.0 37.0 38.0 33.0 38.0 135-139 35.8875 38.0 36.4 38.0 31.8 38.0 140-144 35.75175 38.0 36.0 38.0 31.0 38.0 145-149 35.613299999999995 38.0 36.0 38.0 30.6 38.0 150-151 33.40825 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 4.0 22 3.0 23 1.0 24 3.0 25 9.0 26 8.0 27 17.0 28 16.0 29 20.0 30 39.0 31 44.0 32 56.0 33 92.0 34 140.0 35 217.0 36 469.0 37 2859.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.44025157232704 12.025157232704403 11.849056603773585 37.685534591194966 2 22.45 13.725000000000001 33.125 30.7 3 21.15 17.325 26.075 35.449999999999996 4 23.925 23.65 22.55 29.875 5 23.75 29.225 23.849999999999998 23.175 6 21.25 32.45 24.675 21.625 7 14.274999999999999 27.175 40.925 17.625 8 17.45 25.974999999999998 30.8 25.775 9 17.424999999999997 25.0 34.025 23.549999999999997 10-14 19.405 29.32 28.165000000000003 23.11 15-19 19.375 28.410000000000004 28.310000000000002 23.905 20-24 19.295 29.18 27.555000000000003 23.97 25-29 20.095 29.054999999999996 27.47 23.380000000000003 30-34 19.811981198119813 28.79287928792879 27.75777577757776 23.637363736373636 35-39 19.870993549677486 28.55642782139107 27.841392069603483 23.731186559327966 40-44 20.104020804160832 29.005801160232046 27.315463092618526 23.5747149429886 45-49 20.31 27.375 27.950000000000003 24.365000000000002 50-54 19.705000000000002 28.205000000000002 27.744999999999997 24.345 55-59 20.36 27.97 27.32 24.349999999999998 60-64 20.255000000000003 28.08 27.87 23.794999999999998 65-69 19.67 28.1 28.110000000000003 24.12 70-74 20.150000000000002 27.91 27.700000000000003 24.240000000000002 75-79 20.855 27.950000000000003 26.86 24.335 80-84 20.275000000000002 27.67 28.000000000000004 24.055 85-89 20.405 28.285 27.250000000000004 24.060000000000002 90-94 20.395 27.43 27.61 24.565 95-99 20.48 27.555000000000003 27.744999999999997 24.22 100-104 20.330000000000002 27.894999999999996 27.515 24.26 105-109 20.415 27.075 27.965 24.545 110-114 19.93 27.865000000000002 27.455000000000002 24.75 115-119 20.955 27.900000000000002 26.939999999999998 24.205 120-124 20.685000000000002 28.1 27.05 24.165 125-129 20.89 27.894999999999996 27.16 24.055 130-134 21.065 28.4 26.979999999999997 23.555 135-139 21.34 27.58 26.369999999999997 24.709999999999997 140-144 20.830000000000002 27.889999999999997 26.71 24.57 145-149 20.919999999999998 28.37 26.474999999999998 24.235 150-151 21.712500000000002 27.625 25.3125 25.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 1.5 26 4.0 27 5.0 28 8.5 29 13.0 30 15.0 31 18.5 32 24.5 33 40.0 34 53.0 35 65.0 36 87.5 37 92.5 38 109.0 39 143.0 40 178.0 41 209.5 42 233.5 43 266.0 44 284.5 45 275.0 46 265.5 47 269.0 48 241.5 49 193.0 50 178.0 51 159.0 52 129.0 53 101.5 54 76.0 55 62.5 56 45.0 57 31.0 58 24.0 59 17.5 60 13.5 61 14.0 62 14.0 63 9.5 64 3.0 65 4.5 66 4.5 67 2.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.325 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.45 0.0 0.0 0.0 0.0 136-137 7.9875 0.0 0.0 0.0 0.0 138-139 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAACAA 10 0.0068484643 144.875 8 GTGTGGG 10 0.0068484643 144.875 145 >>END_MODULE SRR7171462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75225 33.0 33.0 34.0 32.0 34.0 2 32.698 34.0 33.0 34.0 32.0 34.0 3 32.7735 34.0 33.0 34.0 32.0 34.0 4 32.552 34.0 33.0 34.0 32.0 34.0 5 32.59 34.0 33.0 34.0 32.0 34.0 6 36.6115 38.0 38.0 38.0 35.0 38.0 7 36.65175 38.0 38.0 38.0 35.0 38.0 8 36.53925 38.0 38.0 38.0 35.0 38.0 9 36.67175 38.0 38.0 38.0 35.0 38.0 10-14 36.71225 38.0 38.0 38.0 35.4 38.0 15-19 36.8717 38.0 38.0 38.0 36.0 38.0 20-24 36.9609 38.0 38.0 38.0 36.2 38.0 25-29 37.00825 38.0 38.0 38.0 36.4 38.0 30-34 37.0495 38.0 38.0 38.0 36.8 38.0 35-39 37.0464 38.0 38.0 38.0 36.4 38.0 40-44 36.9959 38.0 38.0 38.0 36.2 38.0 