Starting /dee2/code/volunteer_pipeline.sh SRR7171464 current disk space = 3115828097024 free memory = 1495945324 SRR7171464 SRAfilesize 94a9519f599aac6f3ae9c92a6c123bf2 SRR7171464.sra SRR7171464.sra file validated SRR7171464 is paired end SRR7171464 is conventional basespace SRR7171464 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92875 34.0 33.0 34.0 32.0 34.0 2 31.8835 33.0 32.0 33.0 30.0 34.0 3 32.76125 33.0 33.0 34.0 32.0 34.0 4 33.15825 34.0 33.0 34.0 32.0 34.0 5 33.279 34.0 33.0 34.0 33.0 34.0 6 36.84275 38.0 37.0 38.0 35.0 38.0 7 37.32225 38.0 38.0 38.0 36.0 38.0 8 37.45725 38.0 38.0 38.0 37.0 38.0 9 37.52225 38.0 38.0 38.0 38.0 38.0 10-14 37.521649999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.42935 38.0 38.0 38.0 37.0 38.0 20-24 37.4461 38.0 38.0 38.0 37.2 38.0 25-29 37.30995 38.0 38.0 38.0 37.0 38.0 30-34 37.32084999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.2916 38.0 38.0 38.0 37.0 38.0 40-44 37.29085 38.0 38.0 38.0 37.0 38.0 45-49 37.364799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.269850000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.19715 38.0 38.0 38.0 36.6 38.0 60-64 37.1967 38.0 38.0 38.0 36.4 38.0 65-69 37.169599999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.0692 38.0 38.0 38.0 36.0 38.0 75-79 37.0129 38.0 38.0 38.0 36.0 38.0 80-84 36.929050000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.95235 38.0 38.0 38.0 36.0 38.0 90-94 36.9163 38.0 38.0 38.0 35.6 38.0 95-99 36.6208 38.0 38.0 38.0 34.4 38.0 100-104 36.476749999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.50375 38.0 38.0 38.0 34.0 38.0 110-114 36.437400000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.437 38.0 38.0 38.0 34.0 38.0 120-124 36.37355 38.0 38.0 38.0 33.8 38.0 125-129 36.22445 38.0 38.0 38.0 33.4 38.0 130-134 36.01595 38.0 36.8 38.0 32.8 38.0 135-139 35.75805 38.0 36.2 38.0 31.4 38.0 140-144 35.608999999999995 38.0 36.0 38.0 31.0 38.0 145-149 35.56015 38.0 36.0 38.0 31.0 38.0 150-151 33.283625 36.5 32.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 0.0 22 4.0 23 4.0 24 4.0 25 9.0 26 20.0 27 17.0 28 21.0 29 30.0 30 43.0 31 60.0 32 64.0 33 78.0 34 135.0 35 200.0 36 472.0 37 2835.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.32563394426312 11.272909866934471 9.99246798895305 37.40898819984936 2 20.175 15.1 35.125 29.599999999999998 3 20.9 19.6 25.25 34.25 4 22.6 27.250000000000004 24.125 26.025 5 22.15 31.624999999999996 23.825 22.400000000000002 6 18.95 34.55 26.375 20.125 7 15.2 24.099999999999998 41.025 19.675 8 17.875 24.8 32.2 25.124999999999996 9 17.0 24.875 34.075 24.05 10-14 20.165 28.694999999999997 27.825 23.315 15-19 20.24 27.83 27.61 24.32 20-24 19.775000000000002 28.715000000000003 28.08 23.43 25-29 19.897959183673468 28.38635454181673 28.056222488995598 23.659463785514205 30-34 20.109103648466043 28.076672839197236 27.7113257594715 24.10289775286522 35-39 20.021022073176837 28.484909154612343 28.30972521147205 23.184343560738778 40-44 20.20222244468916 28.47632395635199 27.755531084192615 23.565922514766243 45-49 19.5896922692019 28.121090818113586 27.98598949211909 24.303227420565424 50-54 20.328049207381106 28.974346151922788 27.124068610291545 23.57353603040456 55-59 20.14 28.51 27.16 24.19 60-64 20.22 28.725 27.3 23.755000000000003 65-69 20.605 28.139999999999997 27.6 23.655 70-74 20.200000000000003 28.349999999999998 27.584999999999997 23.865 75-79 20.665 28.01 27.400000000000002 23.925 80-84 