Starting /dee2/code/volunteer_pipeline.sh SRR7171468 current disk space = 3087454920704 free memory = 1435013876 SRR7171468 SRAfilesize 81d26fd778bf6aea94e25c0f879616b1 SRR7171468.sra SRR7171468.sra file validated SRR7171468 is paired end SRR7171468 is conventional basespace SRR7171468 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.05925 31.0 18.0 33.0 18.0 33.0 2 31.675 33.0 32.0 33.0 27.0 33.0 3 32.0165 33.0 32.0 33.0 31.0 33.0 4 31.788 33.0 32.0 33.0 30.0 34.0 5 32.44475 33.0 33.0 33.0 32.0 34.0 6 36.7675 38.0 37.0 38.0 35.0 38.0 7 37.372 38.0 38.0 38.0 37.0 38.0 8 37.33075 38.0 38.0 38.0 37.0 38.0 9 37.49825 38.0 38.0 38.0 37.0 38.0 10-14 37.51174999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.54935 38.0 38.0 38.0 38.0 38.0 20-24 37.53985 38.0 38.0 38.0 38.0 38.0 25-29 37.392649999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.3221 38.0 38.0 38.0 37.0 38.0 35-39 37.29345 38.0 38.0 38.0 37.0 38.0 40-44 37.34485 38.0 38.0 38.0 37.2 38.0 45-49 37.487049999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.411500000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.26245 38.0 38.0 38.0 36.8 38.0 60-64 37.1281 38.0 38.0 38.0 36.2 38.0 65-69 37.222500000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.28715 38.0 38.0 38.0 36.6 38.0 75-79 37.220150000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.192449999999994 38.0 38.0 38.0 36.2 38.0 85-89 37.1449 38.0 38.0 38.0 36.0 38.0 90-94 37.112750000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.915150000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.8453 38.0 38.0 38.0 35.0 38.0 105-109 36.866200000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.61945000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.3581 38.0 38.0 38.0 33.8 38.0 120-124 36.3304 38.0 37.8 38.0 33.8 38.0 125-129 36.25035 38.0 37.4 38.0 33.4 38.0 130-134 36.185900000000004 38.0 37.6 38.0 33.2 38.0 135-139 35.88965 38.0 36.0 38.0 32.4 38.0 140-144 35.763 38.0 36.0 38.0 31.6 38.0 145-149 35.3985 38.0 35.6 38.0 30.4 38.0 150-151 33.3095 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 4.0 25 5.0 26 10.0 27 18.0 28 22.0 29 25.0 30 33.0 31 38.0 32 61.0 33 87.0 34 141.0 35 235.0 36 579.0 37 2739.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.64613072877536 10.49336338592537 10.443275732531932 38.417230152767345 2 22.225 13.575000000000001 34.300000000000004 29.9 3 21.825 19.55 25.650000000000002 32.975 4 24.95 25.224999999999998 23.375 26.450000000000003 5 22.6 30.575000000000003 25.124999999999996 21.7 6 19.775000000000002 33.575 26.224999999999998 20.424999999999997 7 15.299999999999999 25.775 41.25 17.675 8 19.325 25.324999999999996 30.375000000000004 24.975 9 16.8 24.45 34.949999999999996 23.799999999999997 10-14 19.86 29.015 27.38 23.745 15-19 19.36 28.044999999999998 28.199999999999996 24.395 20-24 20.315 28.235 27.93 23.52 25-29 19.256925692569258 28.537853785378537 28.04280428042804 24.162416241624165 30-34 19.24365964684108 28.572857786003702 28.01260567255265 24.17087689460257 35-39 19.85481852315394 28.150187734668336 28.34543178973717 23.64956195244055 40-44 20.51833691899735 28.523540301195776 27.74303297143143 23.215089808375446 45-49 20.245122561280642 28.07903951975988 27.75887943971986 23.916958479239618 50-54 20.544999999999998 28.139999999999997 27.71 23.605 55-59 