Starting /dee2/code/volunteer_pipeline.sh SRR7171466 current disk space = 3087540060160 free memory = 1408877176 SRR7171466 SRAfilesize 66a539d5a1b01c801ca1f79e8cca5721 SRR7171466.sra SRR7171466.sra file validated SRR7171466 is paired end SRR7171466 is conventional basespace SRR7171466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.312 32.0 28.0 33.0 18.0 33.0 2 31.56775 33.0 31.0 33.0 28.0 34.0 3 31.893 33.0 32.0 33.0 30.0 34.0 4 31.7255 33.0 31.0 33.0 29.0 34.0 5 31.6545 33.0 32.0 33.0 30.0 34.0 6 36.57075 38.0 37.0 38.0 34.0 38.0 7 36.858 38.0 37.0 38.0 35.0 38.0 8 37.34425 38.0 38.0 38.0 37.0 38.0 9 37.48 38.0 38.0 38.0 37.0 38.0 10-14 37.4347 38.0 38.0 38.0 37.4 38.0 15-19 37.47070000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.44235 38.0 38.0 38.0 37.6 38.0 25-29 37.3824 38.0 38.0 38.0 37.0 38.0 30-34 37.350300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.30865 38.0 38.0 38.0 37.0 38.0 40-44 37.22915 38.0 38.0 38.0 37.0 38.0 45-49 37.268950000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2463 38.0 38.0 38.0 37.0 38.0 55-59 37.16965 38.0 38.0 38.0 36.2 38.0 60-64 37.03185 38.0 38.0 38.0 36.0 38.0 65-69 36.96175 38.0 38.0 38.0 36.0 38.0 70-74 37.00465 38.0 38.0 38.0 35.8 38.0 75-79 37.014649999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.81445 38.0 38.0 38.0 35.0 38.0 85-89 36.59925 38.0 38.0 38.0 34.0 38.0 90-94 36.5769 38.0 38.0 38.0 34.0 38.0 95-99 36.66705 38.0 38.0 38.0 34.0 38.0 100-104 36.4465 38.0 38.0 38.0 34.0 38.0 105-109 36.28715 38.0 37.6 38.0 33.6 38.0 110-114 36.1216 38.0 37.0 38.0 33.0 38.0 115-119 35.86335 38.0 36.8 38.0 31.4 38.0 120-124 35.68755 38.0 36.4 38.0 31.0 38.0 125-129 35.500949999999996 38.0 36.0 38.0 29.8 38.0 130-134 35.537 38.0 36.0 38.0 30.6 38.0 135-139 35.264300000000006 38.0 35.6 38.0 28.8 38.0 140-144 34.91695 38.0 35.0 38.0 27.6 38.0 145-149 34.5766 38.0 34.8 38.0 24.6 38.0 150-151 32.44875 36.0 29.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 1.0 24 7.0 25 9.0 26 16.0 27 30.0 28 23.0 29 36.0 30 53.0 31 62.0 32 70.0 33 106.0 34 201.0 35 281.0 36 742.0 37 2358.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5629290617849 13.068904144419019 8.237986270022883 36.130180523773205 2 19.404106159238857 15.172759138708061 32.27341011517276 33.14972458688032 3 18.575 20.525 25.224999999999998 35.675000000000004 4 24.125 28.525 21.825 25.525 5 25.275 30.5 24.45 19.775000000000002 6 20.025000000000002 34.0 25.224999999999998 20.75 7 14.75 25.874999999999996 40.35 19.025 8 18.025 25.424999999999997 30.599999999999998 25.95 9 16.8 24.15 33.7 25.35 10-14 19.78 29.9 26.665 23.655 15-19 20.18 28.235 28.15 23.435 20-24 19.86 28.24 27.584999999999997 24.315 25-29 19.62 29.630000000000003 27.12 23.630000000000003 30-34 20.03 28.360000000000003 27.115000000000002 24.495 35-39 20.1 28.275 27.305 24.32 40-44 20.265 28.52 27.63 23.585 45-49 19.900000000000002 28.62 27.439999999999998 24.04 50-54 19.91 28.32 27.255000000000003 24.515 55-59 20.315 28.17 27.725 23.79 60-64 20.375 28.16 27.62 23.845 65-69 20.05700570057006 28.092809280928094 27.61276127612761 24.237423742374236 70-74 20.067006700670067 