20.09 28.355000000000004 27.650000000000002 23.905 85-89 20.815 27.705000000000002 27.689999999999998 23.79 90-94 20.135 28.03 27.87 23.965 95-99 20.4 28.08 27.779999999999998 23.74 100-104 20.599999999999998 28.175 27.93 23.294999999999998 105-109 20.645 27.900000000000002 27.71 23.745 110-114 21.0 27.99 27.765 23.244999999999997 115-119 20.724999999999998 28.38 27.224999999999998 23.669999999999998 120-124 20.635 27.965 27.279999999999998 24.12 125-129 20.625 28.665000000000003 26.584999999999997 24.125 130-134 20.91 28.595 26.56 23.935000000000002 135-139 20.855 28.185 26.355 24.605 140-144 20.849999999999998 28.27 26.945000000000004 23.935000000000002 145-149 20.79 28.51 26.26 24.44 150-151 21.875 27.787499999999998 26.337500000000002 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.0 23 0.0 24 0.5 25 0.5 26 0.5 27 3.0 28 6.5 29 9.0 30 13.0 31 18.5 32 23.5 33 29.0 34 37.5 35 61.0 36 88.0 37 101.5 38 125.5 39 171.0 40 200.5 41 220.5 42 256.5 43 270.0 44 266.0 45 273.0 46 284.5 47 269.5 48 227.5 49 198.0 50 186.0 51 161.0 52 127.5 53 90.0 54 63.0 55 55.5 56 42.0 57 27.5 58 20.0 59 17.5 60 11.0 61 7.0 62 7.5 63 6.5 64 5.0 65 3.5 66 2.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.04 30-34 0.095 35-39 0.105 40-44 0.11 45-49 0.075 50-54 0.015 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.237500000000001 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 6.112500000000001 0.0 0.0 0.0 0.0 130-131 6.7 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 8.0375 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171464 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5365 33.0 33.0 34.0 32.0 34.0 2 32.5505 33.0 33.0 34.0 31.0 34.0 3 32.54325 34.0 33.0 34.0 31.0 34.0 4 32.34725 34.0 33.0 34.0 31.0 34.0 5 32.44675 33.0 33.0 34.0 32.0 34.0 6 36.37025 38.0 38.0 38.0 34.0 38.0 7 36.38575 38.0 38.0 38.0 34.0 38.0 8 36.3075 38.0 38.0 38.0 34.0 38.0 9 36.565 38.0 38.0 38.0 34.0 38.0 10-14 36.5118 38.0 38.0 38.0 34.4 38.0 15-19 36.689049999999995 38.0 38.0 38.0 35.4 38.0 20-24 36.73055 38.0 38.0 38.0 36.0 38.0 25-29 36.85105 38.0 38.0 38.0 36.0 38.0 30-34 36.84815 38.0 38.0 38.0 36.0 38.0 35-39 36.82695 38.0 38.0 38.0 36.0 38.0 40-44 36.748149999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.75285 38.0 38.0 38.0 35.6 38.0 50-54 36.6438 38.0 38.0 38.0 35.4 38.0 55-59 36.65984999999999 38.0 38.0 38.0 35.2 38.0 60-64 36.574299999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.66035 38.0 38.0 38.0 35.4 38.0 70-74 36.629599999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.6321 38.0 38.0 38.0 35.0 38.0 80-84 36.6136 38.0 38.0 38.0 34.6 38.0 85-89 36.516 38.0 38.0 38.0 34.2 38.0 90-94 36.375800000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.21885 38.0 38.0 38.0 33.6 38.0 100-104 36.1418 38.0 38.0 38.0 33.8 38.0 105-109 36.00894999999999 38.0 38.0 38.0 33.0 38.0 110-114 36.03275 38.0 38.0 38.0 33.0 38.0 115-119 35.67979999999999 38.0 37.2 38.0 31.2 38.0 120-124 35.654399999999995 38.0 37.0 38.0 31.0 38.0 125-129 35.586400000000005 38.0 37.0 38.0 30.6 38.0 130-134 35.4507 38.0 36.0 38.0 30.0 38.0 135-139 35.2005 38.0 36.0 38.0 28.0 38.0 140-144 34.8795 38.0 35.2 38.0 26.6 38.0 145-149 34.49035 38.0 35.0 38.0 23.0 38.0 150-151 31.901874999999997 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 5.0 16 5.0 17 10.0 18 7.0 19 9.0 20 9.0 21 9.0 22 13.0 23 21.0 24 17.0 25 15.0 26 20.0 27 18.0 28 37.0 29 36.0 30 52.0 31 77.0 32 72.0 33 85.0 34 139.0 35 223.0 36 473.