45-49 36.9306 38.0 38.0 38.0 36.2 38.0 50-54 36.84015 38.0 38.0 38.0 36.0 38.0 55-59 36.87955 38.0 38.0 38.0 36.0 38.0 60-64 36.89045 38.0 38.0 38.0 36.0 38.0 65-69 36.90255 38.0 38.0 38.0 36.0 38.0 70-74 36.917249999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.955999999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.89945 38.0 38.0 38.0 36.0 38.0 85-89 36.853750000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.71925 38.0 38.0 38.0 35.6 38.0 95-99 36.558550000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.487 38.0 38.0 38.0 34.4 38.0 105-109 36.36145 38.0 38.0 38.0 34.0 38.0 110-114 36.266549999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.0262 38.0 37.8 38.0 33.2 38.0 120-124 35.935900000000004 38.0 37.4 38.0 32.4 38.0 125-129 35.95845 38.0 37.4 38.0 32.6 38.0 130-134 35.70934999999999 38.0 36.8 38.0 31.2 38.0 135-139 35.50205 38.0 36.0 38.0 31.0 38.0 140-144 35.114549999999994 38.0 35.6 38.0 27.8 38.0 145-149 34.797450000000005 38.0 35.0 38.0 25.2 38.0 150-151 32.29775 35.5 28.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 2.0 6 3.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 4.0 18 6.0 19 8.0 20 5.0 21 11.0 22 8.0 23 9.0 24 18.0 25 17.0 26 15.0 27 22.0 28 24.0 29 24.0 30 44.0 31 58.0 32 67.0 33 88.0 34 120.0 35 208.0 36 498.0 37 2733.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.86743371685843 20.410205102551277 16.45822911455728 28.264132066033014 2 26.01402103154732 26.765147721582373 28.943415122684023 18.27741612418628 3 21.82182182182182 28.97897897897898 27.927927927927925 21.27127127127127 4 22.64764764764765 34.434434434434436 23.623623623623622 19.294294294294296 5 26.183913806063643 33.37509396141318 22.199949887246305 18.241042345276874 6 20.546914199698946 38.08329152032112 23.331660812844955 18.038133467134973 7 19.654048633742793 22.762597142140887 36.776134369516164 20.807219854600152 8 22.837803960892455 25.394835798445726 26.62321383805465 25.14414640260717 9 23.119358074222667 25.55165496489468 29.087261785356066 22.24172517552658 10-14 24.331644680744343 28.670311481165673 25.57054722375483 21.427496614335155 15-19 23.902683722096814 27.589666415851514 27.399046902432904 21.10860295961876 20-24 24.214751630707475 28.354239839438033 26.43753135975916 20.993477170095336 25-29 23.962093862815884 27.69253910950662 27.010629763337345 21.334737264340152 30-34 23.636909828268163 28.773844690331945 26.831222149902366 20.758023331497522 35-39 23.635636036216297 27.792506627982593 27.127207243259466 21.444650092541647 40-44 23.834820086198256 28.295078680966224 26.87681667836023 20.993284554475295 45-49 24.37080116314048 27.303720044119125 27.268625288278354 21.056853504462048 50-54 24.18359668924003 27.78530223225483 27.113117632304988 20.91798344620015 55-59 24.77170095333668 27.937782237832415 26.562970396387353 20.727546412443555 60-64 23.804985704970658 28.178763103776898 26.88970256307368 21.126548628178764 65-69 23.93582351466533 27.681123088493358 27.219854600150413 21.1631987966909 70-74 24.589260669204567 27.9052294129433 26.898417150871566 20.607092766980564 75-79 24.313647047057056 27.99419912986948 27.199079861979296 20.49307396109416 80-84 24.552455245524552 27.47274727472747 26.957695769576954 21.01710171017102 85-89 24.01141255380919 28.506356992691963 26.994694163579936 20.48753628991891 90-94 23.993784772693097 27.928424640368902 27.517417673299583 20.560372913638414 95-99 24.19379106274136 28.3263955062942 26.796730026581074 20.68308340438337 100-104 24.836929252383342 27.932764676367285 27.240341194179628 19.989964877069745 105-109 24.361483265592852 27.668222188770137 27.301921822469765 20.668372723167245 110-114 24.315102860010036 27.616658304064224 27.85248369292524 20.215755143000504 