Starting /dee2/code/volunteer_pipeline.sh SRR7171463 current disk space = 3115125223424 free memory = 1578140680 SRR7171463 SRAfilesize 2fb231ea8c5f9ff9fe4db06840b527aa SRR7171463.sra SRR7171463.sra file validated SRR7171463 is paired end SRR7171463 is conventional basespace SRR7171463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.74 32.0 25.0 33.0 18.0 33.0 2 31.61725 33.0 31.0 33.0 28.0 34.0 3 31.86 33.0 32.0 33.0 28.0 34.0 4 31.387 33.0 31.0 33.0 29.0 34.0 5 32.4275 33.0 33.0 33.0 32.0 34.0 6 36.9795 38.0 37.0 38.0 36.0 38.0 7 37.16975 38.0 38.0 38.0 36.0 38.0 8 37.38975 38.0 38.0 38.0 37.0 38.0 9 37.52 38.0 38.0 38.0 37.0 38.0 10-14 37.506299999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.511700000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.4875 38.0 38.0 38.0 37.8 38.0 25-29 37.4326 38.0 38.0 38.0 37.0 38.0 30-34 37.38805 38.0 38.0 38.0 37.0 38.0 35-39 37.367399999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.346849999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.34835 38.0 38.0 38.0 37.0 38.0 50-54 37.3129 38.0 38.0 38.0 37.0 38.0 55-59 37.221349999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.0966 38.0 38.0 38.0 36.0 38.0 65-69 37.06615 38.0 38.0 38.0 36.0 38.0 70-74 37.029399999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.01305 38.0 38.0 38.0 36.0 38.0 80-84 36.817750000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.7153 38.0 38.0 38.0 34.8 38.0 90-94 36.66915 38.0 38.0 38.0 34.2 38.0 95-99 36.70515 38.0 38.0 38.0 34.6 38.0 100-104 36.48010000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.298199999999994 38.0 37.8 38.0 33.8 38.0 110-114 36.21945 38.0 37.0 38.0 33.0 38.0 115-119 36.0612 38.0 37.0 38.0 32.6 38.0 120-124 35.7294 38.0 36.6 38.0 31.0 38.0 125-129 35.75615 38.0 36.0 38.0 31.0 38.0 130-134 35.73015 38.0 36.0 38.0 31.0 38.0 135-139 35.448800000000006 38.0 36.0 38.0 30.2 38.0 140-144 35.068250000000006 38.0 35.0 38.0 28.0 38.0 145-149 34.80125 38.0 35.0 38.0 26.6 38.0 150-151 32.597875 36.5 29.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 9.0 25 10.0 26 12.0 27 17.0 28 21.0 29 33.0 30 40.0 31 65.0 32 64.0 33 117.0 34 175.0 35 305.0 36 657.0 37 2469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.505228258097425 13.516959959194082 9.716908951798011 37.26090283091048 2 20.190142606955217 14.861145859394545 32.07405554165624 32.874655991994 3 20.200000000000003 18.425 24.275 37.1 4 22.825 26.075 23.45 27.650000000000002 5 22.95 31.4 24.224999999999998 21.425 6 19.275000000000002 34.55 25.775 20.4 7 14.899999999999999 27.800000000000004 39.125 18.175 8 17.675 26.924999999999997 31.775 23.625 9 16.650000000000002 26.0 33.95 23.400000000000002 10-14 19.950000000000003 29.849999999999998 26.534999999999997 23.665 15-19 20.200000000000003 28.255000000000003 27.944999999999997 23.599999999999998 20-24 20.095 28.565 28.199999999999996 23.14 25-29 19.79 28.349999999999998 27.755000000000003 24.104999999999997 30-34 19.495 28.67 28.215 23.62 35-39 20.355 28.73 27.77 23.145 40-44 19.869999999999997 28.294999999999998 27.62 24.215 45-49 19.775000000000002 29.03 27.200000000000003 23.995 50-54 20.07 28.95 27.045 23.935000000000002 55-59 20.395 29.270000000000003 26.55 23.785 60-64 19.919999999999998 28.444999999999997 27.639999999999997 23.995 65-69 19.906990699069908 28.457845784578456 27.85778577857786 23.77737773777378 70-74 20.256012800640033 27.931396569828493 27.85639281964098 23.956197809890494 75-79 20.32 28.645 27.250000000000004 23.785 80-84 20.185 27.91 27.694999999999997 24.21 85-89 20.54 28.050000000000004 27.47 23.94 90-94 20.59 28.09 27.639999999999997 23.68 95-99 20.68 28.275 27.450000000000003 23.595 100-104 20.41 28.42 27.265 23.905 105-109 20.665 28.365000000000002 