27.672767276727672 28.04280428042804 24.217421742174217 75-79 20.215 28.560000000000002 27.200000000000003 24.025 80-84 20.49 27.655 27.61 24.245 85-89 20.41 27.845 27.73 24.015 90-94 20.925 27.235 27.939999999999998 23.9 95-99 20.01 28.185 27.765 24.04 100-104 20.635 27.755000000000003 27.735 23.875 105-109 20.44 27.58 27.785 24.195 110-114 20.954190838167634 27.60552110422084 27.800560112022403 23.63972794558912 115-119 21.3367352043624 28.26554605032768 26.674671069087996 23.723047676221924 120-124 20.73603680184009 27.841392069603483 27.35636781839092 24.066203310165506 125-129 21.23 27.62 27.47 23.68 130-134 21.04 27.589999999999996 27.195000000000004 24.175 135-139 21.08 28.355000000000004 27.034999999999997 23.53 140-144 21.115000000000002 27.595 27.229999999999997 24.060000000000002 145-149 20.794999999999998 28.139999999999997 26.505000000000003 24.560000000000002 150-151 21.15 27.925 26.987499999999997 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 2.0 27 2.5 28 3.5 29 9.0 30 14.0 31 13.5 32 20.0 33 36.5 34 53.0 35 65.0 36 80.0 37 98.5 38 112.5 39 139.5 40 187.5 41 226.0 42 229.5 43 257.0 44 286.5 45 269.0 46 271.0 47 273.0 48 245.5 49 223.5 50 188.5 51 155.5 52 132.5 53 100.5 54 75.5 55 57.5 56 38.5 57 27.0 58 24.0 59 20.5 60 13.5 61 7.0 62 8.0 63 7.5 64 5.5 65 4.5 66 3.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.055 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.2125000000000004 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61625 33.0 33.0 34.0 32.0 34.0 2 32.61575 34.0 33.0 34.0 31.0 34.0 3 32.74275 34.0 33.0 34.0 32.0 34.0 4 32.74625 34.0 33.0 34.0 32.0 34.0 5 32.7815 34.0 33.0 34.0 32.0 34.0 6 36.8635 38.0 38.0 38.0 36.0 38.0 7 36.895 38.0 38.0 38.0 36.0 38.0 8 36.8815 38.0 38.0 38.0 36.0 38.0 9 36.85075 38.0 38.0 38.0 36.0 38.0 10-14 36.709 38.0 38.0 38.0 35.2 38.0 15-19 36.684999999999995 38.0 38.0 38.0 35.0 38.0 20-24 36.64675 38.0 38.0 38.0 35.2 38.0 25-29 36.6509 38.0 38.0 38.0 35.0 38.0 30-34 36.673199999999994 38.0 38.0 38.0 35.0 38.0 35-39 36.677 38.0 38.0 38.0 34.8 38.0 40-44 36.6783 38.0 38.0 38.0 35.0 38.0 45-49 36.6577 38.0 38.0 38.0 35.0 38.0 50-54 36.58845 38.0 38.0 38.0 34.4 38.0 55-59 36.53430000000001 38.0 38.0 38.0 34.2 38.0 60-64 36.386449999999996 38.0 38.0 38.0 33.8 38.0 65-69 36.35445 38.0 38.0 38.0 33.8 38.0 70-74 36.333600000000004 38.0 38.0 38.0 33.8 38.0 75-79 36.29365 38.0 38.0 38.0 33.4 38.0 80-84 36.295849999999994 38.0 38.0 38.0 33.8 38.0 85-89 36.11795 38.0 38.0 38.0 32.8 38.0 90-94 35.9085 38.0 37.4 38.0 31.0 38.0 95-99 35.91155 38.0 37.2 38.0 31.6 38.0 100-104 35.71335 38.0 37.0 38.0 30.0 38.0 105-109 35.481849999999994 38.0 37.0 38.0 29.0 38.0 110-114 35.29575 38.0 36.4 38.0 27.8 38.0 115-119 35.3463 38.0 36.6 38.0 28.6 38.0 120-124 34.905 38.0 35.4 38.0 26.0 38.0 125-129 35.051750000000006 38.0 35.4 38.0 26.8 38.0 130-134 34.82245 38.0 35.0 38.0 25.4 38.0 135-139 34.22315 38.0 34.4 38.0 22.6 38.0 140-144 33.63655 38.0 33.8 38.0 21.0 38.0 145-149 33.57685 38.0 33.4 38.0 19.6 38.0 150-151 31.019875 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 9.0 17 15.0 18 13.0 19 11.0 20 13.0 21 13.0 22 17.0 23 