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.03355032548823 20.180270405608415 13.695543314972458 27.090635953930896 2 26.170798898071624 26.997245179063363 29.72702228900576 17.104933633859254 3 20.555833750625936 28.542814221331998 31.196795192789185 19.70455683525288 4 23.43515272909364 33.80070105157736 22.959439158738107 19.804707060590886 5 25.344352617079892 35.01126972201352 21.888304532932633 17.756073127973952 6 21.129234629861983 37.08908406524466 23.764115432873275 18.017565872020075 7 19.62897969415894 22.31135622963149 37.753823013286535 20.30584106292304 8 21.779448621553886 25.53884711779449 26.94235588972431 25.739348370927317 9 22.252885097842448 26.342197691921726 28.349222277972906 23.05569493226292 10-14 23.862325021323567 28.919773217600724 26.17028749184687 21.04761426922884 15-19 23.212404034321843 28.435947614029804 27.40227808720959 20.94937026443876 20-24 23.337181868380103 28.26665328045781 27.478540233923997 20.91762461723809 25-29 23.570998796630565 29.011231448054552 27.095868431608505 20.321901323706378 30-34 23.48139616405428 27.81311032099755 28.06349842255496 20.64199509239321 35-39 23.047657188626353 28.16880256307569 27.888466159391267 20.895074088906686 40-44 23.7038521264339 28.758202674948656 27.45078395030807 20.087161248309375 45-49 23.90214557850411 27.86244235011029 27.551634249047524 20.68377782233808 50-54 23.472152533868538 28.218765679879574 27.496236828901154 20.812844957350727 55-59 23.834144872245368 27.48356006224587 28.201395512273482 20.48089955323528 60-64 24.136892814130874 28.106182256122043 27.53914090726616 20.21778402248093 65-69 24.00360956534817 27.788639895723666 27.638241339549808 20.569509199378352 70-74 23.916854495366895 28.079138492361633 28.024042073628852 19.979964938642624 75-79 23.956351987185904 27.725498047852636 27.845630193212536 20.472519771748924 80-84 24.104104104104103 28.77877877877878 27.192192192192195 19.924924924924923 85-89 23.958333333333336 28.395432692307693 27.37880608974359 20.267427884615387 90-94 23.387622149837135 28.053119518917562 28.0430969681784 20.5161613630669 95-99 24.237407184427052 27.769416014449128 27.583784868553078 20.409391932570742 100-104 24.06570223025919 27.65722322684348 27.54671488848704 20.73035965441029 105-109 24.397227245328512 28.129395218002813 27.41109101868596 20.06228651798272 110-114 24.133427107404803 28.313071435748014 26.866271475936905 20.687229980910278 115-119 24.02812656956303 28.066298342541433 27.60924158714214 20.29633350075339 120-124 24.22980431510286 28.39438033115906 27.039638735574513 20.336176618163574 125-129 24.907305341216553 28.15913418178174 26.941577312355946 19.991983164645756 130-134 25.123966942148762 27.84372652141247 27.28274480340596 19.74956173303281 135-139 25.256930866797013 28.525592820975586 26.339800471248807 19.877675840978593 140-144 25.688027320208917 28.033346725592605 26.37605464041784 19.902571313780633 145-149 25.55639286611404 27.80708364732479 26.621451896508415 20.01507159005275 150-151 25.42692114515319 28.314917127071826 26.217980914113507 20.040180813661475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 2.0 27 3.5 28 6.0 29 6.5 30 7.0 31 15.0 32 24.0 33 27.5 34 41.0 35 63.0 36 77.5 37 95.5 38 131.0 39 150.0 40 177.5 41 232.0 42 266.5 43 279.5 44 317.0 45 321.0 46 279.0 47 257.0 48 245.5 49 218.5 50 174.0 51 132.5 52 98.5 53 85.0 54 65.0 55 44.5 56 35.5 57 28.0 58 18.0 59 12.5 60 10.5 61 