115-119 24.310085298544905 27.72704465629704 27.119919719016554 20.842950326141498 120-124 25.109093644981694 27.506645934694284 27.586898731002655 19.797361689321363 125-129 24.912315863312955 28.645154825132778 26.47058823529412 19.971941076260148 130-134 25.672494114111107 28.041877473325656 26.884736763011574 19.40089164955167 135-139 25.513887496239846 27.99057455128848 26.456432367391958 20.039105585079714 140-144 25.316074653823 28.115593016255268 26.690748545053182 19.877583784868552 145-149 25.900652282990468 27.842448569994982 26.37732062217762 19.87957852483693 150-151 25.602107375815354 28.24887104867035 26.85649774209734 19.292523833416958 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 1.5 25 1.5 26 2.0 27 2.5 28 4.5 29 5.0 30 5.5 31 12.5 32 19.5 33 20.5 34 33.5 35 41.0 36 57.0 37 88.5 38 111.5 39 135.5 40 162.5 41 194.0 42 233.5 43 273.5 44 286.5 45 299.0 46 314.5 47 296.5 48 258.0 49 223.5 50 199.0 51 165.5 52 128.0 53 98.0 54 72.5 55 55.5 56 39.0 57 27.5 58 21.0 59 17.0 60 18.0 61 16.0 62 10.0 63 5.0 64 3.5 65 2.0 66 3.0 67 5.5 68 5.0 69 4.5 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.15 3 0.1 4 0.1 5 0.22499999999999998 6 0.35000000000000003 7 0.27499999999999997 8 0.27499999999999997 9 0.3 10-14 0.315 15-19 0.325 20-24 0.35000000000000003 25-29 0.27999999999999997 30-34 0.135 35-39 0.045 40-44 0.22999999999999998 45-49 0.27 50-54 0.325 55-59 0.35000000000000003 60-64 0.315 65-69 0.27499999999999997 70-74 0.18 75-79 0.015 80-84 0.01 85-89 0.11 90-94 0.245 95-99 0.305 100-104 0.35000000000000003 105-109 0.35500000000000004 110-114 0.35000000000000003 115-119 0.35000000000000003 120-124 0.315 125-129 0.21 130-134 0.185 135-139 0.27 140-144 0.33999999999999997 145-149 0.35000000000000003 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.2125000000000004 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.8 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 7.95 0.0 0.0 0.0 0.0 138-139 8.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860409 spots for SRR7171462.sra Written 860409 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra Read 860394 spots for SRR7171462.sra Written 860394 spots for SRR7171462.sra SRR ids: ['SRR7171462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7e_kzt94 SRR7171462.sra spots: 17207895 blocks: [[1, 860394], [860395, 1720788], [1720789, 2581182], [2581183, 3441576], [3441577, 4301970], [4301971, 5162364], [5162365, 6022758], [6022759, 6883152], [6883153, 7743546], [7743547, 8603940], [8603941, 9464334], [9464335, 10324728], [10324729, 11185122], [11185123, 12045516], [12045517, 12905910], [12905911, 13766304], [13766305, 14626698], [14626699, 15487092], [15487093, 16347486], [16347487, 17207895]] SRR7171462 file size 5809490 SRR7171462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171462 SRR7171462_1.fastq SRR7171462_2.fastq Input file: SRR7171462_1.fastq Paired file: SRR7171462_2.fastq trimmed: SRR7171462-trimmed-pair1.fastq, SRR7171462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:59:42 2025 >> started Fri Feb 14 10:00:04 2025 >> done (22.090s) 17207895 read pairs processed; of these: 863 ( 0.01%) short read pairs filtered out after trimming by size control 2590 ( 0.02%) empty read pairs filtered out after trimming by size control 17204442 (99.98%) read pairs available; of these: 2541823 (14.77%) trimmed read pairs available after processing 14662619 (85.