18.0 24 14.0 25 20.0 26 21.0 27 31.0 28 47.0 29 66.0 30 63.0 31 87.0 32 78.0 33 103.0 34 154.0 35 303.0 36 615.0 37 2286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.879608728367195 20.642086782041634 14.973664409330322 24.50464008026085 2 26.775 26.0 29.125 18.099999999999998 3 20.724999999999998 29.225 30.0 20.05 4 24.437218609304654 34.11705852926463 22.511255627813906 18.934467233616807 5 24.356089022255563 35.408852213053265 22.280570142535634 17.95448862215554 6 20.625 37.2 23.9 18.275 7 20.575 22.0 36.35 21.075 8 23.200000000000003 25.124999999999996 26.55 25.124999999999996 9 21.180295073768445 25.656414103525883 29.08227056764191 24.081020255063766 10-14 24.003401190416646 28.590006502275795 25.88405942079728 21.52253288651028 15-19 23.66183091545773 28.01400700350175 27.428714357178592 20.89544772386193 20-24 23.355838959739934 28.382095523880967 27.016754188547136 21.24531132783196 25-29 23.89 27.994999999999997 27.339999999999996 20.775 30-34 23.76 27.515 27.765 20.96 35-39 22.895 27.900000000000002 27.884999999999998 21.32 40-44 23.145 28.02 27.785 21.05 45-49 23.489697939587916 27.395479095819162 27.835567113422684 21.279255851170234 50-54 23.592077623286986 27.773331999599883 27.748324497349202 20.88626587976393 55-59 24.090658928303395 27.412818331915744 27.612948416470708 20.883574323310153 60-64 23.671570099069346 28.25477834484139 27.574302011407987 20.499349544681277 65-69 23.730932733183295 27.686921730432605 27.906976744186046 20.675168792198047 70-74 23.715 28.585 27.41 20.29 75-79 23.945 27.52 28.000000000000004 20.535 80-84 23.87 27.325 27.87 20.935000000000002 85-89 23.685000000000002 28.33 27.235 20.75 90-94 23.728559283892583 27.919187878181727 27.99419912986948 20.358053708056207 95-99 23.76569456255315 27.742484117853035 27.527387324295933 20.964433995297885 100-104 24.187978579650668 27.571192633001353 27.751363795605826 20.489464991742153 105-109 24.608299544476147 27.821995294588774 26.89593031986785 20.673774841067228 110-114 23.700290493839525 28.117800260442756 27.351497545827907 20.83041169988981 115-119 24.42320204193984 27.986587257895003 27.09073619938942 20.499474500775737 120-124 24.392196098049023 27.33866933466733 27.693846923461727 20.57528764382191 125-129 24.86 27.900000000000002 27.060000000000002 20.18 130-134 24.856242812140607 27.57637881894095 27.561378068903448 20.006000300015 135-139 25.3352011206724 27.40644386631979 27.01120672403442 20.247148288973385 140-144 25.29408820143165 27.386494468638933 26.976022425789658 20.34339490413976 145-149 25.538631125363263 27.467682132478206 27.217156027658078 19.776530714500453 150-151 25.36340852130326 26.954887218045116 27.58145363408521 20.100250626566414 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 2.5 20 2.5 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.0 27 1.0 28 4.5 29 6.5 30 6.5 31 12.0 32 18.0 33 21.0 34 32.0 35 50.0 36 69.0 37 99.5 38 128.5 39 148.0 40 191.0 41 232.5 42 269.5 43 281.5 44 285.5 45 304.5 46 282.0 47 254.0 48 235.5 49 213.0 50 181.0 51 146.0 52 128.0 53 103.0 54 70.5 55 48.5 56 41.0 57 34.0 58 16.5 59 12.0 60 13.0 61 12.0 62 11.5 63 7.5 64 4.0 65 3.0 66 2.5 67 4.0 68 3.