27.389999999999997 23.580000000000002 110-114 21.187118711871186 28.267826782678267 26.58265826582658 23.962396239623963 115-119 20.92523130782696 28.597149287321834 26.80170042510628 23.675918979744935 120-124 21.326066303315166 28.121406070303518 26.541327066353315 24.011200560028 125-129 20.36 28.095 27.42 24.125 130-134 21.625 27.715 27.12 23.54 135-139 21.41 28.16 26.82 23.61 140-144 21.14 28.205000000000002 26.66 23.995 145-149 21.535 28.095 26.495 23.875 150-151 21.3 27.762500000000003 26.3625 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 5.0 26 6.0 27 7.5 28 9.5 29 12.5 30 20.0 31 22.0 32 28.5 33 43.5 34 61.0 35 75.5 36 85.0 37 102.5 38 134.0 39 170.0 40 185.0 41 204.0 42 236.0 43 258.0 44 247.5 45 243.5 46 260.5 47 251.5 48 235.0 49 208.5 50 170.5 51 142.0 52 132.5 53 107.5 54 77.5 55 64.0 56 46.5 57 31.5 58 25.0 59 19.0 60 14.0 61 11.0 62 7.5 63 6.0 64 6.0 65 5.0 66 2.5 67 2.5 68 3.5 69 1.5 70 1.0 71 2.5 72 1.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.025 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.574999999999999 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.425000000000001 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.575 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTTT 10 0.006832588 144.9875 8 CACCATT 10 0.006832588 144.9875 2 TCTTTTT 10 0.006832588 144.9875 9 >>END_MODULE SRR7171463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7115 33.0 33.0 34.0 32.0 34.0 2 32.7775 34.0 33.0 34.0 32.0 34.0 3 32.7455 34.0 33.0 34.0 32.0 34.0 4 32.80875 34.0 33.0 34.0 32.0 34.0 5 32.76675 34.0 33.0 34.0 32.0 34.0 6 36.8835 38.0 38.0 38.0 36.0 38.0 7 36.8925 38.0 38.0 38.0 36.0 38.0 8 36.94575 38.0 38.0 38.0 36.0 38.0 9 36.85025 38.0 38.0 38.0 36.0 38.0 10-14 36.7797 38.0 38.0 38.0 35.8 38.0 15-19 36.795 38.0 38.0 38.0 35.8 38.0 20-24 36.746300000000005 38.0 38.0 38.0 35.6 38.0 25-29 36.7916 38.0 38.0 38.0 36.0 38.0 30-34 36.7379 38.0 38.0 38.0 35.4 38.0 35-39 36.793099999999995 38.0 38.0 38.0 35.8 38.0 40-44 36.72935 38.0 38.0 38.0 35.2 38.0 45-49 36.6903 38.0 38.0 38.0 35.2 38.0 50-54 36.6981 38.0 38.0 38.0 35.0 38.0 55-59 36.612049999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.36675 38.0 38.0 38.0 34.0 38.0 65-69 36.452200000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.4239 38.0 38.0 38.0 34.0 38.0 75-79 36.46215 38.0 38.0 38.0 34.0 38.0 80-84 36.372749999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.1604 38.0 38.0 38.0 33.0 38.0 90-94 36.0785 38.0 38.0 38.0 32.4 38.0 95-99 36.01175 38.0 37.8 38.0 33.0 38.0 100-104 35.786950000000004 38.0 37.2 38.0 30.6 38.0 105-109 35.58435 38.0 37.0 38.0 29.4 38.0 110-114 35.43825 38.0 36.4 38.0 28.6 38.0 115-119 35.4906 38.0 36.8 38.0 29.4 38.0 120-124 35.1312 38.0 36.0 38.0 26.8 38.0 125-129 35.063599999999994 38.0 35.8 38.0 27.0 38.0 130-134 34.888850000000005 38.0 35.0 38.0 25.8 38.0 135-139 34.33935 38.0 34.8 38.0 23.0 38.0 140-144 33.88535 38.0 33.8 38.0 21.4 38.0 145-149 33.72665 38.0 33.6 38.0 19.8 38.0 150-151 31.10275 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 19.0 17 19.0 18 14.0 19 14.0 20 7.0 21 5.0 22 12.0 23 17.0 24 16.0 25 17.0 26 19.0 27 18.0 28 50.0 29 43.0 30 53.0 31 76.0 32 82.0 33 113.0 34 156.0 35 281.0 36 620.0 37 2346.