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 4 0.00% 30 2 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 5 0.00% 37 1 0.00% 38 1 0.00% 39 2 0.00% 40 4 0.00% 41 2 0.00% 42 4 0.00% 43 5 0.00% 44 3 0.00% 45 7 0.00% 46 4 0.00% 47 11 0.00% 48 6 0.00% 49 16 0.00% 50 7 0.00% 51 18 0.00% 52 21 0.00% 53 21 0.00% 54 25 0.00% 55 30 0.00% 56 32 0.00% 57 57 0.00% 58 61 0.00% 59 60 0.00% 60 64 0.00% 61 89 0.00% 62 94 0.00% 63 111 0.00% 64 156 0.00% 65 157 0.00% 66 178 0.00% 67 217 0.00% 68 229 0.00% 69 279 0.00% 70 314 0.00% 71 388 0.00% 72 544 0.00% 73 558 0.00% 74 624 0.00% 75 794 0.00% 76 817 0.00% 77 985 0.01% 78 1103 0.01% 79 1290 0.01% 80 1584 0.01% 81 1744 0.01% 82 2038 0.01% 83 2321 0.01% 84 2701 0.02% 85 3141 0.02% 86 3373 0.02% 87 3819 0.02% 88 4262 0.02% 89 4657 0.03% 90 5356 0.03% 91 5981 0.03% 92 6673 0.04% 93 7539 0.04% 94 8228 0.05% 95 9071 0.05% 96 10049 0.06% 97 10658 0.06% 98 11502 0.07% 99 12311 0.07% 100 13136 0.08% 101 14353 0.08% 102 15555 0.09% 103 17001 0.10% 104 18140 0.11% 105 19481 0.11% 106 20744 0.12% 107 21780 0.13% 108 23173 0.13% 109 23748 0.14% 110 25137 0.15% 111 26280 0.15% 112 27975 0.16% 113 28943 0.17% 114 31098 0.18% 115 33376 0.19% 116 35747 0.21% 117 38969 0.23% 118 39932 0.23% 119 39097 0.23% 120 39069 0.23% 121 40420 0.23% 122 41694 0.24% 123 43825 0.25% 124 45391 0.26% 125 46869 0.27% 126 48363 0.28% 127 50487 0.29% 128 51492 0.30% 129 52461 0.30% 130 54376 0.32% 131 54949 0.32% 132 56349 0.33% 133 57416 0.33% 134 59895 0.35% 135 61362 0.36% 136 63365 0.37% 137 64387 0.37% 138 65616 0.38% 139 66568 0.39% 140 67682 0.39% 141 72408 0.42% 142 75648 0.44% 143 72092 0.42% 144 75032 0.44% 145 80041 0.47% 146 75129 0.44% 147 79508 0.46% 148 78400 0.46% 149 79424 0.46% 150 82017 0.48% 151 14662619 85.23% 17204442 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=22 prefix-density=0.40 prefix-fanout=3.3 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=24.39 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.7 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=166.55 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=25.2 sequence=GAGAAGAAGGAT SRR7171462 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:00:57 Started mapping on | Feb 14 10:00:57 Finished on | Feb 14 10:03:41 Mapping speed, Million of reads per hour | 377.66 Number of input reads | 17204442 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16068037 Uniquely mapped reads % | 93.39% Average mapped length | 294.44 Number of splices: Total | 15444477 Number of splices: Annotated (sjdb) | 15155382 Number of splices: GT/AG | 15202041 Number of splices: GC/AG | 189838 Number of splices: AT/AC | 12143 Number of splices: Non-canonical | 40455 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451106 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 151544 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685302 685302 685302 N_multimapping 451106 451106 451106 N_noFeature 348150 15925578 401592 N_ambiguous 162313 874 72739 UnstrandedReadsAssigned:15557574 PositiveStrandReadsAssigned:141585 NegativeStrandReadsAssigned:15593706 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171462-trimmed-pair1.fastq SRR7171462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,204,442 reads, 15,737,121 reads pseudoaligned [quant] estimated average fragment length: 217.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7171462.ke.tsv 34699 SRR7171462.se.tsv 87100 total ==> SRR7171462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.29 1336 39.0925 Potri.005G024800.1.v4.1 1035 818.293 447 28.7919 Potri.004G059700.1.v4.1 961 744.293 31 2.19528 Potri.007G009000.2.v4.1 1416 1199.29 0 0 Potri.003G141000.2.v4.1 2943 2726.29 500 9.6665 Potri.016G087400.1.v4.1 270 86.9104 1450 879.362 Potri.015G069301.1.v4.1 564 348.882 0 0 Potri.010G195200.1.v4.1 1773 1556.29 321.76 10.8971 Potri.012G127500.1.v4.1 977 760.293 3930 272.448 ==> SRR7171462.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 590 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 275 SRR7171462 completed mapping pipeline successfully