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.034999999999999996 15-19 0.05 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.03 55-59 0.065 60-64 0.06999999999999999 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.045 100-104 0.095 105-109 0.11499999999999999 110-114 0.16999999999999998 115-119 0.095 120-124 0.05 125-129 0.0 130-134 0.005 135-139 0.06 140-144 0.11499999999999999 145-149 0.21 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.699999999999999 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.6375 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGTTA 10 0.006577216 146.82278 1 GATTGTT 10 0.006832588 144.9875 145 AGGAGGA 20 0.0059376103 28.9975 125-129 >>END_MODULE Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra Read 769565 spots for SRR7171466.sra Written 769565 spots for SRR7171466.sra Read 769548 spots for SRR7171466.sra Written 769548 spots for SRR7171466.sra SRR ids: ['SRR7171466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wd0_rodj SRR7171466.sra spots: 15390977 blocks: [[1, 769548], [769549, 1539096], [1539097, 2308644], [2308645, 3078192], [3078193, 3847740], [3847741, 4617288], [4617289, 5386836], [5386837, 6156384], [6156385, 6925932], [6925933, 7695480], [7695481, 8465028], [8465029, 9234576], [9234577, 10004124], [10004125, 10773672], [10773673, 11543220], [11543221, 12312768], [12312769, 13082316], [13082317, 13851864], [13851865, 14621412], [14621413, 15390977]] SRR7171466 file size 5193796 SRR7171466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171466 SRR7171466_1.fastq SRR7171466_2.fastq Input file: SRR7171466_1.fastq Paired file: SRR7171466_2.fastq trimmed: SRR7171466-trimmed-pair1.fastq, SRR7171466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:00:50 2025 >> started Thu Feb 13 19:01:08 2025 >> done (18.429s) 15390977 read pairs processed; of these: 152 ( 0.00%) short read pairs filtered out after trimming by size control 1344 ( 0.01%) empty read pairs filtered out after trimming by size control 15389481 (99.99%) read pairs available; of these: 1804928 (11.73%) trimmed read pairs available after processing 13584553 (88.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 1 0.00% 34 1 0.00% 35 0 0.00% 36 3 0.00% 37 2 0.00% 38 3 0.00% 39 3 0.00% 40 2 0.00% 41 1 0.00% 42 1 0.00% 43 4 0.00% 44 5 0.00% 45 6 0.00% 46 4 0.00% 47 5 0.00% 48 7 0.00% 49 7 0.00% 50 7 0.00% 51 10 0.00% 52 13 0.00% 53 15 0.00% 54 17 0.00% 55 20 0.00% 56 33 0.00% 57 32 0.00% 58 44 0.00% 59 48 0.00% 60 64 0.00% 61 87 0.00% 62 91 0.00% 63 107 0.00% 64 105 0.00% 65 118 0.00% 66 173 0.00% 67 167 0.00% 68 179 0.00% 69 210 0.00% 70 290 0.00% 71 329 0.00% 72 342 0.00% 73 472 0.00% 74 521 0.00% 75 600 0.00% 76 736 0.00% 77 788 0.01% 78 814 0.01% 79 1033 0.01% 80 1208 0.01% 81 1406 0.01% 82 1589 0.01% 83 1877 0.01% 84 1952 0.01% 85 2277 0.01% 86 2501 0.02% 87 2755 0.02% 88 3056 0.02% 89 3305 0.02% 90 3796 0.02% 91 4332 0.03% 92 4871 0.03% 93 5464 0.04% 94 5928 0.04% 95 6442 0.04% 96 7027 0.05% 97 7352 0.05% 98 7892 0.05% 99 8374 0.05% 100 9067 0.06% 101 9751 0.06% 102 10939 0.07% 103 11800 