6.0 62 7.0 63 8.0 64 5.0 65 2.0 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.17500000000000002 3 0.15 4 0.15 5 0.17500000000000002 6 0.375 7 0.27499999999999997 8 0.25 9 0.35000000000000003 10-14 0.345 15-19 0.35500000000000004 20-24 0.395 25-29 0.27999999999999997 30-34 0.155 35-39 0.12 40-44 0.185 45-49 0.26 50-54 0.35000000000000003 55-59 0.395 60-64 0.36 65-69 0.265 70-74 0.17500000000000002 75-79 0.11 80-84 0.1 85-89 0.16 90-94 0.22499999999999998 95-99 0.33999999999999997 100-104 0.45999999999999996 105-109 0.45999999999999996 110-114 0.47000000000000003 115-119 0.44999999999999996 120-124 0.35000000000000003 125-129 0.21 130-134 0.17500000000000002 135-139 0.265 140-144 0.44 145-149 0.475 150-151 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.8375000000000004 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 6.1375 0.0 0.0 0.0 0.0 130-131 6.737500000000001 0.0 0.0 0.0 0.0 132-133 7.3875 0.0 0.0 0.0 0.0 134-135 8.075 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTACT 10 0.006921068 144.34177 1 GCAGTTT 10 0.006921068 144.34177 4 CTGGAGG 10 0.006921068 144.34177 8 TTTACTC 10 0.006921068 144.34177 2 TGCAGTT 10 0.006921068 144.34177 3 >>END_MODULE Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101688 spots for SRR7171464.sra Written 1101688 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra Read 1101676 spots for SRR7171464.sra Written 1101676 spots for SRR7171464.sra SRR ids: ['SRR7171464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_swpu61op SRR7171464.sra spots: 22033532 blocks: [[1, 1101676], [1101677, 2203352], [2203353, 3305028], [3305029, 4406704], [4406705, 5508380], [5508381, 6610056], [6610057, 7711732], [7711733, 8813408], [8813409, 9915084], [9915085, 11016760], [11016761, 12118436], [12118437, 13220112], [13220113, 14321788], [14321789, 15423464], [15423465, 16525140], [16525141, 17626816], [17626817, 18728492], [18728493, 19830168], [19830169, 20931844], [20931845, 22033532]] SRR7171464 file size 7444740 SRR7171464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171464 SRR7171464_1.fastq SRR7171464_2.fastq Input file: SRR7171464_1.fastq Paired file: SRR7171464_2.fastq trimmed: SRR7171464-trimmed-pair1.fastq, SRR7171464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:22:54 2025 >> started Fri Feb 14 10:24:00 2025 >> done (66.011s) 22033532 read pairs processed; of these: 1124 ( 0.01%) short read pairs filtered out after trimming by size control 3080 ( 0.01%) empty read pairs filtered out after trimming by size control 22029328 (99.98%) read pairs available; of these: 3345341 (15.19%) trimmed read pairs available after processing 18683987 (84.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 5 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 7 0.00% 35 4 0.00% 36 4 0.00% 37 3 0.00% 38 5 0.00% 39 8 0.00% 40 9 0.00% 41 5 0.00% 42 7 0.00% 43 7 0.00% 44 23 0.00% 45 17 0.00% 46 8 0.00% 47 20 0.00% 48 16 0.00% 49 46 0.00% 50 33 0.00% 51 33 0.00% 52 57 0.00% 53 68 0.00% 54 60 0.00% 55 96 0.00% 56 101 0.00% 57 88 0.00% 58 114 0.00% 59 149 0.00% 60 181 0.00% 61 200 0.00% 62 258 0.00% 63 263 0.00% 64 346 0.00% 65 355 0.00% 66 452 0.00% 67 486 0.00% 68 556 0.00% 69 684 0.00% 70 827 0.00% 71 950 0.00% 72 1150 0.01% 73 1279 0.01% 74 1505 0.01% 75 1712 0.01% 76 1896 0.01% 77 2161 0.01% 78 2454 0.01% 79 2817 0.01% 80 3262 0.01% 81 3669 0.02% 82 4322 0.02% 83 4825 0.02% 84 5562 0.03% 85 6245 0.03% 86 6704 0.03% 87 7332 0.03% 