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.38636933099474 21.172638436482085 15.184164369832123 25.256827862691054 2 26.724999999999998 27.250000000000004 29.775000000000002 16.25 3 21.099999999999998 29.075 30.225 19.6 4 25.1 32.2 23.125 19.575 5 24.474999999999998 35.675000000000004 22.775000000000002 17.075000000000003 6 21.25 36.125 23.7 18.925 7 20.7 22.35 36.925000000000004 20.025000000000002 8 22.325 25.974999999999998 26.85 24.85 9 22.975 25.624999999999996 28.225 23.175 10-14 23.965 28.02 26.424999999999997 21.59 15-19 23.555 28.775000000000002 26.529999999999998 21.14 20-24 23.425 28.544999999999998 26.985 21.044999999999998 25-29 23.16 28.000000000000004 27.33 21.51 30-34 24.16 28.335 26.740000000000002 20.765 35-39 23.93 27.875 27.49 20.705000000000002 40-44 24.015 27.744999999999997 27.105 21.135 45-49 23.945 28.065 27.185 20.805 50-54 23.66 27.82 27.35 21.17 55-59 23.685000000000002 27.715 27.905 20.695 60-64 23.985 27.755000000000003 27.389999999999997 20.87 65-69 24.185000000000002 27.065 27.83 20.919999999999998 70-74 24.3 27.865000000000002 27.12 20.715 75-79 23.669999999999998 28.025 27.644999999999996 20.66 80-84 23.905 27.505000000000003 27.925 20.665 85-89 23.880000000000003 27.944999999999997 27.51 20.665 90-94 24.365000000000002 27.425 27.55 20.66 95-99 23.955000000000002 27.875 27.51 20.66 100-104 24.77 27.750000000000004 27.250000000000004 20.23 105-109 24.295 27.96 27.575 20.169999999999998 110-114 24.263639545931888 27.919187878181727 26.82402360354053 20.99314897234585 115-119 24.115000000000002 28.205000000000002 27.189999999999998 20.49 120-124 24.595 27.534999999999997 28.095 19.775000000000002 125-129 24.945 27.865000000000002 27.35 19.84 130-134 24.675 28.455000000000002 27.18 19.689999999999998 135-139 25.35 27.735 27.255000000000003 19.66 140-144 25.05 27.884999999999998 27.52 19.545 145-149 26.131532883220803 27.51187796949237 27.011752938234558 19.344836209052264 150-151 26.513256628314156 27.938969484742373 26.263131565782892 19.28464232116058 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.0 27 3.0 28 4.5 29 7.5 30 10.0 31 10.0 32 14.5 33 23.0 34 31.0 35 45.5 36 60.0 37 79.0 38 117.5 39 159.5 40 196.0 41 207.0 42 236.0 43 289.5 44 304.0 45 300.0 46 282.5 47 268.0 48 260.5 49 223.0 50 171.5 51 139.5 52 120.0 53 95.5 54 79.5 55 65.0 56 48.0 57 33.5 58 22.0 59 21.5 60 14.5 61 8.5 62 9.5 63 6.0 64 5.0 65 4.5 66 2.5 67 3.5 68 3.0 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.35 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.4875 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.6375 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670157 spots for SRR7171463.sra Written 670157 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra Read 670145 spots for SRR7171463.sra Written 670145 spots for SRR7171463.sra SRR ids: ['SRR7171463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kmwpelkj SRR7171463.sra spots: 13402912 blocks: [[1, 670145], [670146, 1340290], [1340291, 2010435], [2010436, 2680580], [2680581, 3350725], [3350726, 4020870], [4020871, 4691015], [4691016, 5361160], [5361161, 6031305], [6031306, 6701450], [6701451, 7371595], [7371596, 8041740], [8041741, 8711885], [8711886, 9382030], [9382031, 10052175], [10052176, 10722320], [10722321, 11392465], [11392466, 12062610], [12062611, 12732755], [12732756, 13402912]] SRR7171463 file size 4520106 SRR7171463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171463 SRR7171463_1.fastq SRR7171463_2.fastq Input file: SRR7171463_1.fastq Paired file: SRR7171463_2.fastq trimmed: SRR7171463-trimmed-pair1.fastq, SRR7171463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:06:42 2025 >> started Fri Feb 14 11:06:56 2025 >> done (14.581s) 13402912 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 2149 ( 0.02%) empty read pairs filtered out after trimming by size control 13400641 (99.98%) read pairs available; of these: 2116835 (15.80%) trimmed read pairs available after processing 11283806 (84.