19.82 28.58 27.615000000000002 23.985 60-64 19.650000000000002 27.875 28.07 24.404999999999998 65-69 20.025000000000002 28.07 27.77 24.135 70-74 19.655 28.26 28.015 24.07 75-79 19.735 28.15 28.23 23.885 80-84 20.305 27.889999999999997 28.01 23.794999999999998 85-89 20.415 28.095 27.85 23.64 90-94 20.075000000000003 27.61 28.544999999999998 23.77 95-99 20.315 27.63 28.175 23.880000000000003 100-104 20.155 27.900000000000002 27.939999999999998 24.005000000000003 105-109 20.32 28.075 28.044999999999998 23.56 110-114 21.13 27.794999999999998 27.389999999999997 23.685000000000002 115-119 20.74 27.96 27.615000000000002 23.685000000000002 120-124 21.26 27.87 26.88 23.990000000000002 125-129 21.015 27.765 27.52 23.7 130-134 21.035 27.485 27.265 24.215 135-139 20.669999999999998 28.125 26.55 24.654999999999998 140-144 20.82 28.29 26.61 24.279999999999998 145-149 20.585 28.27 26.72 24.425 150-151 20.6375 27.700000000000003 27.275 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 3.5 27 6.5 28 7.0 29 9.0 30 14.0 31 21.0 32 32.0 33 39.5 34 42.5 35 57.0 36 76.5 37 90.5 38 112.0 39 144.0 40 184.0 41 226.0 42 250.5 43 272.0 44 308.0 45 316.0 46 304.5 47 265.0 48 215.5 49 208.5 50 181.5 51 150.5 52 128.0 53 91.0 54 67.0 55 48.5 56 32.5 57 25.5 58 19.5 59 10.0 60 6.5 61 6.0 62 5.5 63 4.0 64 3.5 65 4.0 66 2.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.045 35-39 0.125 40-44 0.065 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.7875 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.487500000000001 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTAAA 10 0.006830828 145.0 1 >>END_MODULE SRR7171468 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92175 33.0 33.0 34.0 32.0 34.0 2 32.90825 34.0 33.0 34.0 32.0 34.0 3 33.014 34.0 33.0 34.0 32.0 34.0 4 32.95475 34.0 33.0 34.0 32.0 34.0 5 32.8875 34.0 33.0 34.0 32.0 34.0 6 37.082 38.0 38.0 38.0 37.0 38.0 7 36.99275 38.0 38.0 38.0 37.0 38.0 8 37.12575 38.0 38.0 38.0 37.0 38.0 9 37.0345 38.0 38.0 38.0 37.0 38.0 10-14 36.9802 38.0 38.0 38.0 36.4 38.0 15-19 36.95745 38.0 38.0 38.0 36.2 38.0 20-24 36.983399999999996 38.0 38.0 38.0 36.6 38.0 25-29 36.9969 38.0 38.0 38.0 36.8 38.0 30-34 37.14275 38.0 38.0 38.0 37.0 38.0 35-39 37.16495 38.0 38.0 38.0 37.0 38.0 40-44 37.16415 38.0 38.0 38.0 37.0 38.0 45-49 37.0664 38.0 38.0 38.0 36.8 38.0 50-54 36.95745000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.91345 38.0 38.0 38.0 36.0 38.0 60-64 36.74640000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.8529 38.0 38.0 38.0 35.8 38.0 70-74 36.87010000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.959399999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.90985 38.0 38.0 38.0 36.0 38.0 85-89 36.83435000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.77905 38.0 38.0 38.0 35.6 38.0 95-99 36.66615 38.0 38.0 38.0 35.0 38.0 100-104 36.50535000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.41615 38.0 38.0 38.0 34.0 38.0 110-114 36.1671 38.0 38.0 38.0 33.2 38.0 115-119 35.92985 38.0 37.6 38.0 32.6 38.0 120-124 35.7708 38.0 37.2 38.0 31.4 38.0 125-129 35.7615 38.0 37.0 38.0 31.0 38.0 130-134 35.6555 38.0 36.2 38.0 31.0 38.0 135-139 35.31345 38.0 35.8 38.0 29.4 38.0 140-144 34.98125 38.0 35.2 38.0 27.4 38.0 145-149 34.682599999999994 38.0 35.0 38.0 24.4 38.0 150-151 32.308749999999996 36.5 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 3.