88 8036 0.04% 89 8866 0.04% 90 9827 0.04% 91 10746 0.05% 92 12048 0.05% 93 13478 0.06% 94 14529 0.07% 95 15874 0.07% 96 17242 0.08% 97 18136 0.08% 98 18795 0.09% 99 20199 0.09% 100 21378 0.10% 101 23078 0.10% 102 24768 0.11% 103 26803 0.12% 104 28796 0.13% 105 30104 0.14% 106 31543 0.14% 107 32638 0.15% 108 33694 0.15% 109 34738 0.16% 110 35781 0.16% 111 37908 0.17% 112 40081 0.18% 113 42005 0.19% 114 44703 0.20% 115 47385 0.22% 116 49718 0.23% 117 54388 0.25% 118 54270 0.25% 119 52216 0.24% 120 51785 0.24% 121 53721 0.24% 122 55150 0.25% 123 57521 0.26% 124 60082 0.27% 125 62061 0.28% 126 64175 0.29% 127 65033 0.30% 128 65593 0.30% 129 66642 0.30% 130 67341 0.31% 131 67995 0.31% 132 70626 0.32% 133 72816 0.33% 134 75255 0.34% 135 76972 0.35% 136 78894 0.36% 137 79472 0.36% 138 80680 0.37% 139 81445 0.37% 140 82078 0.37% 141 87955 0.40% 142 91763 0.42% 143 87356 0.40% 144 91471 0.42% 145 97997 0.44% 146 91283 0.41% 147 97517 0.44% 148 94684 0.43% 149 95057 0.43% 150 97679 0.44% 151 18683987 84.81% 22029328 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=48.47 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=TTCCCCTCTTCGGCCTTCAAAGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGGCGCGGCTCAACGAAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCCGATAGAACTCGCA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=12 prefix-density=0.52 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=29.38 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171464 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:25:16 Started mapping on | Feb 14 10:25:17 Finished on | Feb 14 10:28:09 Mapping speed, Million of reads per hour | 461.08 Number of input reads | 22029328 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20329556 Uniquely mapped reads % | 92.28% Average mapped length | 293.62 Number of splices: Total | 19731589 Number of splices: Annotated (sjdb) | 19381238 Number of splices: GT/AG | 19415317 Number of splices: GC/AG | 251547 Number of splices: AT/AC | 14352 Number of splices: Non-canonical | 50373 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500332 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 225596 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1199441 1199441 1199441 N_multimapping 500332 500332 500332 N_noFeature 545533 20144966 616290 N_ambiguous 214621 1246 99925 UnstrandedReadsAssigned:19569402 PositiveStrandReadsAssigned:183344 NegativeStrandReadsAssigned:19613341 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171464-trimmed-pair1.fastq SRR7171464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,029,328 reads, 19,870,615 reads pseudoaligned [quant] estimated average fragment length: 221.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7171464.ke.tsv 34699 SRR7171464.se.tsv 87100 total ==> SRR7171464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.78 1558 44.6304 Potri.005G024800.1.v4.1 1035 814.785 276 17.4448 Potri.004G059700.1.v4.1 961 740.785 22 1.52944 Potri.007G009000.2.v4.1 1416 1195.78 0 0 Potri.003G141000.2.v4.1 2943 2722.78 949.687 17.9625 Potri.016G087400.1.v4.1 270 88.2569 1187 692.632 Potri.015G069301.1.v4.1 564 346.375 0 0 Potri.010G195200.1.v4.1 1773 1552.78 514.876 17.0762 Potri.012G127500.1.v4.1 977 756.785 7425 505.271 ==> SRR7171464.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 711 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 267 SRR7171464 completed mapping pipeline successfully