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 2 0.00% 36 1 0.00% 37 3 0.00% 38 0 0.00% 39 1 0.00% 40 2 0.00% 41 6 0.00% 42 5 0.00% 43 5 0.00% 44 5 0.00% 45 6 0.00% 46 9 0.00% 47 6 0.00% 48 8 0.00% 49 15 0.00% 50 12 0.00% 51 35 0.00% 52 17 0.00% 53 24 0.00% 54 30 0.00% 55 23 0.00% 56 27 0.00% 57 51 0.00% 58 70 0.00% 59 64 0.00% 60 85 0.00% 61 99 0.00% 62 116 0.00% 63 134 0.00% 64 153 0.00% 65 159 0.00% 66 215 0.00% 67 232 0.00% 68 264 0.00% 69 297 0.00% 70 383 0.00% 71 438 0.00% 72 500 0.00% 73 634 0.00% 74 721 0.01% 75 850 0.01% 76 914 0.01% 77 1010 0.01% 78 1123 0.01% 79 1317 0.01% 80 1595 0.01% 81 1875 0.01% 82 2171 0.02% 83 2412 0.02% 84 2637 0.02% 85 3041 0.02% 86 3388 0.03% 87 3742 0.03% 88 4142 0.03% 89 4476 0.03% 90 5019 0.04% 91 5634 0.04% 92 6362 0.05% 93 6982 0.05% 94 7663 0.06% 95 8361 0.06% 96 9110 0.07% 97 9735 0.07% 98 10408 0.08% 99 11269 0.08% 100 11987 0.09% 101 12972 0.10% 102 13723 0.10% 103 15475 0.12% 104 16397 0.12% 105 17423 0.13% 106 18533 0.14% 107 19306 0.14% 108 19978 0.15% 109 20896 0.16% 110 21636 0.16% 111 22926 0.17% 112 24200 0.18% 113 25830 0.19% 114 27106 0.20% 115 28863 0.22% 116 29963 0.22% 117 31303 0.23% 118 33985 0.25% 119 32684 0.24% 120 32883 0.25% 121 33945 0.25% 122 35345 0.26% 123 37109 0.28% 124 38860 0.29% 125 39508 0.29% 126 41139 0.31% 127 41798 0.31% 128 42704 0.32% 129 43378 0.32% 130 43663 0.33% 131 44952 0.34% 132 46207 0.34% 133 47794 0.36% 134 49171 0.37% 135 50922 0.38% 136 51490 0.38% 137 52368 0.39% 138 53321 0.40% 139 53618 0.40% 140 54343 0.41% 141 55941 0.42% 142 60415 0.45% 143 59470 0.44% 144 60633 0.45% 145 62670 0.47% 146 60852 0.45% 147 64952 0.48% 148 62591 0.47% 149 62734 0.47% 150 66761 0.50% 151 11283806 84.20% 13400641 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=52.48 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.1 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=31 prefix-density=0.58 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=30.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171463 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:08:09 Started mapping on | Feb 14 11:08:09 Finished on | Feb 14 11:11:06 Mapping speed, Million of reads per hour | 272.56 Number of input reads | 13400641 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11835776 Uniquely mapped reads % | 88.32% Average mapped length | 293.62 Number of splices: Total | 10789438 Number of splices: Annotated (sjdb) | 10578944 Number of splices: GT/AG | 10612899 Number of splices: GC/AG | 132538 Number of splices: AT/AC | 9104 Number of splices: Non-canonical | 34897 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322208 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 43004 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.84% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1242657 1242657 1242657 N_multimapping 322208 322208 322208 N_noFeature 278201 11721957 319834 N_ambiguous 133209 735 60593 UnstrandedReadsAssigned:11424366 PositiveStrandReadsAssigned:113084 NegativeStrandReadsAssigned:11455349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171463-trimmed-pair1.fastq SRR7171463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,400,641 reads, 11,528,685 reads pseudoaligned [quant] estimated average fragment length: 214.797 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7171463.ke.tsv 34699 SRR7171463.se.tsv 87100 total ==> SRR7171463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.2 1511 63.9385 Potri.005G024800.1.v4.1 1035 821.203 306 28.4482 Potri.004G059700.1.v4.1 961 747.208 60 6.13046 Potri.007G009000.2.v4.1 1416 1202.2 0 0 Potri.003G141000.2.v4.1 2943 2729.2 408 11.4132 Potri.016G087400.1.v4.1 270 88.4419 930 802.802 Potri.015G069301.1.v4.1 564 351.691 0 0 Potri.010G195200.1.v4.1 1773 1559.2 159 7.78535 Potri.012G127500.1.v4.1 977 763.208 6853 685.522 ==> SRR7171463.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 426 SRR7171463 completed mapping pipeline successfully