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 5.0 17 3.0 18 7.0 19 2.0 20 2.0 21 6.0 22 9.0 23 13.0 24 11.0 25 19.0 26 18.0 27 23.0 28 22.0 29 40.0 30 37.0 31 58.0 32 70.0 33 81.0 34 132.0 35 178.0 36 539.0 37 2715.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 20.349999999999998 16.375 27.575 2 25.20692249811889 26.962628542763984 29.0945573112616 18.735891647855528 3 20.948319116909182 29.52834922227797 28.6001003512293 20.923231309583542 4 23.783241344706475 33.01555444054189 23.507275464124437 19.693928750627197 5 24.761665830406425 35.69994982438535 22.05218263923733 17.486201705970895 6 20.881321982974463 37.456184276414625 23.910866299449175 17.751627441161745 7 20.240480961923847 21.54308617234469 38.15130260521042 20.06513026052104 8 21.763085399449036 25.31930879038317 27.87377911344853 25.043826696719258 9 22.138742799899823 26.421237165038818 27.998998246932132 23.441021788129227 10-14 23.51643945469126 28.944466720128307 25.982357658380113 21.556736166800324 15-19 23.331328923631993 28.20204449789537 27.435357787131693 21.031268791340953 20-24 23.509950373452305 28.23199157852524 27.14421775527595 21.113840292746502 25-29 23.636363636363637 28.49987478086652 27.052341597796143 20.811419984973703 30-34 22.93325321716489 28.020629913374396 27.630063592208703 21.416053277252015 35-39 23.235205767497746 28.286772804646038 27.73105036547512 20.746971062381096 40-44 23.695543314972458 27.97696544817226 27.346019028542813 20.981472208312468 45-49 23.530590770155836 28.320889913313625 27.418950744099813 20.729568572430725 50-54 23.70162422297975 28.539201925005013 27.085422097453378 20.673751754561863 55-59 24.36591478696742 28.075187969924816 27.157894736842103 20.401002506265662 60-64 23.37844611528822 28.25563909774436 27.328320802005013 21.037593984962406 65-69 23.63845884062328 28.177764417054963 27.696778395711206 20.48699834661055 70-74 23.90466175955135 28.431225276651144 26.83891642882179 20.825196534975714 75-79 23.358503775566337 28.18422763414512 27.72415862379357 20.733109966494975 80-84 23.65854878231735 28.219232884932737 27.319097864679705 20.80312046807021 85-89 23.598317981577893 28.55927112535042 27.6331597917501 20.209251101321584 90-94 24.036054081121684 28.087130696044067 28.062093139709564 19.814722083124686 95-99 23.466626578472642 28.7632792142714 27.51052315093205 20.259571056323914 100-104 23.786359077231694 28.32998996990973 27.347041123370108 20.536609829488466 105-109 24.02568089481868 27.57185133169484 28.063399709083615 20.33906806440287 110-114 24.02327097647826 29.008475851346603 27.162846682381264 19.80540648979387 115-119 24.461044821016745 27.93542564925298 27.43407199438484 20.169457535345433 120-124 24.551468377267717 28.535631953493034 26.340583341685875 20.572316327553374 125-129 24.882323485227843 28.202303455182776 26.91537305958938 20.0 130-134 25.23284927391087 28.758137205808715 26.344516775162745 19.664496745117678 135-139 24.78328406073057 28.726762539459838 26.687377862404173 19.802575537405424 140-144 25.110330992978934 28.761283851554666 26.860581745235706 19.26780341023069 145-149 26.00431315512313 28.09067656351873 26.646271126937158 19.258739154420983 150-151 25.031351893654374 28.216704288939056 26.63656884875846 20.115374968648105 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 1.