0.08% 104 12696 0.08% 105 13613 0.09% 106 14195 0.09% 107 14508 0.09% 108 15449 0.10% 109 15963 0.10% 110 16728 0.11% 111 17697 0.11% 112 18759 0.12% 113 20555 0.13% 114 21518 0.14% 115 22948 0.15% 116 23766 0.15% 117 25548 0.17% 118 28298 0.18% 119 26424 0.17% 120 26380 0.17% 121 27336 0.18% 122 28919 0.19% 123 30199 0.20% 124 31853 0.21% 125 32714 0.21% 126 33827 0.22% 127 35097 0.23% 128 35561 0.23% 129 35901 0.23% 130 37097 0.24% 131 37744 0.25% 132 39009 0.25% 133 40720 0.26% 134 42628 0.28% 135 44234 0.29% 136 45785 0.30% 137 46109 0.30% 138 47138 0.31% 139 47658 0.31% 140 47818 0.31% 141 49683 0.32% 142 55584 0.36% 143 53669 0.35% 144 55669 0.36% 145 58157 0.38% 146 56366 0.37% 147 60526 0.39% 148 58247 0.38% 149 58897 0.38% 150 63245 0.41% 151 13584553 88.27% 15389481 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=3.7 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=130.53 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=21.2 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=18 prefix-density=0.51 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=85.39 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=17.2 sequence=TTGGTGCTGAGA SRR7171466 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:01:55 Started mapping on | Feb 13 19:01:55 Finished on | Feb 13 19:03:56 Mapping speed, Million of reads per hour | 457.87 Number of input reads | 15389481 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14031765 Uniquely mapped reads % | 91.18% Average mapped length | 295.72 Number of splices: Total | 13933105 Number of splices: Annotated (sjdb) | 13704763 Number of splices: GT/AG | 13717455 Number of splices: GC/AG | 173519 Number of splices: AT/AC | 9283 Number of splices: Non-canonical | 32848 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413146 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 139012 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944570 944570 944570 N_multimapping 413146 413146 413146 N_noFeature 269023 13908237 317870 N_ambiguous 137937 756 62771 UnstrandedReadsAssigned:13624805 PositiveStrandReadsAssigned:122772 NegativeStrandReadsAssigned:13651124 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171466-trimmed-pair1.fastq SRR7171466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,389,481 reads, 13,834,335 reads pseudoaligned [quant] estimated average fragment length: 229.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR7171466.ke.tsv 34699 SRR7171466.se.tsv 87100 total ==> SRR7171466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.23 910 34.6319 Potri.005G024800.1.v4.1 1035 806.228 157 13.26 Potri.004G059700.1.v4.1 961 732.241 14 1.30189 Potri.007G009000.2.v4.1 1416 1187.23 0 0 Potri.003G141000.2.v4.1 2943 2714.23 514 12.8949 Potri.016G087400.1.v4.1 270 83.0146 1088 892.432 Potri.015G069301.1.v4.1 564 338.116 0 0 Potri.010G195200.1.v4.1 1773 1544.23 157 6.92292 Potri.012G127500.1.v4.1 977 748.241 2307 209.946 ==> SRR7171466.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 514 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 127 SRR7171466 completed mapping pipeline successfully