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 2.0 27 2.0 28 2.0 29 5.5 30 9.0 31 9.0 32 11.0 33 20.5 34 31.5 35 46.5 36 69.0 37 93.0 38 134.0 39 177.5 40 215.0 41 244.5 42 280.0 43 294.5 44 284.5 45 282.0 46 277.0 47 259.5 48 239.0 49 222.5 50 190.5 51 150.0 52 113.0 53 84.5 54 60.5 55 49.0 56 34.5 57 22.5 58 20.0 59 14.0 60 9.5 61 7.0 62 6.0 63 5.0 64 3.0 65 1.5 66 0.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.35000000000000003 4 0.35000000000000003 5 0.35000000000000003 6 0.15 7 0.2 8 0.17500000000000002 9 0.17500000000000002 10-14 0.24 15-19 0.22 20-24 0.255 25-29 0.17500000000000002 30-34 0.145 35-39 0.13 40-44 0.15 45-49 0.215 50-54 0.26 55-59 0.25 60-64 0.25 65-69 0.20500000000000002 70-74 0.145 75-79 0.015 80-84 0.015 85-89 0.12 90-94 0.15 95-99 0.22 100-104 0.3 105-109 0.315 110-114 0.305 115-119 0.27 120-124 0.22999999999999998 125-129 0.15 130-134 0.15 135-139 0.215 140-144 0.3 145-149 0.305 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.300000000000001 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.487500000000001 0.0 0.0 0.0 0.0 134-135 8.0625 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058051 spots for SRR7171468.sra Written 1058051 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra Read 1058040 spots for SRR7171468.sra Written 1058040 spots for SRR7171468.sra SRR ids: ['SRR7171468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7f28c79 SRR7171468.sra spots: 21160811 blocks: [[1, 1058040], [1058041, 2116080], [2116081, 3174120], [3174121, 4232160], [4232161, 5290200], [5290201, 6348240], [6348241, 7406280], [7406281, 8464320], [8464321, 9522360], [9522361, 10580400], [10580401, 11638440], [11638441, 12696480], [12696481, 13754520], [13754521, 14812560], [14812561, 15870600], [15870601, 16928640], [16928641, 17986680], [17986681, 19044720], [19044721, 20102760], [20102761, 21160811]] SRR7171468 file size 7149004 SRR7171468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171468 SRR7171468_1.fastq SRR7171468_2.fastq Input file: SRR7171468_1.fastq Paired file: SRR7171468_2.fastq trimmed: SRR7171468-trimmed-pair1.fastq, SRR7171468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:07:00 2025 >> started Thu Feb 13 19:07:35 2025 >> done (35.296s) 21160811 read pairs processed; of these: 619 ( 0.00%) short read pairs filtered out after trimming by size control 2729 ( 0.01%) empty read pairs filtered out after trimming by size control 21157463 (99.98%) read pairs available; of these: 3114198 (14.72%) trimmed read pairs available after processing 18043265 (85.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 3 0.00% 37 6 0.00% 38 2 0.00% 39 5 0.00% 40 1 0.00% 41 5 0.00% 42 7 0.00% 43 12 0.00% 44 10 0.00% 45 12 0.00% 46 13 0.00% 47 21 0.00% 48 17 0.00% 49 25 0.00% 50 26 0.00% 51 34 0.00% 52 40 0.00% 53 34 0.00% 54 48 0.00% 55 42 0.00% 56 62 0.00% 57 70 0.00% 58 77 0.00% 59 95 0.00% 60 106 0.00% 61 141 0.00% 62 180 0.00% 63 183 0.00% 64 247 0.00% 65 281 0.00% 66 334 0.00% 67 381 0.00% 68 415 0.00% 69 483 0.00% 70 593 0.00% 71 626 0.00% 72 825 0.00% 73 969 0.00% 74 1116 0.01% 75 1259 0.01% 76 1402 0.01% 77 1608 0.01% 78 1763 0.01% 79 2030 0.01% 80 2374 0.01% 81 2745 0.01% 82 3203 0.02% 83 3718 0.02% 84 4241 0.02% 85 4685 0.02% 86 5285 0.02% 87 5728 0.03% 88 6186 0.03% 89 7051 0.03% 90 7508 0.04% 91 8325 0.04% 92 9675 0.05% 93 10675 0.05% 94 11782 0.06% 95 12913 0.06% 96 14003 0.07% 97 14720 0.07% 98 15628 0.07% 99 16918 0.08% 100 17879 0.08% 101 19075 0.09% 102 20578 0.10% 103 22492 0.11% 104 24054 0.11% 105 25605 0.12% 106 26870 0.13% 107 28186 0.13% 108 29187 0.14% 109 30501 0.14% 110 31666 0.15% 111 33267 0.16% 112 35047 0.17% 113 37082 0.18% 114 39335 0.19% 115 41428 0.20% 116 43726 0.21% 117 48726 0.23% 118 49346 0.23% 119 49614 0.23% 120 47889 0.23% 121 49258 0.23% 122 51033 0.24% 123 53110 0.25% 124 55270 0.26% 125 57126 0.27% 126 59496 0.28% 127 61079 0.29% 128 61856 0.29% 129 62823 0.30% 130 63851 0.30% 131 65489 0.31% 132 67010 0.32% 133 69529 0.33% 134 71150 0.34% 135 73509 0.35% 136 75866 0.36% 137 76975 0.36% 138 77878 0.37% 139 78772 0.37% 140 79928 0.38% 141 88845 0.42% 142 84963 0.40% 143 91829 0.43% 144 92179 0.44% 145 90691 0.43% 146 90428 0.43% 147 93696 0.44% 148 92676 0.44% 149 94379 0.45% 150 98947 0.47% 151 18043265 85.28% 21157463 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=23 prefix-density=0.23 prefix-fanout=3.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=386.09 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=32.4 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=3.8 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=10 fanout-score=280.51 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.0 sequence=GAAGAAGAAGAAA SRR7171468 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:08:26 Started mapping on | Feb 13 19:08:26 Finished on | Feb 13 19:11:20 Mapping speed, Million of reads per hour | 437.74 Number of input reads | 21157463 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19641330 Uniquely mapped reads % | 92.83% Average mapped length | 294.28 Number of splices: Total | 20312489 Number of splices: Annotated (sjdb) | 19987113 Number of splices: GT/AG | 19995489 Number of splices: GC/AG | 254660 Number of splices: AT/AC | 14203 Number of splices: Non-canonical | 48137 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 543602 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 188311 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 972531 972531 972531 N_multimapping 543602 543602 543602 N_noFeature 415504 19478649 483576 N_ambiguous 188766 1027 93619 UnstrandedReadsAssigned:19037060 PositiveStrandReadsAssigned:161654 NegativeStrandReadsAssigned:19064135 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171468-trimmed-pair1.fastq SRR7171468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,157,463 reads, 19,233,253 reads pseudoaligned [quant] estimated average fragment length: 218.999 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7171468.ke.tsv 34699 SRR7171468.se.tsv 87100 total ==> SRR7171468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800 1052 30.2365 Potri.005G024800.1.v4.1 1035 817.001 233 14.7544 Potri.004G059700.1.v4.1 961 743.001 36 2.5067 Potri.007G009000.2.v4.1 1416 1198 0 0 Potri.003G141000.2.v4.1 2943 2725 609 11.5622 Potri.016G087400.1.v4.1 270 87.914 1749 1029.25 Potri.015G069301.1.v4.1 564 348.449 0 0 Potri.010G195200.1.v4.1 1773 1555 223 7.4193 Potri.012G127500.1.v4.1 977 759.001 4638 316.138 ==> SRR7171468.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 263 SRR7171468 completed mapping pipeline successfully